Wheat TaPPKL1 mutant and application thereof
Editing the wheat TaPPKL1 gene using CRISPR/Cas9 gene editing technology solved the problem of regulating wheat plant height and grain size, achieving reduced plant height and increased grain size, thus improving wheat yield.
Patent Information
- Application Number
- CN202511492259.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-20
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2045-10-20
AI Technical Summary
Existing technologies are insufficient to effectively regulate wheat plant height and grain size, and the allohexaploid genetic background of common wheat limits the cloning and molecular breeding of agronomic trait genes, thus failing to meet production needs.
By using CRISPR/Cas9 gene editing technology to edit three homologous copies of the wheat TaPPKL1 gene, resulting in gene sequence deletions, deletions, and substitutions, wheat TaPPKL1 mutants were constructed, and plant height and grain size were regulated using genetic engineering techniques.
It significantly reduces wheat plant height, increases grain length and width, and improves wheat yield, providing a practical and feasible method for breeding high-yield wheat.
Smart Images

Figure CN120944847A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, specifically to the wheat TaPPKL1 mutant and its applications. Background Technology
[0002] wheat( Triticum aestivum As one of the world's most important food crops, wheat yield is directly related to people's living standards. Wheat yield is determined by a combination of agronomic traits, mainly by increasing the number of ears per acre, the number of ears per ear, and the thousand-grain weight. Wheat plant height and grain shape directly affect these traits, thus influencing wheat yield. Therefore, identifying the genes regulating wheat plant height and grain shape is of great significance for increasing wheat yield.
[0003] Currently, the genes or pathways identified that regulate wheat plant height, grain shape, and grain weight mainly include Rht1 and its alleles or homologs, the G protein signaling pathway (GS3), the mitogen-activated protein kinase (MAPK) signaling pathway (SMG1), and plant hormones (such as BRs, IAA, CTK, etc.). However, research on the corresponding regulatory networks remains relatively weak. Because common wheat is an allohexaploid, its complex genetic background restricts the cloning of agronomic trait genes and molecular breeding, falling far short of meeting the needs of production applications. Therefore, in wheat production, identifying key genes controlling grain size and plant height has significant application value for wheat line improvement and high-yield variety design. Summary of the Invention
[0004] The purpose of this invention is to provide wheat TapPKL1 mutants and their applications.
[0005] To achieve the above objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides wheat TapPKL1 mutants, said wheat TapPKL1 gene mutants including TapPKL1-5A, TapPKL1-5B and TapPKL1-5D; The amino acid sequence of TaPPKL1-5A is shown in SEQ ID NO: 1, the amino acid sequence of TaPPKL1-5B is shown in SEQ ID NO: 2, and the amino acid sequence of TaPPKL1-5D is shown in SEQ ID NO: 3.
[0006] In some embodiments, the wheat TapPKL1 mutant of the present invention is a gene sequence deletion / deletion, addition, truncation, substitution, etc., caused by manipulation of three homologous copies (TaPPKL1-5A, TapPKL1-5B, TapPKL1-5D) of the wheat TapPKL1 gene.
[0007] In some embodiments, the wheat TaPPKL1 gene can be edited to obtain the wheat TaPPKL1 mutant described in this invention.
[0008] In some embodiments, the TaPPKL1 gene can be edited using CRISPR-based gene editing technology to obtain the wheat TaPPKL1 mutant described in this invention. Site-specific nucleases can induce double-strand breaks (DSBs) at target sites in the genomic sequence, which are then repaired through natural processes such as homologous recombination (HR) or non-homologous end joining (NHEJ), resulting in deletions / deletions, additions, truncations, or substitutions of the TaPPKL1 gene sequence; mutations in the wheat TaPPKL1 protein can also be induced by adding an exogenous donor template.
[0009] In a second aspect, the invention provides a nucleic acid molecule encoding the wheat TapPKL1 mutant described herein.
[0010] The nucleic acid molecule is selected from the group consisting of: genomic sequences, cDNA sequences, RNA sequences, or combinations thereof.
[0011] The nucleic acid molecule can be single-stranded or double-stranded.
[0012] The nucleic acid molecule may also contain additional auxiliary elements selected from the group consisting of: signal peptides, secretory peptides, tag sequences (such as 6His), nuclear localization signals, or combinations thereof.
[0013] The nucleic acid molecule also contains a promoter that is operatively linked to the ORF sequence encoding the mutant polypeptide.
[0014] The promoter is selected from the group consisting of: constitutive promoters, tissue-specific promoters, inducible promoters, or strong promoters.
[0015] In some embodiments, the nucleic acid molecule comprises a gene as shown in (a1), (a2), or (a3) below: (a1) A cDNA molecule encoding an amino acid sequence as shown in SEQ ID NO: 1, or a deletion of the 513th base in the wheat TapPKL1-5A gene sequence corresponding to SEQ ID NO: 4; (a2) A cDNA molecule encoding an amino acid sequence as shown in SEQ ID NO: 2, or, inserting a T base at position 531 corresponding to the wheat TapPKL1-5B gene sequence shown in SEQ ID NO: 5; (a3) A cDNA molecule encoding an amino acid sequence as shown in SEQ ID NO: 3, or a deletion of bases at positions 530 and 531 corresponding to the wheat TapPKL1-5D gene sequence shown in SEQ ID NO: 6.
[0016] A third aspect of the invention provides an expression cassette or vector comprising the nucleic acid molecule described herein.
[0017] In some embodiments, the expression cassette contains the nucleic acid molecule described in this invention and a regulatory element operatively linked thereto.
[0018] The regulatory element is selected from one or more of the following groups: enhancer, transposon, promoter, terminator, leader sequence, polyadenylation sequence, and marker gene.
[0019] In some embodiments, the vector comprises a nucleic acid molecule encoding the wheat TapPKL1 mutant of the present invention. Preferably, the vector further comprises an expression regulatory element operatively linked to the aforementioned nucleic acid molecule.
[0020] In some embodiments, the vector includes a cloning vector, an expression vector, a shuttle vector, or an integration vector.
[0021] In some implementations, the vector may be a vector for gene editing of the host cell's endogenous TapPKL1 gene.
[0022] In some embodiments, the expression vector further contains at least one origin of replication to enable self-replication.
[0023] In some embodiments, the vector may be a vector that is integrated into the genome when introduced into a host cell and replicates along with the chromosome into which it is integrated.
[0024] The vector can be of the following types: plasmid, virus, granule, bacteriophage, etc., which are well known to those skilled in the art. Preferably, the vector in this invention is a plasmid.
[0025] In some embodiments, the present invention provides an editing vector system comprising one or more vectors, wherein the one or more vectors at least contain a guide sequence targeting the parental TapPKL1 protein-coding gene. The guide sequence contains a nucleotide sequence of a portion of the parental TapPKL1 protein-coding gene, preferably at least 15 bp of the TapPKL1 protein-coding gene nucleotide sequence, and more preferably at least 20 bp of the TapPKL1 protein-coding gene nucleotide sequence.
[0026] In some embodiments, the editing vector system further includes gene editing enzymes, including nucleases of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), TALEN (Tanscription Activator-like (TAL) effector nucleases), and ZFN (Zinc finger nuclease) editing tools.
[0027] In some embodiments, the gene-editing enzyme is a Cas protein, also known as a CRISPR enzyme or Cas effector protein, including but not limited to: Cas9 protein, Cas12 protein, Cas13 protein, Cas14 protein, Csm1 protein, and FDK1 protein. Preferably, the Cas protein is operatively linked to a first regulatory element.
[0028] In some embodiments, the gene-editing enzyme is the Cas9 protein, and the vector further includes a scaffold sequence that specifically binds to the Cas9 protein. The scaffold sequence and the guide sequence are operatively linked to form a guide RNA. Preferably, the gRNA is operatively linked to a second regulatory element.
[0029] In other embodiments, the gene-editing enzyme is a Cas12 protein, such as Cas12a, Cas12b, or Cas12i, and the vector further includes a direct repeat sequence that specifically binds to the Cas12 protein. The direct repeat sequence and the guide sequence are operatively linked to form a guide RNA. Preferably, the gRNA is operatively linked to a second regulatory element.
[0030] The aforementioned regulatory elements include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and polyU sequences).
[0031] In some embodiments, the editing vector also contains resistance genes for screening purposes, including hyg, bar, kana, rif, spec, and amp, which are well known to those skilled in the art.
[0032] In some implementations, the Cas protein used is nCas9 or other Cas9 proteins with nick activity. Here, "n" stands for nick, meaning a Cas protein that only has single-strand cleavage activity.
[0033] In a fourth aspect, the invention provides a host cell comprising the nucleic acid molecule described in this invention or the expression cassette or vector described in this invention, or wherein the nucleic acid molecule is integrated into the genome of the host cell.
[0034] In some embodiments, the host cell is a eukaryotic cell, such as a yeast cell, an animal cell, or a plant cell.
[0035] In some embodiments, the host cell is a prokaryotic cell, such as Escherichia coli.
[0036] In some embodiments, the plants include angiosperms and gymnosperms.
[0037] In some embodiments, the plants include monocotyledonous plants and dicotyledonous plants.
[0038] In some embodiments, the plants include herbaceous plants and woody plants.
[0039] In some embodiments, the plants include wheat, corn, Arabidopsis thaliana, tobacco, rice, sorghum, barley, millet, soybean, tomato, potato, quinoa, lettuce, rapeseed, cabbage, strawberry, etc.
[0040] A fifth aspect of the invention provides the use of the wheat TapPKL1 mutant, nucleic acid molecule, expression cassette or vector, and host cell described herein in any of the following: (b1) Regulating wheat plant height; (b2) Regulating wheat grain size or yield; (b3) Regulating wheat yield; (b4) Develop dwarf wheat varieties; (b5) Wheat breeding.
[0041] In some implementations, the regulation of wheat plant height is a negative regulation of wheat plant height, or a reduction of wheat plant height.
[0042] In some embodiments, the reduction in wheat plant height means that the plant height of wheat plants containing the wheat TaPPKL1 mutant, nucleic acid molecule, expression cassette or vector, and host cell described in this invention is lower than that of wheat plants containing wild-type parental TaPPKL1 protein.
[0043] The plant height refers to the height from the ground to the highest point of the wheat.
[0044] In some embodiments, wheat plants containing the wheat TaPPKL1 mutant, nucleic acid molecule, expression cassette or vector, and host cell described in this invention exhibit a plant height reduction of approximately 10%-90% compared to the wild-type parent, for example, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 55%, 60%, 65%, 70%, 75%, 80%, and 85%.
[0045] In some embodiments, the regulation of wheat grain size or yield is a positive regulation of wheat grain size or yield, or an increase in grain length and width.
[0046] In some embodiments, the increase in grain length and width means that, compared with the wild-type parent, wheat plants containing the wheat TaPPKL1 mutant, nucleic acid molecule, expression cassette or vector, and host cell of the present invention have grain length and width increased by approximately 5%-30%, for example, 5%, 8%, 10%, 15%, 20%, 25%, and 30%.
[0047] In some implementations, regulating wheat yield refers to positively regulating wheat yield, or... Increase wheat production.
[0048] In some embodiments, the wheat TaPPKL1 mutant plants described in this invention exhibit yield and grain weight increases of approximately 5%-30% compared to the wild-type parent. For example, 5%, 8%, 10%, 15%, 20%, 25%, and 30%.
[0049] A sixth aspect of the present invention provides a method for reducing wheat plant height, comprising the step of introducing the wheat TaPPKL1 mutant of the present invention into a plant cell, plant seed, plant tissue, plant part or plant, wherein the plant is wheat.
[0050] A seventh aspect of the present invention provides a method for breeding dwarf wheat varieties, comprising the step of introducing the wheat TaPPKL1 mutant of the present invention into plant cells, plant seeds, plant tissues, plant parts or plants, wherein the plant is wheat.
[0051] An eighth aspect of the present invention provides a method for increasing the length and width of wheat grains, comprising the step of introducing the wheat TaPPKL1 mutant of the present invention into a plant cell, plant seed, plant tissue, plant part or plant, wherein the plant is wheat.
[0052] In the above method, introducing the wheat TaPPKL1 mutant of the present invention includes the step of expressing the TaPPKL1 mutant protein in plant cells, plant tissues, plant parts or plants, for example, by expressing the mutant protein through an expression vector, or by integrating the nucleic acid molecule encoding the mutant protein into the plant genome for expression.
[0053] In some embodiments, introducing the wheat TapPKL1 mutant of the present invention includes the step of mutating and expressing the endogenous TapPKL1 protein-coding gene of the plant.
[0054] In some implementations, the TapPKL1 mutant includes deletions / deletions, additions, truncations, substitutions, etc. of TapPKL1.
[0055] Among the methods described above, the methods for introducing mutations include natural variation, physical mutagenesis (such as ultraviolet mutagenesis, X-ray or gamma-ray mutagenesis), chemical mutagenesis (such as nitrite, hydroxylamine, EMS, nitrosoguanidine, etc.), biological mutagenesis (such as virus or bacterial-mediated mutagenesis), and gene editing.
[0056] It should be further explained that, since wheat is an allohexaploid, the TapPKL1 gene contains three copies: TapPKL1-5A, TapPKL1-5B, and TapPKL1-5D. Therefore, it is necessary to edit the gene of these three homologous copies simultaneously.
[0057] Those skilled in the art can easily mutate the nucleotide sequence of the TapPKL1 gene of the present invention using known methods, such as site-directed mutagenesis (including oligonucleotide primer-mediated site-directed mutagenesis, PCR-mediated site-directed mutagenesis, and cassette mutagenesis) or directed evolution (including error-prone PCR, DNA shuffling, and in vitro random recombination).
[0058] Based on the above technical solution, the present invention has the following technical effects: 1. This invention screened out a group of mutant wheat TapPKL1 gene sequences.
[0059] 2. This invention designs a guide single-stranded RNA (sgRNA) for the TaPPKL1 gene, constructs an expression vector that can knock out the TaPPKL1 gene in wheat, and genetically transforms wheat to obtain TaPPKL1 gene knockout progeny. tappkl1-2#,Compared with the wild type, its plant height is significantly reduced, while the length and width of the grains are significantly increased.
[0060] 3. This invention provides a practical method for achieving rapid wheat breeding and increasing wheat yield using genetic engineering technology, and has significant breeding application value. Attached Figure Description
[0061] Figure 1 In this embodiment of the invention, all three homologous copies underwent gene editing. tappkl1-2# Sequencing results; Figure 2 In this embodiment of the invention, all three homologous copies underwent gene editing. tappkl1-2# A schematic diagram comparing the protein coding results with those of the wild type, where A represents a comparison of the protein coding results of the TapPKL1-5A gene, B represents a comparison of the protein coding results of the TapPKL1-5B gene, and C represents a comparison of the protein coding results of the TapPKL1-5D gene. Figure 3 The gene-edited strains in this embodiment of the invention tappkl1-2# Sequencing amplification fragments of the edited site, where 1 is the Transgen 2K plus marker, and 2 to 11 are... tappkl1-2# The PCR amplification fragments of the post-edited site are shown in Figure 12, which is a negative control amplified using water as a template, and Figure 13 is a PCR amplification fragment from JW1. Figure 4 For the JW1 and gene knockout lines in the embodiments of the present invention tappkl1-2# A diagram comparing plant height, grain length, and width, where A and B represent gene knockout lines compared to wild-type JW1 wheat. tappkl1-2# Plant height comparison; C and D are gene knockout lines compared to wild-type JW1 wheat. tappkl1-2# Comparison of grain length between strains, E and F represent gene knockout lines compared to wild-type JW1 wheat. tappkl1-2# The grain width of the strains was significantly increased; G represents wild-type JW1 wheat and gene knockout strains. tappkl1-2# Comparison of thousand-grain weight of strains, where H represents the weight of gene-edited strains compared to wild-type JW1 wheat. tappkl1-2# The yield per plant increased significantly. In the figure, * indicates p < 0.05, *** indicates p < 0.001, and **** indicates p < 0.0001. Detailed Implementation
[0062] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0063] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0064] As mentioned earlier, identifying key genes that control grain size and plant height has important application value for wheat strain improvement and high-yield breeding.
[0065] In view of this, this invention has conducted in-depth research on the genes that regulate wheat grain size and plant height. Using the wild-type wheat variety JW1 as experimental material, this invention employed CRISPR / Cas9 gene editing technology to perform the following mutation treatments on the wheat TapPKL1-5A, TapPKL1-5B, and TapPKL1-5D genes: (1) The deletion of the 513th base in the wheat TaPPKL1-5A gene sequence corresponding to SEQ ID NO:4 caused a frameshift mutation, which changed the reading frame. The mutant protein TaPPKL1-5A began to shift from the 172nd amino acid and the translation terminated after the 185th amino acid, resulting in the loss of the corresponding gene function.
[0066] (2) A T is inserted at position 531 of the wheat TaPPKL1-5B gene sequence corresponding to SEQ ID NO: 5, causing a frameshift mutation. The reading frame changes, and the mutant protein TaPPKL1-5B begins to shift from amino acid 178. Translation terminates after amino acid 233, and the corresponding gene function is lost.
[0067] (3) The deletion of bases at positions 530 and 531 of the wheat TaPPKL1-5D gene sequence corresponding to SEQ ID NO: 6 caused a frameshift mutation, which changed the reading frame. The mutant protein TaPPKL1-5C began to show a frameshift starting from amino acid 178, and translation terminated after amino acid 232, resulting in the loss of the corresponding gene function.
[0068] The above mutation treatment yielded wheat TapPKL1 mutants. The amino acid sequence of TapPKL1-5A of the wheat TapPKL1 mutant is shown in SEQ ID NO: 1, the amino acid sequence of TapPKL1-5B of the wheat TapPKL1 mutant is shown in SEQ ID NO: 2, and the amino acid sequence of TapPKL1-5D of the wheat TapPKL1 mutant is shown in SEQ ID NO: 3.
[0069] Comparison between the wheat TapPKL1 mutant and the wild-type wheat variety JW1 revealed that the TapPKL1 mutant exhibited a significant decrease in plant height and a significant increase in grain length and width. Therefore, site-directed mutagenesis of the wheat TapPKL1-5A, TapPKL1-5B, and TapPKL1-5D genes using existing genetic engineering techniques can yield wheat mutants with reduced plant height and increased grain length and width, laying the foundation for high-yield wheat breeding.
[0070] The high-fidelity enzyme required for PCR amplification was KOD-FX NEO (Toyobo); the restriction endonucleases BsaI and T4 ligase required for Gibson assembly were purchased from NEB; the gel extraction kit and plasmid extraction kit required for enzyme fragment recovery were purchased from Thermo Fisher Scientific. The inorganic salts required for culture medium preparation were purchased from Sinopharm Group, and the vitamins and antibiotics were purchased from Sigma-Aldrich. The *E. coli* strain used in this invention is... E. coli Transgen 5α, purchased from Beijing Quanshijin Company.
[0071] The wheat variety JW1 used in this invention is a new germplasm with good tissue culture ability bred by the Crop Research Institute of Shandong Academy of Agricultural Sciences. It is available to the public from the Crop Research Institute of Shandong Academy of Agricultural Sciences. This biological material is only used to repeat the relevant experiments of this invention and cannot be used for other purposes.
[0072] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0073] Example 1: Design and expression vector of sgRNA 1. Design of sgRNAs targeting TaPPKL1 The TaPPKL1 gene has one copy each on wheat chromosomes 5A, B, and D (TaPPKL1-5A, TaPPKL1-5B, and TaPPKL1-5D, respectively). The nucleotide sequence of the TaPPKL1 gene in genome A has 100% similarity to the gene TraesCS5A02G373900 (Chromosome 5A: 571,780,121-571,789,960 forward strand) in the Ensembl Plants database (http: / / plants.ensembl.org / index.html). The nucleotide sequence of the TaPPKL1-5A coding region (CDS) is shown in SEQ ID NO: 4. The nucleotide sequence of the TaPPKL1 gene in genome B has similarity to the gene TraesCS5B02G375800 (Chromosome 5B: 553,346,620-553,356,553 forward strand) in the Ensembl Plants database. The sequence similarity of the TaPPKL1 gene in the D genome is 100% with that of the gene TraesCS5D02G383300 (Chromosome 5D:452,843,590-452,852,376 forward strand.) in the Ensembl Plants database. The nucleotide sequence of the TaPPKL1 gene in the D genome is 100% with that of the gene TraesCS5D02G383300 (Chromosome 5D:452,843,590-452,852,376 forward strand.). The nucleotide sequence of the TaPPKL1-5D coding region (CDS) is shown in SEQ ID NO: 6.
[0074] To design sgRNAs capable of editing the coding region of the TapPKL1 gene, suitable target sites were searched in the coding region of the TapPKL1 gene using the website CRISPRdirect (http: / / crispr.dbcls.jp / ). A 20bp sequence fragment before or after the PAM structure was selected as the target sequence. In this embodiment, a knockout experiment was performed using one of the sgRNAs as an example. Its nucleotide sequence is GGGTGGAATTGGCCCAGCTG (SEQ ID NO: 7). The CCA before the sgRNA target sequence is the PAM sequence (the forward sequence relative to the genome). Since the CCA is located in the intron region, it is not shown in the corresponding CDS sequence of the TapPKL1 gene.
[0075] 2. pBUE411-TaPPKL1 binary expression vector The example uses the plant CRISPR / Cas9 gene editing vector pBUE411, which contains the wheat U3 promoter TaU3 to initiate sgRNA. Cas9 mimics the characteristic of high 5' GC content in grass genes and is a genetically designed and synthesized gene with optimized plant codons. The plasmid pBUE411 is publicly available from China Agricultural University, and its sequence is publicly known, at 17430 bp.
[0076] The plant binary expression vector pBUE411-TaPPKL1 consists of expression cassette E1 and expression cassette E2. Expression cassette E1, from upstream to downstream, consists of: a wheat TaU3 promoter, an sgRNA targeting the TaPPKL1 gene, and a terminator T1. Expression cassette E2, from upstream to downstream, consists of: a maize ubiquitin promoter Ubi, a maize Cas9 coding sequence, and a terminator T2. The nucleotide sequences of the wheat TaU3 promoter, terminator T1, the maize ubiquitin promoter Ubi, the maize Cas9 coding sequence, and terminator T2 have been disclosed in patent "202411320638.3". The nucleotide sequence information of pBUE411-TaPPKL1 is as follows: the 802nd to 821st bases in the nucleotide sequence of the plant binary expression vector pBUE411-TaPND in patent "202411320638.3" are replaced with cagctgggccaattccaccc (SEQ ID NO: 8), which is the nucleotide sequence of the plant binary expression vector pBUE411-TaPPKL1 in this application.
[0077] Example 2: Obtaining and Identifying Transgenic Offspring 1. Acquisition of TaPPKL1 transgenic offspring The recombinant binary expression vector pBUE411-TaPPKL1 from Example 1 was transformed into Agrobacterium EHA105 competent cells. Specifically, the recombinant binary expression vector pBUE411-TaPPKL1 was added to Agrobacterium EHA105 competent cells and incubated on ice for 5 min, flash-frozen in liquid nitrogen for 5 min, heat-shocked at 37°C for 5 min, then incubated on ice for 5 min. Antibiotic-free LB medium was added, and the cells were incubated on a shaker at 28°C for 2 h. The cells were then spread onto LB agar plates (containing rifampin, streptomycin, and kanamycin) and incubated upside down at 28°C until colonies emerged. Single colonies were picked and inoculated into LB medium containing the corresponding antibiotics, and cultured at 28°C and 160 rpm for 24 h.
[0078] Take JW1 wheat seeds approximately 15 days after pollination and remove the embryos. Add 1 mL of Agrobacterium suspension to a 1.5 mL centrifuge tube and mix with 1.4 μL of acetylsylgenone (0.1 M). Infect the tube with the prepared bacterial solution for 5 minutes, then place it on a co-culture medium and incubate in the dark at 23°C for 3 days. After co-culture, place it on a resting medium and incubate in the dark at 25°C for 5 days. Transfer the callus tissue to selection medium 1, seal the culture dish with sealing film, and incubate in the dark at 25.5°C for 2 weeks. After cutting the callus, transfer it to selection medium 2, seal the culture dish again with sealing film, and continue incubating in the dark at 25.5°C for 2 weeks. After 2 weeks of callus selection, resistant callus showing green buds is transferred to regeneration medium. Seal the culture dish and incubate in a 25°C incubator with light / dark (16 h / 8 h) for 2 weeks. After 2 weeks of regeneration, transfer healthy seedlings to new resistance regeneration boxes. Once the seedlings have grown to a certain size, samples can be taken for testing.
[0079] The various culture media and their preparation methods involved in the above-mentioned wheat genetic transformation are described in the following literature: Kan Wang (ed.), Agrobacterium Protocals: Volume 1, Methods in Molecular Biology, vol.1223DOI10.007 / 978-1-4939-1695-5_15, Spring Science+Businessed Media New York 2015.
[0080] The formulations of co-culture medium, resting medium, screening medium 1, screening medium 2 and regeneration medium are shown in Table 1.
[0081] Table 1 Culture medium formulation
[0082] Young leaves of regenerated wheat were collected, and genomic DNA was extracted using the CTAB method. PCR identification was performed using primers from two vectors: BUE-DF1 (TCATTGAGCAGATTTCCGAGT, SEQ ID NO: 9) and BUE-DR1 (ATTTGCAGCTTTTCTAGGTCT, SEQ ID NO: 10). The PCR reaction system was as follows: 2×PCR master mix: 10 μL, BUE-DF1 (10 μM): 0.5 μL, BUE-DR1 (10 μM): 0.5 μL, gDNA (50 ng / μL): 1 μL, ddH2O: 8 μL. The PCR reaction program was: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s; 58℃ annealing for 30 s, 72℃ extension for 30 s, for 32 cycles; 72℃ annealing for 5 min.
[0083] 2. Identification of TapPKL1 transgenic knockout progeny Wheat is an allohexaploid, and the TapPKL1 gene is a copy on chromosome 5A. Homologous copies on chromosomes 5B and 5D are TapPKL1-5B and TapPKL1-5D, respectively. The DNA sequences of these three copies show high homology, with an amino acid sequence similarity of 98.8%. Therefore, it is necessary to simultaneously detect gene editing in all three homologous copies. This experiment used the Hi-TOM gene editing site detection kit purchased from Xi'an Qingxue Biotechnology Co., Ltd. This kit performs high-throughput library construction via PCR and directly analyzes the variation information from multiple samples and multiple sites using the Hi-TOM online software. TapPKL1, TapPKL1-5B, and TapPKL1-5D were simultaneously amplified using specific primers Seq-F1 (GGAGTGAGTACGGTGTGCCTCCACTATTCCCAAGCTAATCTAACC, SEQ ID NO: 11) and Seq-R1 (GAGTTGGATGCTGGATGGCTGTTGTGTAAGATCTAGAACATGAAGG, SEQ ID NO: 12) flanking the target sequence. The first round of PCR reaction consisted of 1 μL of leaf DNA from wheat plants transfected with the pBUE411-TaPPKL1 gene as a template, 10 μL of 2× Taq Master Mix from the kit, 0.5 μL each of Seq-F1 and Seq-R1 (Table 1) (10 μM), and Nuclease-free Water to a final volume of 20 μL. The PCR reaction conditions were as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 20 s, for a total of 32 cycles; and a final extension at 72℃ for 5 min. After PCR, 5 μL of the PCR product was subjected to agarose gel electrophoresis to ensure the presence and specificity of the target product. A second round of PCR was then performed. 1 μL of the Hi-TOM Mix from the kit was added, along with 1 μL of the first-round PCR product as a template, and Nuclease-free Water was added to bring the volume to 20 μL. The PCR reaction program was: 94℃ denaturation for 2 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 25 s, for a total of 33 cycles; and a final extension at 72℃ for 5 min. The amplified products were mixed and recovered from the gel; the recovered gel product was used for library construction and sequencing, and was subsequently sent to Xi'an Qingxue Biotechnology Co., Ltd. for sequencing.
[0084] The gene editing results of the target genes wheat TapPKL1, TapPKL1-5B, and TapPKL1-5D are as follows: Figure 1 As shown, its encoded amino acid sequence is as follows: Figure 2As shown in Figures A, B, and C. After comparison, the mutant protein TapPKL1-5A showed a frameshift starting at amino acid 172, with translation terminating at amino acid 185; the mutant protein TapPKL1-5B showed a frameshift starting at amino acid 178, with translation terminating after amino acid 233; and the mutant protein TapPKL1-5D showed a frameshift starting at amino acid 178, with translation terminating after amino acid 232. The results indicate that the sgRNA was successfully transformed with the Cas9 element and functioned, editing the TapPKLs gene and causing premature termination of translation for the three proteins TapPKL1-5A, TapPKL1-5B, and TapPKL1-5D, resulting in the loss of their respective gene functions.
[0085] Example 3: Representative typology identification of wheat after knockout of TapPKL1-5A, TapPKL1-5B, and TapPKL1-5D genes. To obtain homozygous knockout lines with three homologous copies of TapPKL1-5A, TapPKL1-5B, and TapPKL1-5D, restriction enzyme digestion amplification polymorphic sequence (Caps) markers were developed targeting the editing sites. The self-crossed offspring of the gene-editing mutants were then identified until homozygous mutants with simultaneous knockout of TapPKL1-5A, TapPKL1-5B, and TapPKL1-5D were obtained.
[0086] PCR amplification of the TapPKL1-5A, TapPKL1-5B, and TapPKL1-5D genes in gene-edited progeny was performed using Seq-1F (SEQ ID NO: 11) and Seq-R1 (SEQ ID NO: 12). The PCR reaction system was as follows: KOD-FX NEO buffer: 10 μL, dNTP (2 mM): 4 μL, Seq-F1 (10 μM): 0.6 μL, Seq-R1 (10 μM): 0.6 μL, gene knockout line gDNA (approximately 20 ng / μL): 1 μL, KOD-FX NEO: 0.4 μL, and ddH2O to make up to 20 μL. The touchdown PCR reaction program was used: 98℃ pre-denaturation for 2 min, 98℃ denaturation for 12 s; 60℃ annealing for 20 s, 68℃ extension for 45 s; 98℃ pre-denaturation for 2 min, 98℃ denaturation for 12 s; 55℃ annealing for 20 s, 68℃ extension for 45 s; 98℃ pre-denaturation for 2 min, 98℃ denaturation for 12 s; 50℃ annealing for 20 s, 68℃ extension for 45 s; for a total of 35 cycles; annealing at 68℃ for 5 min. After PCR, 5 μL of PCR product was taken for agarose gel electrophoresis detection. The detection results are as follows: Figure 3 As shown. After library construction, the amplified products were sent to Xi'an Qingxue Biotechnology Co., Ltd. for sequencing. This allows for the screening of homozygous gene knockout strains. tappkl1-2# .
[0087] The wild-type recipient variety JW1 and TapPKL1 genes and their homologous copies were homozygous knockout lines (named JW1 and TapPKL1). tappkl1-2# Wheat plants (JW1 and JW2) were planted together in the artificial climate chamber of Shandong University's Qingdao campus under the following conditions: 16 hours of light and 8 hours of darkness; daytime temperature 22℃ and nighttime temperature 16℃; humidity 40%-50%; and CO2 concentration 500ppm-700ppm. Wheat plant height was measured during the grain-filling stage, and images of the plants were taken using a Canon high-performance SLR camera. tappkl1-2# The seeds were photographed. After harvesting, they were dried in a 30℃ oven for 14 days. The images of the JW1 seeds were then photographed using a Canon high-performance SLR camera. tappkl1-2# The seeds were photographed, and Image-Pro Plus 6.0 was used to analyze and measure the images, and the JW1 content was statistically analyzed. tappkl1-2# The length, width, thousand-grain weight, and yield per plant of the grain. For example... Figure 4 As shown in A and B, compared to wild-type JW1, tappkl1-2# The plant height was significantly reduced. For example... Figure 4 As shown in C, D, E, and F, compared to wild-type JW1, tappkl1-2# The length and width of the grains increased significantly. For example... Figure 4 As shown in G and H, compared to wild-type JW1, tappkl1 -2# wheat plants showed a significant increase in thousand-grain weight and yield per plant. This indicates that knockout of the TapPKL1 gene has a significant negative regulatory effect on wheat plant height and a significant positive regulatory effect on wheat grain length and width. This invention constructs a pBUE411-TaPPKL1 binary recombinant vector containing sgRNA that specifically targets TapPKL1 and its homologous genes. Using Agrobacterium-mediated infection of wheat embryo-induced callus tissue, the TapPKL1 gene is specifically edited, rendering it nonfunctional. This significantly reduces wheat plant height and increases wheat grain length and width, providing a new method for breeding high-yielding wheat.
[0088] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of them. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A wheat TaPPKL1 mutant, characterized by, The wheat TapPKL1 mutants include TapPKL1-5A, TapPKL1-5B, and TapPKL1-5D; The amino acid sequence of TaPPKL1-5A is shown in SEQ ID NO: 1, the amino acid sequence of TaPPKL1-5B is shown in SEQ ID NO: 2, and the amino acid sequence of TaPPKL1-5D is shown in SEQ ID NO:
3.
2. A nucleic acid molecule, characterized in that, Encodes the wheat TapPKL1 mutant as described in claim 1.
3. An expression box or carrier, characterized in that, It includes the nucleic acid molecule as described in claim 2.
4. A host cell, characterized in that, Contains the nucleic acid molecule of claim 2 or the expression cassette or vector of claim 3.
5. The use of the wheat TaPPKL1 mutant of claim 1, the nucleic acid molecule of claim 2, the expression cassette or vector of claim 3, or the host cell of claim 4 in any of the following: (b1) Regulating wheat plant height; (b2) Regulating wheat grain size or yield; (b3) Regulating wheat yield; (b4) Develop dwarf wheat varieties; (b5) Wheat breeding.
6. The application as described in claim 5, characterized in that, The regulation of wheat plant height is a negative regulation of wheat plant height, or a reduction of wheat plant height.
7. The application as described in claim 5, characterized in that, The regulation of wheat grain size or yield is a positive regulation of wheat grain size or yield, or an increase in grain length and width.
8. A method for reducing wheat plant height, characterized in that, The step includes introducing the wheat TaPPKL1 mutant of claim 1 into a plant cell, plant seed, plant tissue, plant part or plant, wherein the plant is wheat.
9. A method for breeding dwarf wheat varieties, characterized in that, The step includes introducing the wheat TaPPKL1 mutant of claim 1 into a plant cell, plant seed, plant tissue, plant part or plant, wherein the plant is wheat.
10. A method for increasing the length and width of wheat grains, characterized in that, The step includes introducing the wheat TaPPKL1 mutant of claim 1 into a plant cell, plant seed, plant tissue, plant part or plant, wherein the plant is wheat.
Citation Information
Patent Citations
Application of wheat TaPND gene
CN119410650B
Clone and application of semi-dominant gene qGL3 capable of controlling grain length and grain weight of rice kernel
CN102352367A
Gene G13 for regulating length and weight of rice grains and application
CN103374578A
Protein related to grain length and grain weight of paddy rice grains, encoding gene GL3-3 and application thereof
CN105585619A
Method for creating large and long grain type new germplasm or large and long grain type dwarf new germplasm of rice and application thereof
CN115216488A