Application of TaESV in regulating and controlling carbon-nitrogen balance of wheat

Abstract

The invention discloses an application of TaESV in regulating and controlling carbon-nitrogen balance of wheat. The invention belongs to the technical field of biology, and particularly relates to application of TaESV to regulation and control of wheat carbon-nitrogen balance. The protein TaESV is any one of the following proteins: A1) a protein with an amino acid sequence as shown in SEQ ID No: 1; a2) a protein which is obtained by substitution and / or deletion and / or addition of amino acid residues on the protein of A1), has 80% or more of identity with the protein of A1) and has the same function as the protein of A1); and A3) a fusion protein obtained by connecting a protein tag to the N terminal or / and C terminal of A1) or A2). The edited wheat obtained by knocking out the TaESV protein coding gene grows well under a low-nitrogen condition.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of TaESV in regulating the carbon-nitrogen balance of wheat. Background Technology

[0002] Global environmental change has multifaceted impacts on plant nitrogen uptake. Statistics show that global annual nitrogen fertilizer consumption exceeds 100 million tons, and this figure continues to rise. This indicates that nitrogen fertilizer plays a crucial role in global agricultural production, being a key factor in improving crop yield and quality. In developing countries, nitrogen fertilizer use is increasing year by year due to lower agricultural productivity levels; while in developed countries, nitrogen fertilizer use has stabilized or declined due to technological advancements and environmental requirements. Most crops utilize nitrogen fertilizer at only 40% to 50% efficiency, meaning less than half of the applied nitrogen fertilizer is absorbed and utilized by crops. Inefficient nitrogen fertilizer use leads to significant nitrogen loss, polluting soil, groundwater, and the atmosphere. Improving nitrogen use efficiency can reduce emissions of nitrogen oxides and nitrates, protecting the ecological environment.

[0003] Nitrogen is one of the essential macronutrients for plant growth and development. It is not only a component of important biomolecules such as proteins, nucleic acids, and chlorophyll, but also plays a crucial role in plant metabolism, photosynthesis, and growth regulation. When crops grow in an environment with sufficient nitrogen fertilizer, they typically exhibit greener leaves, stronger stems, larger leaf area, faster growth rate, increased tillering (for gramineous crops), and well-developed flowers and fruits. However, nitrogen deficiency leads to stunted growth, yellowing leaves, weakened branching ability, restricted physiological metabolism, reduced photosynthetic efficiency, and decreased protein and enzyme content. Therefore, to ensure healthy crop growth and high and stable yields, it is necessary to apply nitrogen fertilizer scientifically and rationally, maintaining an appropriate nitrogen supply.

[0004] The functional research and utilization of low-nitrogen response genes are of great significance in agricultural and environmental sciences. By studying these genes, it is possible to significantly improve nitrogen use efficiency in plants, reduce nitrogen fertilizer usage, and thus lower agricultural production costs and reduce environmental pollution. Furthermore, these genes can enhance plant resistance to low-nitrogen environments, improve their survival and adaptability in poor soils or arid regions, and ensure stable growth and yield. The utilization of low-nitrogen response genes also helps promote the development of green agriculture, enabling the cultivation of high-efficiency, low-consumption crop varieties through genetic modification and molecular breeding, protecting the ecological environment, and achieving sustainable agricultural production. Simultaneously, research on low-nitrogen response genes can reveal the regulatory mechanisms of plant nitrogen and carbon metabolism, providing a deeper understanding of the molecular mechanisms and adaptability of plant carbon and nitrogen metabolism, and laying a theoretical foundation for further research. In terms of breeding technology, the use of low-nitrogen response genes can accelerate the selection of superior varieties, improve breeding efficiency, and rapidly screen and cultivate crop varieties with high nitrogen use efficiency and stress resistance, thus promoting agricultural technological progress. Finally, the research and application of low-nitrogen response genes are of great significance for ensuring food security. By cultivating low-nitrogen-tolerant, high-yielding crop varieties, the yield and quality of crops can be improved, meeting the needs of a growing population. In conclusion, the research and application of low-nitrogen response genes have a profound impact on improving agricultural production efficiency, protecting the environment, promoting green agriculture, deepening plant physiological research, accelerating the breeding process, and ensuring food security. They not only have important scientific research value but also significant practical implications for actual agricultural production and environmental protection. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to regulate the carbon-nitrogen balance of plants.

[0006] To address the problems existing in the prior art, the present invention provides a protein.

[0007] The protein provided by this invention may be any of the following:

[0008] A1) Proteins with amino acid sequences as shown in SEQ ID No:1, SEQ ID No:9 or SEQ ID No:10;

[0009] A2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the protein in A1) that has more than 80% identity with the protein shown in A1) and has the ability to regulate the carbon and nitrogen balance of plants; for example, those skilled in the art can, based on the amino acid sequence shown in SEQ ID No:1 and conventional techniques such as the conserved substitution of amino acids, obtain a protein mutant with the same function as the amino acid sequence shown in SEQ ID No:1 by substituting, deleting and / or adding one or more amino acids without affecting its activity.

[0010] A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0011] The protein described in A1 above is named TaESV.

[0012] To facilitate the purification or detection of the protein in A1), a tag protein can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in SEQ ID No:1, SEQ ID No:9, or SEQ ID No:10.

[0013] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0014] The tagged proteins include, but are not limited to: GST (glutathione thiotransferase) tagged protein, His6 tagged protein (His-tag), MBP (maltose-binding protein) tagged protein, Flag tagged protein, SUMO tagged protein, HA tagged protein, Myc tagged protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tagged protein.

[0015] Those skilled in the art can readily mutate the nucleotide sequence encoding the TaESV protein of this invention using known methods, such as directed evolution or point mutation. Any artificially modified nucleotides that have 75% or more identity with the nucleotide sequence of the TaESV protein isolated in this invention, as long as they encode and function the TaESV protein, are derived from and equivalent to the nucleotide sequence of this invention.

[0016] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0017] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained.

[0018] In this document, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0019] In this document, the 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0020] The protein mentioned above is derived from wheat (Triticum aestivum L.).

[0021] The present invention also provides biomaterials related to the above-mentioned proteins, said biomaterials may be any of the following:

[0022] B1) Nucleic acid molecules that encode the proteins described above;

[0023] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0024] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0025] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0026] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0027] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0028] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2);

[0029] C1) Nucleic acid molecules that inhibit, reduce, or silence the expression of the genes encoding the proteins described above;

[0030] C2) expresses the gene encoding the nucleic acid molecule described in C1);

[0031] C3) contains an expression cassette encoding the gene described in C2);

[0032] C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3);

[0033] C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4);

[0034] C6) A transgenic plant cell line containing the encoding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4);

[0035] C7) Transgenic plant tissue containing the encoding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4);

[0036] C8) A transgenic plant organ containing the encoding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

[0037] In the above-mentioned biological materials, the nucleic acid molecule described in B1) is a gene as shown in E1) or E2) below:

[0038] E1) The encoded sequence is a CDS sequence of SEQ ID No:2, SEQ ID No:5, or SEQ ID No:7;

[0039] E2) The nucleotide is a cDNA molecule or DNA molecule of SEQ ID No:3, SEQ ID No:6 or SEQ ID No:8.

[0040] The DNA molecule shown in SEQ ID No:2 encodes the protein TaESV-A of SEQ ID No:1.

[0041] The nucleotide sequence shown in SEQ ID No:3 is the nucleotide sequence of the gene encoding the protein TaESV-A (CDS).

[0042] The DNA molecule shown in SEQ ID No:5 encodes the protein TaESV-B, which is the protein in SEQ ID No:9.

[0043] The nucleotide sequence shown in SEQ ID No:6 is the nucleotide sequence of the gene encoding the protein TaESV-B (CDS).

[0044] The DNA molecule shown in SEQ ID No:7 encodes the protein TaESV-D, which is SEQ ID No:10.

[0045] The nucleotide sequence shown in SEQ ID No:8 is the nucleotide sequence of the protein TaESV-D encoding gene (CDS).

[0046] The TaESV gene described in this invention can be any nucleotide sequence capable of encoding the TaESV protein. Considering codon degeneracy and the codon preferences of different species, those skilled in the art can use codons suitable for expression in specific species as needed.

[0047] B1) The nucleic acid molecules may also include nucleic acid molecules obtained by codon preference modification based on the nucleotide sequences shown in SEQ ID No:2, SEQ ID No:5 or SEQ ID No:7.

[0048] B1) The nucleic acid molecule may also include nucleic acid molecules that have a nucleotide sequence identity of more than 95% with the nucleotide sequence shown in SEQ ID No:2, SEQ ID No:5 or SEQ ID No:7 and originate from the same species.

[0049] The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, CDS, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0050] The vectors described herein are well known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, it may be the vector pBUE411.

[0051] Recombinant expression vectors containing the TaESV gene can be constructed using existing plant expression vectors. These plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors suitable for plant microbombardment. The plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylate signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3' end of genes including, but not limited to, Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the Nos gene for lipase) and plant genes (such as the soybean storage protein gene).

[0052] When constructing recombinant plant expression vectors using the TaESV gene, any enhancing or constitutive promoter can be added before its transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. These can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the gene of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0053] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0054] By using any vector capable of guiding the expression of exogenous genes in plants, the TaESV gene or gene fragments provided in this invention can be introduced into plant cells or recipient plants to obtain transgenic cell lines and transgenic plants with altered carbon-nitrogen balance. The expression vector carrying the TaESV gene can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants.

[0055] As a specific embodiment, the recombinant vector described above is the recombinant vector pBUE411-sgRNA. The structure of the recombinant vector pBUE411-sgRNA is described as follows: it is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No:4 between the BsaI restriction sites of the starting vector pBUE411, while keeping the other sequences of the vector pBUE411 unchanged.

[0056] The recombinant vector pBUE411-sgRNA contains sgRNA1 and sgRNA2 expression cassettes. The sgRNA1 gene is shown as nucleotides 439-457 of SEQ ID No:4, and the sgRNA2 gene is shown as nucleotides 1351-1369 of SEQ ID No:4. Nucleotides 20-437 are the promoter for initiating sgRNA gene transcription, and nucleotides 1446-1736 are the terminator for terminating sgRNA gene transcription.

[0057] sgRNA1:5'-CCCGGACCCCACGCCGCCG-3' (target sequences are positions 129-147 of SEQ ID No:2 and positions 918-936 of SEQ ID No:3).

[0058] sgRNA2:5'-GGAGCAAGCCCATTGCCCG-3' (target sequences are positions 209-227 of SEQ ID No:2 and positions 998-1016 of SEQ ID No:3).

[0059] The microorganisms described in this article can be yeast, bacteria, algae, or fungi. Among them, bacteria can originate from genera such as *Escherichia*, *Erwinia*, *Agrobacterium*, *Flavobacterium*, *Alcaligenes*, *Pseudomonas*, and *Bacillus*. Specifically, *Agrobacterium tumefaciens* EHA105 is an example.

[0060] The recombinant microorganism may specifically be recombinant Agrobacterium EHA105 / pBUE411-sgRNA.

[0061] The recombinant Agrobacterium EHA105 / pBUE411-sgRNA is a recombinant bacterium obtained by introducing the recombinant vector pBUE411-sgRNA into Agrobacterium tumefaciens EHA105.

[0062] The present invention also provides the use of the protein TaESV described above, or the expression substance regulating the gene, or the substance regulating the activity or content of said protein, in any of the following:

[0063] Application of U1 in regulating the ability of plants to maintain carbon and nitrogen balance;

[0064] Application of U2 in the preparation of products that regulate the ability of plants to regulate carbon and nitrogen balance;

[0065] Application of U3 in cultivating plants with altered carbon-nitrogen balance;

[0066] U4) Application in the preparation of products from plants with altered carbon-nitrogen balance;

[0067] Application of U5 in plant breeding.

[0068] In this article, the substance that regulates the activity and / or content of the protein may be a substance that regulates gene expression, wherein the gene encodes the protein TaESV.

[0069] In the above applications, the substance that regulates gene expression or the substance that regulates the activity or content of the protein is a biological material related to the protein, and the biological material may be the biological material described above.

[0070] In the above text, the substance that regulates gene expression can be a substance that performs at least one of the following six types of regulation:

[0071] 1) Regulation occurring at the transcriptional level of the aforementioned gene;

[0072] 2) Regulation that occurs after the gene is transcribed (i.e., regulation of the splicing or processing of the primary transcript of the gene);

[0073] 3) Regulation of RNA transport of the gene (that is, regulation of the transport of mRNA of the gene from the nucleus to the cytoplasm);

[0074] 4) Regulation of the translation of the aforementioned genes;

[0075] 5) Regulation of mRNA degradation of the aforementioned gene;

[0076] 6) Post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0077] The present invention also provides a method for regulating the carbon-nitrogen balance capacity of plants, including regulating the activity and / or content of the proteins described above in the target plant, and / or the expression level of the genes encoding the proteins, to regulate the carbon-nitrogen balance capacity of plants.

[0078] The importation refers to the importation through recombination methods, including but not limited to Agrobacterium-mediated transformation, bio-projectile methods, electroporation, in-planta technology, and so on.

[0079] In the above applications and methods, the regulation can be to increase, enhance, or upregulate.

[0080] In the above applications and methods, the regulation can be suppression, reduction, or silencing.

[0081] To facilitate the identification and screening of transgenic cells or plants, the recombinant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color reactions, antibiotic resistance markers, or chemical reagent resistance marker genes. Alternatively, without adding any selective marker genes, transformed plants can be directly screened for resistance under stress.

[0082] The plants obtained by the above methods can be transgenic plants or plants obtained through conventional breeding techniques such as hybridization. In the above methods, the transgenic plants are understood to include not only first- and second-generation transgenic plants, but also their progeny. For transgenic plants, the gene can be propagated within the species, or it can be transferred into other varieties of the same species using conventional breeding techniques, particularly commercial varieties. The transgenic plants include seeds, callus tissue, complete plants, and cells.

[0083] This invention also provides a method for cultivating plants with altered carbon-nitrogen balance, comprising:

[0084] 1) Inhibit, reduce or silence the expression level of the coding gene of the protein described above in the target plant, or / and inhibit, reduce or silence the activity and / or content of the coding gene of the protein described above, to obtain a plant with improved carbon-nitrogen balance.

[0085] 2) Increase, enhance and / or upregulate the expression level of the coding genes of the proteins mentioned above in the target plant, or / and increase, enhance and / or upregulate the activity and / or content of the coding genes of the proteins mentioned above, to obtain plants with reduced carbon-nitrogen balance.

[0086] As one embodiment of the present invention, the method for cultivating plants with altered carbon-nitrogen balance capabilities includes the following steps:

[0087] (1) Construct an expression vector containing the sgRNA gene expression cassette sequence shown in SEQ ID No:4;

[0088] (2) Introduce the expression vector constructed in step (1) into plants;

[0089] (3) Plants with improved carbon-nitrogen balance were obtained through screening and identification.

[0090] In the above method, inhibiting, reducing, or silencing the expression of the gene encoding the protein in wheat means knocking out the gene encoding the protein in the target wheat.

[0091] In the above method, the knockout is implemented using a CRISPR / Cas9 system.

[0092] In the above method, the target sequence for gene editing by the CRISPR / Cas9 system is positions 129-147 of SEQ ID No:2 and positions 918-936 of SEQ ID No:3; or positions 209-227 of SEQ ID No:2 and positions 998-1016 of SEQ ID No:3.

[0093] In the above method, knocking out the coding gene of the target wheat protein can be achieved by performing at least one of the following mutations on the coding gene of the protein shown in SEQ ID No:3 in the wheat genome:

[0094] 1) Replace 5'-CCCGGACCCCACGCCCCG-3' in the gene encoding the protein in the wheat genomic DNA with 5'-CCCGGACCCCACGCCGCCG-3', thereby knocking out the gene encoding the TaESV protein;

[0095] 2) Replace 5'-CCCGGACCCCACCCG-3' in the gene encoding the protein in the wheat genomic DNA with 5'-CCCGGACCCCACGCCGCCG-3' to knock out the gene encoding the TaESV protein.

[0096] The present invention also provides a method for cultivating plants with altered carbon-nitrogen balance, comprising the following steps: inhibiting, reducing or silencing the expression level of the coding gene of the protein described above in the target plant, thereby obtaining a plant with altered carbon-nitrogen balance.

[0097] In this invention, the purpose of plant breeding includes cultivating plants with altered carbon-nitrogen balance capabilities.

[0098] In this invention, the low-nitrogen culture conditions are: indoor seedling stage low-nitrogen treatment with a nutrient solution containing 0.2 mM nitrate.

[0099] In the above applications or methods, the plant is any one of the following:

[0100] N1) Monocotyledons:

[0101] N2) Plants of the order Poales;

[0102] N3) Gramineae plants;

[0103] N4) Plants of the Triticum genus;

[0104] N5) Wheat.

[0105] This invention uses a natural population of 362 wheat varieties (lines) as experimental material. Data analysis was conducted by measuring the correlation between various phenotypic traits during the seedling stage under low nitrogen treatment. The low nitrogen tolerance index was used to characterize the sensitivity of a trait to nitrogen stress, thereby measuring the differences in nitrogen use efficiency among different genotypes. Screening revealed that leaf length and leaf width traits were mapped to a single region, AX-110507898, containing 10 candidate genes. One gene, TaESV (TraesCS5A02G501000), was identified by qRT-PCR. Attached Figure Description

[0106] Figure 1 These are the editing sites for TaESV genes A, B, and D. The target sequences sgRNA1 of TaESV genes A, B, and D and their specific locations on the TaESV genes are shown.

[0107] Figure 2 Sequencing peak diagram to verify gene editing of ESV mutant.

[0108] Figure 3 This experiment involved starch-iodine staining of leaves at the end of the day under normal and low-nitrogen culture conditions. Ctrl: normal nutrient solution treatment; LN: low-nitrogen nutrient solution treatment; ED: end of the day. Detailed Implementation

[0109] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0110] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0111] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0112] The pCBC-MT1T2 (chloramphenicol) plasmid and pBUE411 (kanamycin) plasmid in the following examples have been described in: Xing HL; Dong L; Wang ZP; Zhang HY; Han CY; Liu B; Wang XC; Chen QJ, A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol 2014 Nov 29; 14:327. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.

[0113] The following examples used GraphPad Prism 8 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.05 (*) indicates a significant difference, and P < 0.01 (**) indicates a highly significant difference.

[0114] Example 1: TaESV gene knockout vector construction and transformation

[0115] The coding sequence (CDS) of the TaESV gene in the wheat variety Chinese Spring is SEQ ID No:2, encoding the TaESV protein with the amino acid sequence SEQ ID No:1. The genomic gene encoding the TaESV protein in the genomic DNA of the wheat variety Chinese Spring is shown in SEQ ID No:3 of the sequence listing.

[0116] The full-length CDS sequence of the target gene TaESV was pasted into the CRISPR2 / SCORE website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / SCORE) in FASTA format. Approximately 10 sgRNAs with high scores and close to the ATG region were directly copied. Their base sequences were then compared with homologous genes from wheat genomes A, B, and D. The sgRNAs that were completely identical to the CDS sequences of homologous genes from all three genomes were selected as the two optimal sgRNAs, sgRNA1 and sgRNA2. The NGG portion of the sgRNA sequences was deleted, and then the first base was deleted, leaving the middle 19 bases. Specific sgRNA sequence information is as follows:

[0117] sgRNA1:5'-CCCGGACCCCACGCCGCCG-3' (target sequences are positions 129-147 of SEQ ID No:2 and positions 918-936 of SEQ ID No:3).

[0118] sgRNA2:5'-GGAGCAAGCCCATTGCCCG-3' (target sequences are positions 209-227 of SEQ ID No:2 and positions 998-1016 of SEQ ID No:3).

[0119] Table 1. Primers for editing vector construction

[0120] Primer name Primer sequence information (5'-3') MT1T2-F gtgcagatgatccgtggcgtgagaccGGAGCAAGCCCATTGCCCG MT1T2-F0 GGAGCAAGCCCATTGCCCGgttttagagctagaaatagc MT1T2-R0 CGGCGGCGTGGGGTCCGGGCGCTTCTTGGTGCC MT1T2-R gctatttctagctctaaaaccgagaccCGGCGGGCGTGGGGTCCGGG

[0121] The specific steps are as follows:

[0122] 1. Extract pCBC-MT1T2 plasmid (chloramphenicol resistance);

[0123] 2. The normal primer concentration of MT1T2-F / MT1T2-R is 10p, and MT1T2-F0 / MT1T2-R0 is diluted 20-fold. After mixing the four primers in equal volumes, PCR is performed using pCBC-MT1T2 plasmid as a template. The product size is 964bp, and the mixture is annealed at 60℃.

[0124] 3. The pBUE411 vector was digested with BsaⅠ enzyme, but the PCR product was not digested.

[0125] 4. Homologous recombination was used to ligate pBUE411 to the PCR product;

[0126] 5. Transform Top10 competent cells (ZOMANBIO, catalog number: ZC104-3). After the bacterial count and sequencing are correct, extract the plasmid and transform it into EHA105 Agrobacterium competent cells (ZOMANBIO, catalog number: ZK303) for transformation.

[0127] The structure of the recombinant vector pBUE411-sgRNA is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No:4 between the BsaI restriction sites of the starting vector pBUE411, while keeping the other sequences of the vector pBUE411 unchanged.

[0128] The recombinant vector pBUE411-sgRNA contains sgRNA1 and sgRNA2 expression cassettes. The sgRNA1 gene is shown as nucleotides 439-457 of SEQ ID No:4, and the sgRNA2 gene is shown as nucleotides 1351-1369 of SEQ ID No:4. Nucleotides 20-437 are the promoter for initiating sgRNA gene transcription, and nucleotides 1446-1736 are the terminator for terminating sgRNA gene transcription.

[0129] The recombinant Agrobacterium EHA105 / pBUE411-sgRNA was identified by bacterial culture PCR, and then transformed into wheat Fielder variety by Agrobacterium transformation method.

[0130] Example 2: Identification of TaESV gene knockout plants

[0131] The recombinant Agrobacterium EHA105 / pBUE411-sgRNA was identified by bacterial culture PCR, and then transformed into wheat Fielder variety by Agrobacterium transformation method.

[0132] Positive plants were screened using TaESV-transgenic wheat, and DNA was extracted. ABD-specific detection primers were designed for PCR amplification. ABD-specific detection primer information is as follows:

[0133]

[0134]

[0135] The target band of the transgenic material was detected by 1.5% agarose gel electrophoresis. Two positive lines of gene-edited material were ultimately obtained, with mutation types esv-1 and esv-2. The specific mutation types of TaESV gene-edited wheat are as follows:

[0136] mutant esv -1. Compared with wild-type wheat: For the TaESV gene, the following mutations occurred in all three homologous chromosomes: In the TaESV-A gene, “5'-CCCGGACCCCACGCCGCCG-3' (corresponding to positions 129-147 of SEQ ID No:2, and positions 918-936 of SEQ ID No:3)” was mutated to “5'-CCCGGACCCCACGCCCCG-3'”; in the TaESV-B gene, “5'-CCCGGACCCCACGCCGCCG-3' (corresponding to positions 138-156 of SEQ ID No:5, and positions 1100-1118 of SEQ ID No:6)” was mutated to “5'-CCCGGACCCCACGCCCCG-3'”; in the TaESV-D gene, “5'-CCCGGAGCCCACGCCGCCG-3' (corresponding to positions 138-156 of SEQ ID No:7, and positions 918-936 of SEQ ID No:3)” was mutated to “5'-CCCGGACCCCACGCCCCG-3'”; and ... The mutation at positions 981-999 of No:8 is changed to "5'-CCCGGAGCCCACGCCCG-3'"; the deletion of this nucleotide causes a frameshift, resulting in changes in the TaESV amino acid profile, leading to loss of TaESV protein function, thus knocking out the TaESV gene. Figure 2 ).

[0137] mutant esv - 2. Compared with wild-type wheat: For the TaESV gene, the following mutations occurred in both homologous chromosomes: In the TaESV-A gene, “5'-CCCGGACCCCACGCCGCCG-3' (corresponding to positions 129-147 of SEQ ID No:2, and positions 918-936 of SEQ ID No:3)” was mutated to “5'-CCCGGACCCCACCCG-3'”; in the TaESV-B gene, “5'-CCCGGACCCCACGCCGCCG-3' (corresponding to positions 138-156 of SEQ ID No:5, and positions 1100-1118 of SEQ ID No:6)” was mutated to “5'-CCCGGACCCCACCCG-3'”; in the TaESV-D gene, “5'-CCCGGAGCCCACGCCGCCG-3' (corresponding to positions 138-156 of SEQ ID No:7, and positions 918-936 of SEQ ID No:3)” was mutated to “5'-CCCGGACCCCACCCG-3'”; and in the TaESV-D gene, “5'-CCCGGAGCCCACGCCGCCG-3' (corresponding to positions 138-156 of SEQ ID No:7, and positions 918-936 of SEQ ID No:3)” was mutated to “5'-CCCGGACCCCACCCG-3'”. The mutation at positions 981-999 of No:8 is changed to "5'-CCCGGAGCCCACCCG-3'"; the deletion of this nucleotide causes a frameshift, resulting in changes in the TaESV amino acid profile, leading to loss of TaESV protein function, thus knocking out the TaESV gene. Figure 2 ).

[0138] Gene knockout lines were self-crossed to the T3 generation to obtain gene-edited homozygous plants for phenotypic studies.

[0139] Example 3: Phenotypic identification of TaESV gene knockout plants

[0140] Sample to be tested: mutant ESV - 1 and ESV - 2. Receptor wheat Fielder. Each sample was repeated three times in each setting.

[0141] Leaf starch-iodine staining experiment at the end of the day under normal culture and low nitrogen culture conditions.

[0142] Normal culture conditions (Ctrl) are: nutrient solution with 2 mM nitrate; low nitrogen culture conditions (LN) are: nutrient solution with 0.2 mM nitrate.

[0143] Nutrient solution composition (normal): Calcium nitrate 1 mM / L, potassium dihydrogen phosphate 0.2 mM / L, magnesium sulfate 1 mM / L, potassium chloride 1.5 mM / L, calcium chloride dihydrate 1.5 mM / L, boric acid 1×10 -3 mM / L, sodium molybdate 15×10 -3 mM / L, copper sulfate pentahydrate 5×10 -4 mM / L, zinc sulfate heptahydrate 1×10 -3 mM / L, manganese sulfate 1×10 -3 0.1 mM / L ferrous sulfate heptahydrate and 0.1 mM / L EDTANa2

[0144] Nutrient solution composition (low nitrogen): Calcium nitrate 0.1 mM / L, potassium dihydrogen phosphate 0.2 mM / L, magnesium sulfate 1 mM / L, potassium chloride 1.5 mM / L, calcium chloride dihydrate 2.4 mM / L, boric acid 1×10 -3 mM / L, sodium molybdate 15×10 -3 mM / L, copper sulfate pentahydrate 5×10 -4 mM / L, zinc sulfate heptahydrate 1×10 -3 mM / L, manganese sulfate 1×10 -3 The concentrations of ferrous sulfate heptahydrate (0.1 mM / L) and EDTANa2 (0.1 mM / L) were as follows: Fielder and taesv edited the material. The seedlings were cultured in water in an artificial incubator for three days, then the solution was changed to 2 mM nitrate. After four days, a low-nitrogen treatment (0.2 mM nitrate) was carried out for four weeks.

[0145] Leaves from Fielder and Taesv were collected at the end of the day, soaked in anhydrous ethanol, boiled in a water bath for 20 minutes to remove chlorophyll, stained with Lugol solution (Sigma) for 10 minutes, and then soaked in water for 1 hour before observation.

[0146] The results are as follows ( Figure 3 At the end of the day (ED) under normal culture conditions, Fielder showed a blue-purple color at the end of the day, while the iodine staining of the ESV edited material did not show a blue-purple color, indicating that taesv affects starch synthesis. Under low nitrogen conditions, the iodine staining of both Fielder and taesv at the end of the day was lower than that under normal nutrient conditions, indicating that under low nitrogen conditions, starch synthesis of both Frelder and taesv was affected, with taesv being more affected.

[0147] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A protein, wherein the protein is any of the following: A1) Proteins with amino acid sequences as shown in SEQ ID No:1, SEQ ID No:9 or SEQ ID No:10; A2) A protein that has more than 80% identity with and has the same function as the protein shown in A1) obtained by substituting and / or deleting and / or adding amino acid residues of the protein in A1). A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).

2. The protein according to claim 1, characterized in that: The protein is derived from wheat.

3. A biomaterial relating to the protein of claim 1 or 2, wherein the biomaterial is any one of the following: B1) A nucleic acid molecule encoding the protein described in claim 1; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) Transgenic plant organs containing the nucleic acid molecules described in B1) or transgenic plant organs containing the expression cassette described in B2).

4. The biomaterial according to claim 3, characterized in that, B1) The nucleic acid molecule described is a gene as shown in E1) or E2) below: E1) The coding sequence is a cDNA molecule or DNA molecule of SEQ ID No:2, SEQ ID No:5 or SEQ ID No:7; E2) The nucleotide is a cDNA molecule or DNA molecule of SEQ ID No:3, SEQ ID No:6 or SEQ ID No:

8.

5. The use of the protein or gene expression regulator or substance regulating the activity or content of said protein as described in claim 1 or 2 in any of the following: U1) Application in regulating plant carbon and nitrogen balance; U2) Application in the preparation of products that regulate plant carbon and nitrogen balance; U3) Applications in cultivating plants that promote carbon-nitrogen balance; U4) Application in the preparation of products that cultivate plants that promote carbon and nitrogen balance; U5) Applications in plant breeding.

6. The application according to claim 5, characterized in that: The substance regulating gene expression or the substance regulating protein activity or content is a biological material related to the protein, and the biological material is any one of B1) to B7) below: B1) A nucleic acid molecule encoding the protein described in claim 1; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) Transgenic plant organs containing the nucleic acid molecules described in B1) or transgenic plant organs containing the expression cassette described in B2).

7. A method for regulating the carbon-nitrogen balance of plants, characterized in that, This includes regulating the activity and / or content of the proteins described in claim 1 or 2 in the target plant, and / or the expression level of the gene encoding the proteins described in claim 1 or 2, to regulate the plant's carbon and nitrogen balance.

8. The method according to claim 7, characterized in that: The regulation of the activity and / or content of the protein described in claim 1 or 2 in the target plant, or / and the expression level of the gene encoding the protein described in claim 1 or 2, includes the introduction of the gene encoding the protein into the recipient plant to obtain a target plant with a stronger ability to regulate carbon and nitrogen balance than the recipient plant; the gene encoding the protein described in claim 1 or 2.

9. Methods for cultivating plants with altered carbon-nitrogen balance include: 1) Inhibit or reduce or silence the expression level of the gene encoding the protein described in claim 1 in the target plant, and / or inhibit or reduce or silence the activity and / or content of the gene encoding the protein described in claim 1, to obtain a plant with improved carbon and nitrogen balance regulation ability. 2) Increase, enhance and / or upregulate the expression level of the gene encoding the protein described in claim 1 in the target plant, or / and increase, enhance and / or upregulate the activity and / or content of the gene encoding the protein described in claim 1, to obtain a plant with reduced carbon-nitrogen balance regulation ability.

10. The method according to any one of claims 7-9, characterized in that, The plant is any one of the following: N1) Monocotyledons: N2) Plants of the order Poales; N3) Gramineae plants; N4) Plants of the Triticum genus; N5) Wheat.

Images