Wheat TaPPKL3 mutant and application thereof
By editing the wheat TaPPKL3 gene, especially by using the CRISPR/Cas9 system to edit the wheat TaPPKL3-5A, TaPPKL3-5B, and TaPPKL3-5D genes, the trade-off between wheat yield factors has been resolved. This has resulted in a reduction in plant height and ear length, an increase in grain width, and improved wheat yield and quality, providing an effective approach for breeding dwarf, lodging-resistant wheat.
Patent Information
- Application Number
- CN202511492260.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-20
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2045-10-20
AI Technical Summary
Traditional breeding methods struggle to overcome the trade-offs between factors affecting wheat yield, making it difficult to simultaneously improve high-yield traits and impacting both wheat yield and quality.
By manipulating the wheat TaPPKL3 gene using gene editing technology, especially by using the CRISPR/Cas9 system to edit the TaPPKL3-5A, TaPPKL3-5B, and TaPPKL3-5D genes, gene sequence deletions or substitutions can be achieved, altering protein function and regulating plant height, spike length, and grain width.
This study achieved a reduction in wheat plant height and ear length, an increase in grain width, and a decrease in the number of tillers, thereby improving wheat yield and quality and providing a practical method for breeding short-stalked, lodging-resistant wheat.
Smart Images

Figure CN120944848A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, specifically to the wheat TaPPKL3 mutant and its applications. Background Technology
[0002] Wheat, as one of the world's three major food crops, is a primary food source for humanity globally, and its yield and quality directly impact food security and agricultural economic development. Factors influencing wheat yield primarily include the number of effective tillers per plant, the number of grains per ear, and grain weight. However, in actual breeding processes, these three yield factors exhibit complex interrelationships. An increase in one yield factor often accompanies a decrease in others, limiting overall wheat yield improvement and making it difficult to simultaneously improve high-yield traits. Traditional breeding methods struggle to overcome these trade-offs, necessitating an analysis of the synergistic regulatory mechanisms at the molecular level.
[0003] Plant growth and development are regulated by a complex signaling network, among which protein phosphatases precisely control signal transduction processes through reversible phosphorylation modifications. PPKL (Phosphatase Pseudokinase and Leucine-rich repeat), as a special type of phosphatase, contains several Kelch-like repeat sequences at its N-terminus, evolving unique regulatory functions in plants. In wheat, research on PPKL proteins is still limited, and their function in regulating important agronomic traits such as plant height, spike length, and grain width has not yet been reported. Therefore, studying the mechanism of action of the TaPPKL gene is of great significance for wheat molecular breeding. Summary of the Invention
[0004] The purpose of this invention is to provide wheat TapPKL3 mutants and their applications.
[0005] To achieve the above objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides wheat TapPKL3 mutants, said wheat TapPKL3 gene mutants including TapPKL3-5A, TapPKL3-5B and TapPKL3-5D; The amino acid sequence of TaPPKL3-5A is shown in SEQ ID NO: 1, the amino acid sequence of TaPPKL3-5B is shown in SEQ ID NO: 2, and the amino acid sequence of TaPPKL3-5D is shown in SEQ ID NO: 3.
[0006] In some embodiments, the wheat TapPKL3 mutant of the present invention is a gene sequence deletion / deletion, addition, truncation, substitution, etc., resulting from manipulation of three homologous copies of the wheat TapPKL3 gene (TaPPKL3-5A, TapPKL3-5B, TapPKL3-5D).
[0007] In some embodiments, the wheat TaPPKL3 gene can be edited to obtain the wheat TaPPKL3 mutant described in this invention.
[0008] In some embodiments, the TapPKL3 gene can be edited using CRISPR-based gene editing technology to obtain the wheat TapPKL3 mutant described in this invention. Site-specific nucleases can induce double-strand breaks (DSBs) at target sites in the genomic sequence, which are then repaired through natural processes such as homologous recombination (HR) or non-homologous end joining (NHEJ), resulting in deletions / deletions, additions, truncations, or substitutions of the TapPKL3 gene sequence; mutations in the wheat TapPKL3 protein can also be induced by adding an exogenous donor template.
[0009] In a second aspect, the invention provides a nucleic acid molecule encoding the wheat TapPKL3 mutant described herein.
[0010] The nucleic acid molecule is selected from the group consisting of: genomic sequences, cDNA sequences, RNA sequences, or combinations thereof.
[0011] The nucleic acid molecule can be single-stranded or double-stranded.
[0012] The nucleic acid molecule may also contain additional auxiliary elements selected from the group consisting of: signal peptides, secretory peptides, tag sequences (such as 6His), nuclear localization signals, or combinations thereof.
[0013] The nucleic acid molecule also contains a promoter that is operatively linked to the ORF sequence encoding the mutant polypeptide.
[0014] The promoter is selected from the group consisting of: constitutive promoters, tissue-specific promoters, inducible promoters, or strong promoters.
[0015] In some embodiments, the nucleic acid molecule comprises a gene as shown in (a1), (a2), or (a3) below: (a1) A cDNA molecule encoding an amino acid sequence as shown in SEQ ID NO: 1, or a deletion of the 329th base in the wheat TapPKL3-5A gene sequence corresponding to SEQ ID NO: 4; (a2) A cDNA molecule encoding an amino acid sequence as shown in SEQ ID NO: 2, or a deletion of bases 325 to 326 corresponding to the wheat TapPKL3-5B gene sequence shown in SEQ ID NO: 5; (a3) A cDNA molecule encoding an amino acid sequence as shown in SEQ ID NO: 3, or a deletion of bases 323 to 327 corresponding to the wheat TapPKL3-5D gene sequence shown in SEQ ID NO: 6.
[0016] A third aspect of the invention provides an expression cassette or vector comprising the nucleic acid molecule described herein.
[0017] In some embodiments, the expression cassette contains the nucleic acid molecule described in this invention and a regulatory element operatively linked thereto.
[0018] The regulatory element is selected from one or more of the following groups: enhancer, transposon, promoter, terminator, leader sequence, polyadenylation sequence, and marker gene.
[0019] In some embodiments, the vector comprises a nucleic acid molecule encoding the wheat TapPKL3 mutant of the present invention. Preferably, the vector further comprises an expression regulatory element operatively linked to the aforementioned nucleic acid molecule.
[0020] In some embodiments, the vector includes a cloning vector, an expression vector, a shuttle vector, or an integration vector.
[0021] In some implementations, the vector may be a vector for gene editing of the host cell's endogenous TapPKL3 gene.
[0022] In some embodiments, the expression vector further contains at least one origin of replication to enable self-replication.
[0023] In some embodiments, the vector may be a vector that is integrated into the genome when introduced into a host cell and replicates along with the chromosome into which it is integrated.
[0024] The vector can be of the following types: plasmid, virus, granule, bacteriophage, etc., which are well known to those skilled in the art. Preferably, the vector in this invention is a plasmid.
[0025] In some embodiments, the present invention provides an editing vector system comprising one or more vectors, wherein the one or more vectors at least contain a guide sequence targeting the parental TapPKL3 protein-coding gene. The guide sequence contains a nucleotide sequence of a portion of the parental TapPKL3 protein-coding gene, preferably at least 15 bp of the TapPKL3 protein-coding gene nucleotide sequence, and more preferably at least 20 bp of the TapPKL3 protein-coding gene nucleotide sequence.
[0026] In some embodiments, the editing vector system further includes gene editing enzymes, including nucleases of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), TALEN (Tanscription Activator-like (TAL) effector nucleases), and ZFN (Zinc finger nuclease) editing tools.
[0027] In some embodiments, the gene-editing enzyme is a Cas protein, also known as a CRISPR enzyme or Cas effector protein, including but not limited to: Cas9 protein, Cas12 protein, Cas13 protein, Cas14 protein, Csm1 protein, and FDK1 protein. Preferably, the Cas protein is operatively linked to a first regulatory element.
[0028] In some embodiments, the gene-editing enzyme is the Cas9 protein, and the vector further includes a scaffold sequence that specifically binds to the Cas9 protein. The scaffold sequence and the guide sequence are operatively linked to form a guide RNA. Preferably, the gRNA is operatively linked to a second regulatory element.
[0029] In other embodiments, the gene-editing enzyme is a Cas12 protein, such as Cas12a, Cas12b, or Cas12i, and the vector further includes a direct repeat sequence that specifically binds to the Cas12 protein. The direct repeat sequence and the guide sequence are operatively linked to form a guide RNA. Preferably, the gRNA is operatively linked to a second regulatory element.
[0030] The aforementioned regulatory elements include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and polyU sequences).
[0031] In some embodiments, the editing vector also contains resistance genes for screening purposes, including hyg, bar, kana, rif, spec, and amp, which are well known to those skilled in the art.
[0032] In some implementations, the Cas protein used is nCas9 or other Cas9 proteins with nick activity. Here, "n" stands for nick, meaning a Cas protein that only has single-strand cleavage activity.
[0033] In a fourth aspect, the invention provides a host cell comprising the nucleic acid molecule described in this invention or the expression cassette or vector described in this invention, or wherein the nucleic acid molecule is integrated into the genome of the host cell.
[0034] In some embodiments, the host cell is a eukaryotic cell, such as a yeast cell, an animal cell, or a plant cell.
[0035] In some embodiments, the host cell is a prokaryotic cell, such as Escherichia coli.
[0036] In some embodiments, the plants include angiosperms and gymnosperms.
[0037] In some embodiments, the plants include monocotyledonous plants and dicotyledonous plants.
[0038] In some embodiments, the plants include herbaceous plants and woody plants.
[0039] In some embodiments, the plants include wheat, corn, Arabidopsis thaliana, tobacco, rice, sorghum, barley, millet, soybean, tomato, potato, quinoa, lettuce, rapeseed, cabbage, strawberry, etc.
[0040] A fifth aspect of the invention provides the use of the wheat TapPKL3 mutant, nucleic acid molecule, expression cassette or vector, and host cell described herein in any of the following: (b1) Regulating wheat plant height; (b2) Regulating wheat ear length; (b3) Regulating wheat grain width or yield; (b4) Regulating the number of wheat tillers; (b5) Develop dwarf wheat varieties; (b6) Wheat breeding.
[0041] In some implementations, the regulation of wheat plant height is a negative regulation of wheat plant height, or a reduction of wheat plant height.
[0042] In some embodiments, the reduction in wheat plant height means that the plant height of wheat plants containing the wheat TaPPKL3 mutant, nucleic acid molecule, expression cassette or vector, and host cell described in this invention is lower than that of wheat plants containing wild-type parental TaPPKL3 protein.
[0043] The plant height refers to the height from the ground to the highest point of the wheat.
[0044] In some embodiments, wheat plants containing the wheat TapPKL3 mutant, nucleic acid molecule, expression cassette or vector, and host cell described in this invention exhibit a plant height reduction of approximately 10%-90% compared to the wild-type parent, for example, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 55%, 60%, 65%, 70%, 75%, 80%, and 85%.
[0045] In some implementations, the regulation of wheat ear length is a negative regulation of wheat ear length, or a reduction of wheat ear length.
[0046] In some embodiments, reducing the ear length of wheat means that the ear length of wheat plants containing the wheat TapPKL3 mutant, nucleic acid molecule, expression cassette or vector, or host cell described in this invention is lower than that of wheat plants containing wild-type parent TapPKL3 protein.
[0047] In some embodiments, the regulation of wheat grain width or yield is a positive regulation of wheat grain width or yield, or an increase in grain width.
[0048] In some embodiments, the increase in grain width refers to the increase in grain width of wheat plants containing the wheat TaPPKL3 mutant, nucleic acid molecule, expression cassette or vector, and host cell described in this invention by approximately 5%-30% compared to wild-type parents, for example, 5%, 8%, 10%, 15%, 20%, 25%, or 30%.
[0049] In some implementations, regulating the number of wheat tillers means negatively regulating the number of wheat tillers, or reducing the number of wheat tillers.
[0050] A sixth aspect of the present invention provides a method for reducing wheat plant height, comprising the step of introducing the wheat TaPPKL3 mutant of the present invention into plant cells, plant seeds, plant tissues, plant parts or plants, wherein the plant is wheat.
[0051] A seventh aspect of the present invention provides a method for breeding dwarf wheat varieties, comprising the step of introducing the wheat TaPPKL3 mutant of the present invention into plant cells, plant seeds, plant tissues, plant parts or plants, wherein the plant is wheat.
[0052] An eighth aspect of the present invention provides a method for increasing the length and width of wheat grains, comprising the step of introducing the wheat TaPPKL3 mutant of the present invention into a plant cell, plant seed, plant tissue, plant part or plant, wherein the plant is wheat.
[0053] In the above method, introducing the wheat TaPPKL3 mutant of the present invention includes the step of expressing the TaPPKL3 mutant protein in plant cells, plant tissues, plant parts or plants, for example, by expressing the mutant protein through an expression vector, or by integrating the nucleic acid molecule encoding the mutant protein into the plant genome for expression.
[0054] In some embodiments, introducing the wheat TapPKL3 mutant of the present invention includes the step of mutating and expressing the endogenous TapPKL3 protein-encoding gene of the plant.
[0055] In some implementations, the TapPKL3 mutant includes deletions / deletions, additions, truncations, substitutions, etc. of TapPKL3.
[0056] Among the methods described above, the methods for introducing mutations include natural variation, physical mutagenesis (such as ultraviolet mutagenesis, X-ray or gamma-ray mutagenesis), chemical mutagenesis (such as nitrite, hydroxylamine, EMS, nitrosoguanidine, etc.), biological mutagenesis (such as virus or bacterial-mediated mutagenesis), and gene editing.
[0057] It should be further explained that, since wheat is an allohexaploid, the TapPKL3 gene contains three copies: TapPKL3-5A, TapPKL3-5B, and TapPKL3-5D. Therefore, it is necessary to edit the gene of these three homologous copies simultaneously.
[0058] Those skilled in the art can easily mutate the nucleotide sequence of the TapPKL3 gene of the present invention using known methods, such as site-directed mutagenesis (including oligonucleotide primer-mediated site-directed mutagenesis, PCR-mediated site-directed mutagenesis, and cassette mutagenesis) or directed evolution (including error-prone PCR, DNA shuffling, and in vitro random recombination).
[0059] Based on the above technical solution, the present invention has the following technical effects: 1. This invention screened out a group of mutated wheat TapPKL3 gene sequences.
[0060] 2. This invention designs a guide single-stranded RNA (sgRNA) targeting the TapPKL3 gene, constructs an expression vector that can knock out the TapPKL3 gene in wheat, and genetically transforms wheat to obtain TapPKL3 gene knockout progeny. ko- tapppkl3-15#, Compared with the wild type, its plant height, ear length, and number of tillers are reduced, while the grain width is increased, and the thousand-grain weight is not significantly different.
[0061] 3. This invention provides a practical method for using genetic engineering technology to achieve rapid wheat breeding and cultivate lodging-resistant wheat, and has important breeding application value. Attached Figure Description
[0062] Picture 1 This is a strain in which gene editing occurred in all three homologous copies in the embodiments of the present invention. ko-tappkl3-15# Sequencing results; Picture 2 The wild-type protein encoded by the homologous copy gene TapPKL3-5A in this embodiment of the invention is compared with the gene-edited strain. ko-tappkl3-15# A schematic diagram comparing the results of encoded proteins; Picture 3 The wild-type protein encoded by the homologous copy gene TapPKL3-5B in this embodiment of the invention is compared with the gene-edited strain. ko-tappkl3-15# A schematic diagram comparing the results of encoded proteins; Picture 4 The wild-type protein encoded by the homologous copy gene TapPKL3-5D in this embodiment of the invention is compared with the gene-edited strain. ko-tappkl3-15# A schematic diagram comparing the results of encoded proteins; Picture 5 As described in the embodiments of the present invention ko-tappkl3-15# Amplified fragments of the editing site in the strain, where: 1 is the Transgen 2K plus marker, and 2-12 are... ko-tappkl3-15# The results of PCR amplification fragments in the progeny are shown in Figure 13, which is the result of PCR amplification fragment in JW1, and Figure 14 is the result of negative control amplification using water as a template. Picture 6 The JW1 and homozygous gene knockout lines in the embodiments of the present invention ko-tappkl3-15#Comparison of agronomic traits such as plant height, spike length, and grain width; where: A is a picture of wheat plants taken at the same time, B is a comparison of plant height, C is a comparison of tiller number, D is a comparison of effective tiller number, E is a picture of wheat spike type taken at the same time, F is a comparison of spike length, G is a comparison of spikelet number, H is a comparison of thousand-grain weight, I is a schematic diagram of grain length, J is a comparison of grain length, K is a schematic diagram of grain width, and L is a comparison of grain width; in the figure, different letters above the bars indicate statistically significant differences between different samples, and the same letter indicates no significant difference. Detailed Implementation
[0063] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0064] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0065] As mentioned earlier, identifying key genes that control grain size and plant height has important application value for wheat strain improvement and high-yield breeding.
[0066] In view of this, this invention has conducted in-depth research on the genes that regulate wheat grain size and plant height. Using the wild-type wheat variety JW1 as experimental material, this invention employed CRISPR / Cas9 gene editing technology to perform the following mutation treatments on the wheat TapPKL3-5A, TapPKL3-5B, and TapPKL3-5D genes: (1) The deletion of the 329th base in the wheat TaPPKL3-5A gene sequence corresponding to SEQ ID NO:4 causes a frameshift mutation, which changes the reading frame. The 109th amino acid of the mutant protein TaPPKL3-5A begins to shift, and the corresponding gene function is lost.
[0067] (2) The deletion of bases 325 to 326 in the wheat TaPPKL3-5B gene sequence corresponding to SEQ ID NO: 5 causes a frameshift mutation, which changes the reading frame. The mutant protein TaPPKL3-5B begins to show a frameshift from the 109th amino acid, and the corresponding gene function is lost.
[0068] (3) The deletion of bases 323 to 327 in the wheat TaPPKL3-5D gene sequence corresponding to SEQ ID NO: 6 causes a frameshift mutation, which changes the reading frame. The mutant protein TaPPKL3-5D begins to show a frameshift from the 108th amino acid, and the corresponding gene function is lost.
[0069] The above mutation treatment yielded wheat TapPKL3 mutants. The amino acid sequence of TapPKL3-5A of the wheat TapPKL3 mutant is shown in SEQ ID NO: 1, the amino acid sequence of TapPKL3-5B of the wheat TapPKL3 mutant is shown in SEQ ID NO: 2, and the amino acid sequence of TapPKL3-5D of the wheat TapPKL3 mutant is shown in SEQ ID NO: 3.
[0070] Comparison between the wheat TaPPKL3 mutant and the wild-type wheat variety JW1 revealed that the TaPPKL3 mutant exhibited significantly reduced plant height and spike length, significantly increased grain width, and decreased tiller number, while the thousand-grain weight and yield showed no significant difference compared to the wild type. Therefore, site-directed mutagenesis of the wheat TaPPKL3-5A, TaPPKL3-5B, and TaPPKL3-5D genes using existing genetic engineering techniques can yield wheat mutants with reduced plant height and increased grain length and width, laying the foundation for the breeding of dwarf, lodging-resistant wheat.
[0071] The high-fidelity enzyme required for PCR amplification was KOD-FX NEO (Toyobo); the restriction endonucleases BsaI and T4 ligase required for Gibson assembly were purchased from NEB; the gel extraction kit and plasmid extraction kit required for enzyme fragment recovery were purchased from Thermo Fisher Scientific. The inorganic salts required for culture medium preparation were purchased from Sinopharm Group, and the vitamins and antibiotics were purchased from Sigma-Aldrich. The *E. coli* strain used in this invention is... E. coli Transgen 5α, purchased from Beijing Quanshijin Company.
[0072] The wheat variety JW1 used in this invention is a new germplasm with good tissue culture ability bred by the Crop Research Institute of Shandong Academy of Agricultural Sciences. It is available to the public from the Crop Research Institute of Shandong Academy of Agricultural Sciences. This biological material is only used to repeat the relevant experiments of this invention and cannot be used for other purposes.
[0073] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0074] Example 1: Design and expression vector of sgRNA 1. Design of sgRNAs targeting TapPKL3 The TaPPKL3 gene has one copy each on wheat chromosome 5, A, B, and D (TaPPKL3-5A, TaPPKL3-5B, and TaPPKL3-5D, respectively). The nucleotide sequence of the TaPPKL3 gene in genome A has 100% similarity to the gene TraesCS5A02G030300 (Chromosome 5A: 26,440,090-26,449,927 forward strand) in the Ensembl Plants database (http: / / plants.ensembl.org / index.html). The nucleotide sequence of the TaPPKL3-5A coding region (CDS) is shown in SEQ ID NO: 4. The nucleotide sequence of the TaPPKL3 gene in genome B has similarity to the gene TraesCS5B02G029100 (Chromosome 5B: 27,830,119-27,840,027 reverse strand) in the Ensembl Plants database. The sequence similarity of the TaPPKL3 gene in the D genome is 100% with that of the gene TraesCS5D02G038500 (Chromosome 5D:37,321,983-37,331,860 forward strand.) in the Ensembl Plants database. The nucleotide sequence of the TaPPKL3 gene in the D genome is 100% with that of the gene TraesCS5D02G038500 (Chromosome 5D:37,321,983-37,331,860 forward strand.). The nucleotide sequence of the TaPPKL3-5D coding region (CDS) is shown in SEQ ID NO: 6.
[0075] To design sgRNAs capable of editing the coding region of the TapPKL3 gene, suitable target sites were searched in the coding region of the TapPKL3 gene using the website CRISPRdirect (http: / / crispr.dbcls.jp / ). A 20 bp sequence fragment was found before or after the PAM structure and set as the target sequence. In this embodiment, one sgRNA was used as an example for knockout experiments, and its nucleotide sequence is CAGCGGCTGATCCTCTTCGG (SEQ ID NO: 7).
[0076] 2. pBUE411-TaPPKL3 binary expression vector The example uses the plant CRISPR / Cas9 gene editing vector pBUE411, which contains the wheat U3 promoter TaU3 to initiate sgRNA. Cas9 mimics the characteristic of high 5' GC content in grass genes and is a genetically designed and synthesized gene with optimized plant codons. The plasmid pBUE411 is publicly available from China Agricultural University, and its sequence is publicly known, at 17430 bp.
[0077] The plant binary expression vector pBUE411-TaPPKL3 consists of expression cassette E1 and expression cassette E2. Expression cassette E1, from upstream to downstream, consists of: a wheat TaU3 promoter, an sgRNA targeting the TaPPKL3 gene, and a terminator T1. Expression cassette E2, from upstream to downstream, consists of: a maize ubiquitin promoter Ubi, a maize Cas9 coding sequence, and a terminator T2. The nucleotide sequences of the wheat TaU3 promoter, terminator T1, the maize ubiquitin promoter Ubi, the maize Cas9 coding sequence, and terminator T2 have been disclosed in patent "202411320638.3". The nucleotide sequence information of pBUE411-TaPPKL3 is as follows: the nucleotide sequence of the plant binary expression vector pBUE411-TaPND in patent "202411320638.3" is replaced with cagcggctgatcctcttcgg (SEQ ID NO: 7), which is the nucleotide sequence of the plant binary expression vector pBUE411-TaPPKL3 of this application.
[0078] Example 2: Obtaining and Identifying Transgenic Offspring 1. Acquisition of TaPPKL3 transgenic offspring The plant binary expression vector pBUE411-TaPPKL3 from Example 1 was transformed into Agrobacterium EHA105 competent cells. Specifically, the plant binary expression vector pBUE411-TaPPKL3 was added to Agrobacterium EHA105 competent cells and incubated on ice for 5 min, flash-frozen in liquid nitrogen for 5 min, heat-shocked at 37°C for 5 min, then incubated on ice for 5 min. Antibiotic-free LB medium was added, and the cells were incubated on a shaker at 28°C for 2 h. The cells were then spread onto LB agar plates (containing rifampin, streptomycin, and kanamycin) and incubated upside down at 28°C until colonies emerged. Single colonies were picked and inoculated into LB medium containing the corresponding antibiotics, and cultured at 28°C and 160 rpm for 24 hours.
[0079] Take JW1 wheat seeds approximately 15 days after pollination and remove the embryos. Add 1 mL of Agrobacterium suspension to a 1.5 mL centrifuge tube and mix with 1.4 μL of acetylsylgenone (0.1M). Infect the tube with the prepared bacterial solution for 5 minutes, then place it on a co-culture medium and incubate in the dark at 23°C for 3 days. After co-culture, place it on a resting medium and incubate in the dark at 25°C for 5 days. Transfer the callus tissue to selection medium 1, seal the culture dish with sealing film, and incubate in the dark at 25.5°C for 2 weeks. After cutting the callus, transfer it to selection medium 2, seal the culture dish again with sealing film, and continue incubating in the dark at 25.5°C for 2 weeks. After 2 weeks of callus selection, resistant callus showing green buds is transferred to regeneration medium. Seal the culture dish and incubate in a 25°C incubator with light / dark (16 h / 8 h) cycle for 2 weeks. After 2 weeks of regeneration, transfer healthy seedlings to new resistance regeneration boxes. Once the seedlings have grown to a certain size, samples can be taken for testing.
[0080] The various culture media and their preparation methods involved in the above-mentioned wheat genetic transformation are described in the following literature: Kan Wang (ed.), Agrobacterium Protocols: Volume 1, Methods in Molecular Biology, vol. 1223 DOI 10.007 / 978-1-4939-1695-5_15, Spring Science + Businedd Media New York 2015. The formulations of co-culture medium, resting medium, selection medium 1, selection medium 2, and regeneration medium are shown in Table 1.
[0081] Table 1 Culture medium formulation
[0082] Young leaves of regenerated wheat were collected, and genomic DNA was extracted using the CTAB method. PCR identification was performed using primers from two vectors: BUE-DF1 (TCATTGAGCAGATTTCCGAGT, SEQ ID NO: 8) and BUE-DR1 (ATTTGCAGCTTTTCTAGGTCT, SEQ ID NO: 9). The PCR reaction system was as follows: 2×PCR master mix: 10 μL, BUE-DF1 (10 μM): 0.5 μL, BUE-DR1 (10 μM): 0.5 μL, gDNA (50 ng / μL): 1 μL, ddH2O: 8 μL. The PCR reaction program was: 95 ℃ pre-denaturation for 5 min, 95 ℃ denaturation for 30 s; 58 ℃ annealing for 30 s, 72 ℃ extension for 30 s, 32 cycles; 72 ℃ annealing for 5 min.
[0083] 2. Identification of TapPKL3 transgenic knockout progeny Wheat is an allohexaploid, and the TapPKL3 gene is a copy on chromosome 5A. Homologous copies on chromosomes 5B and 5D are TapPKL3-5B and TapPKL3-5D, respectively. The DNA sequences of these three copies show high homology, necessitating simultaneous detection of gene editing in all three homologous copies. This experiment used the Hi-TOM gene editing site detection kit purchased from Xi'an Qingxue Biotechnology Co., Ltd. This kit performs high-throughput library construction via PCR and directly analyzes the variation information from multiple samples and sites using the Hi-TOM online software. TapPKL3-5A, TapPKL3-5B, and TapPKL3-5D were simultaneously amplified using specific primers Seq-F (ggagtgagtacggtgtgcCCGTGACCGCGCGGGGGATCTCGAGCT, SEQ ID NO: 10) and Seq-R (gagttggatgctggatggGCCGTACGGATCCCGGCGCTCCCAGCC, SEQ ID NO: 11) flanking the target sequence. The first round of PCR reaction consisted of 1 μL of leaf DNA from wheat plants transfected with the pBUE411-TaPPKL3 gene as a template, 10 μL of 2× Taq Master Mix from the kit, 0.5 μL each of Seq-F and Seq-R (10 μM), and Nuclease-free Water to a final volume of 20 μL. The PCR reaction conditions were as follows: 94 ℃ pre-denaturation for 2 min; 94 ℃ denaturation for 30 s, 64 ℃ annealing for 30 s, 72 ℃ extension for 20 s, for a total of 32 cycles; and a final extension at 72 ℃ for 5 min. After PCR, 5 μL of agarose gel was used for electrophoresis to detect the PCR products, ensuring the presence of the target product and good specificity. A second round of PCR was then performed. 1 μL of Hi-TOMMix from the kit was added, along with 1 μL of the first-round PCR product as a template, and Nuclease-free water was added to bring the volume to 20 μL. The PCR reaction program was: 94 ℃ denaturation for 2 min; 94 ℃ denaturation for 30 s, 58 ℃ annealing for 30 s, 72 ℃ extension for 25 s, for a total of 33 cycles; and a final extension at 72 ℃ for 5 min. The amplified products were mixed and recovered from the gel; the recovered gel product was used for library construction and sequencing, and was subsequently sent to Xi'an Qingxue Biotechnology Co., Ltd. for sequencing.
[0084] The gene editing results of the target genes, wheat TapPKL3-5A, TapPKL3-5B, and TapPKL3-5D, are as follows: Picture 1As shown, CGG highlighted in yellow represents the PAM structure. The wild-type protein encoded by the homologous copy gene TaPPKL3-5A is compared with that of the gene-edited strain. ko-tappkl3-15# Comparison of encoded protein results as follows Picture 2 As shown, the wild-type protein encoded by the homologous copy gene TapPKL3-5B is similar to that of the gene-edited strain. ko-tappkl3-15# Comparison of encoded protein results as follows Picture 3 As shown, the wild-type protein encoded by the homologous copy gene TapPKL3-5D is different from that of the gene-edited strain. ko- tappkl3-15# Comparison of encoded protein results as follows Picture 4 As shown, after comparison, the mutant proteins tappkl3-5a, tappkl3-5b, and tappkl3-5d exhibited frameshifts starting from amino acid 109; the mutant protein tappkl3-5a also showed frameshifts starting from amino acid 109; and the mutant protein tappkl3-5d showed frameshifts starting from amino acid 108. The results indicate that the sgRNA was successfully transformed into the Cas9 element and functioned, editing the TaPPKL3 gene, leading to premature termination of translation for the three proteins TaPPKL3-5A, TaPPKL3-5B, and TaPPKL3-5D, resulting in the loss of their corresponding gene functions.
[0085] Example 3: Representative typology identification of wheat after knockout of TapPKL3-5A, TapPKL3-5B, and TapPKL3-5D genes. To obtain homozygous knockout lines with three homologous copies of TapPKL3-5A, TapPKL3-5B, and TapPKL3-5D, restriction enzyme digestion amplification polymorphic sequence (Caps) markers were developed targeting the editing sites. The self-crossed offspring of the gene-editing mutants were then identified until homozygous mutants with simultaneous knockout of TapPKL3-5A, TapPKL3-5B, and TapPKL3-5D were obtained.
[0086] PCR amplification of the TapPKL3-5A, TapPKL3-5B, and TapPKL3-5D genes in gene-edited progeny was performed using Seq-F (SEQ ID NO: 10) and Seq-R (SEQ ID NO: 11). The PCR reaction system was as follows: KOD-FX NEO buffer: 10 μL, dNTP (2 mM): 4 μL, Seq-F (10 μM): 0.6 μL, Seq-R (10 μM): 0.6 μL, gene knockout line gDNA (approximately 20 ng / μL): 1 μL, KOD-FX NEO: 0.4 μL, and ddH2O to a final volume of 20 μL. The PCR reaction program was as follows: 98 ℃ pre-denaturation for 2 min, 98 ℃ denaturation for 12 s; 58 ℃ annealing for 20 s, 68 ℃ extension for 45 s, for 35 cycles; 68 ℃ annealing for 5 min.
[0087] The amplification products were detected by electrophoresis, and the results are as follows: Picture 5 As shown in the figure. The amplified products were sent to Xi'an Qingxue Biotechnology Co., Ltd. for sequencing, and the gene editing results are as follows. Picture 1 As shown, this allows for the screening of transgenic homozygous three-copy gene knockout lines. ko- tappkl3-15# .
[0088] The wild-type recipient variety JW1 and the homozygous knockout line obtained through screening were respectively... ko-tappkl3-15# Wheat was grown in a greenhouse at the Qingdao campus of Shandong University (120.41°E, 36.07°N) under the following conditions: light / dark ratio of 16 / 8 h; daytime temperature of 22°C and nighttime temperature of 16°C; humidity between 40% and 50%; and CO2 concentration between 500 ppm and 700 ppm. During the grain-filling stage, plant height, tiller number, and main spike length were recorded. The morphology of wild-type and knockout mutant plants was photographed using a Canon high-performance SLR camera. At the mid-to-late waxy ripening stage, individual wheat plants were harvested, and the morphology of the spikelet and ear was photographed. Grain width was also recorded. The thousand-grain weight of wheat was calculated. The harvested wheat seeds were placed in a 37°C constant-temperature incubator for 14 days to dry, and photographs were taken to analyze the JW1 and... ko-tappkl3-15# The length and width of wheat grains. For example... Picture 6 As shown in A, B, C, and D, the plant height, tiller number, and effective tiller number of the homozygous knockout mutant were significantly reduced compared to the wild type. Picture 6 In the comparison of ear type between the homozygous knockout mutant and the wild-type JW1, E represents the ear type. Picture 6 As shown in F and G, the spike length and spikelet number of the homozygous knockout mutant were significantly reduced compared to the wild-type JW1, as shown in F and G. Picture 6 As shown in H, the thousand-grain weight of the homozygous and knockout mutants was not significantly different from that of the wild-type JW1; Picture 6As shown in I and J, the grain length of the homozygous and knockout mutants was not significantly different from that of the wild-type JW1; Picture 6 As shown by K and L, the grain width of the homozygous and knockout mutants was significantly larger than that of the wild-type JW1. These results indicate that TapPKL3 plays a regulatory role in wheat plant height, tiller number, grain number per spike, and grain development.
[0089] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of them. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A wheat TaPPKL3 mutant, characterized by, The wheat TapPKL3 mutants include TapPKL3-5A, TapPKL3-5B, and TapPKL3-5D; The amino acid sequence of TaPPKL3-5A is shown in SEQ ID NO: 1, the amino acid sequence of TaPPKL3-5B is shown in SEQ ID NO: 2, and the amino acid sequence of TaPPKL3-5D is shown in SEQ ID NO:
3.
2. A nucleic acid molecule, characterized in that, Encodes the wheat TapPKL3 mutant as described in claim 1.
3. An expression box or carrier, characterized in that, It includes the nucleic acid molecule as described in claim 2.
4. A host cell, characterized in that, Contains the nucleic acid molecule of claim 2 or the expression cassette or vector of claim 3.
5. The use of the wheat TaPPKL3 mutant of claim 1, the nucleic acid molecule of claim 2, the expression cassette or vector of claim 3, or the host cell of claim 4 in any of the following: (b1) Regulating wheat plant height; (b2) Regulating wheat ear length; (b3) Regulating wheat grain width or yield; (b4) Regulating the number of wheat tillers; (b5) Develop dwarf wheat varieties; (b6) Wheat breeding.
6. The application as described in claim 5, characterized in that, The regulation of wheat plant height is a negative regulation of wheat plant height, or a reduction of wheat plant height.
7. The application as described in claim 5, characterized in that, The regulation of wheat grain size or yield is a positive regulation of wheat grain width or yield, or an increase in grain width.
8. A method for reducing wheat plant height, characterized in that, The step includes introducing the wheat TaPPKL3 mutant of claim 1 into plant cells, plant seeds, plant tissues, plant parts or plants, wherein the plant is wheat.
9. A method for breeding dwarf wheat varieties, characterized in that, The step includes introducing the wheat TaPPKL3 mutant of claim 1 into plant cells, plant seeds, plant tissues, plant parts or plants, wherein the plant is wheat.
10. A method for increasing the width of wheat grains, characterized in that, The step includes introducing the wheat TaPPKL3 mutant of claim 1 into plant cells, plant seeds, plant tissues, plant parts or plants, wherein the plant is wheat.
Citation Information
Patent Citations
Application of wheat TaPND gene
CN119410650B
Application of TGW3 mutant protein in regulation and control of rice grain traits
CN118308405A
Compositions and methods for increasing plant seed number and / or yield
WO2014150879A1