Virus element TuMV-S and application thereof in regulation and control of tobacco gene expression
The modified TuMV-S regulatory element enabled efficient and stable expression of exogenous genes in tobacco, solving the problem of low and unstable expression intensity of exogenous genes in tobacco and improving mRNA abundance, protein expression level and enzyme activity.
Patent Information
- Application Number
- CN202511135324.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-14
- Publication Date
- 2025-11-14
AI Technical Summary
Existing tobacco exogenous gene expression regulation technologies are susceptible to interference from complex endogenous regulatory networks, resulting in low and unstable expression intensity, making it difficult to match the unique developmental stages, tissue and organ differentiation, and environmental response mechanisms of tobacco.
The regulatory element TuMV-S was developed using the modified turnip mosaic virus (TuMV) 5'UTR sequence. A plant expression vector was prepared between the gene open reading frame and the promoter element, and gene expression was regulated using the Agrobacterium-mediated transient tobacco transformation system.
It significantly improved the mRNA stability and translation efficiency of exogenous genes in tobacco cells, and greatly enhanced the expression level and enzyme activity of the target protein.
Smart Images

Figure CN120944889A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of plant genetic engineering and synthetic biology, specifically relating to a regulatory element TuMV-S modified from the 5'UTR of turnip mosaic virus and its application in gene expression regulation. Background Technology
[0002] tobacco( Nicotiana tabacum Tobacco (Nicotiana spp.) is an annual herbaceous plant belonging to the genus Nicotiana in the family Solanaceae, primarily used in cigarette and cigar production. It exhibits vigorous growth, a large biomass (over 1000 kg / acre fresh weight), strong ecological adaptability, and significant secondary metabolic capacity. Tobacco is the most widely used plant substrate in synthetic biology. Especially in low-cost, green production scenarios for natural active substances and medicinal proteins, the tobacco substrate offers numerous irreplaceable advantages. Currently, various high-value natural active substances, including alkaloids, terpenes, glucosinolates, and phenylpropanes, have been successfully synthesized using tobacco as a substrate.
[0003] However, tobacco, as an allotetraploid plant, has a highly complex genetic background. Existing exogenous gene expression regulation technologies based on promoters and transcription factors are easily interfered with by complex endogenous regulatory networks, making it difficult for artificial anabolic pathways to match the unique developmental stages (such as the transition from vegetative to reproductive growth), tissue and organ differentiation (such as glandular trichome specialization), and environmental response mechanisms (such as photoperiod regulation) of tobacco. Therefore, there is an urgent need to develop novel regulatory elements to overcome the technical bottlenecks in the regulation of allogeneic gene expression in the tobacco chassis.
[0004] Turnip mosaic virus (TuMV) is an RNA virus belonging to the genus *Potatovirus Y*, with a wide host range. After infecting plants, TuMV virus rapidly causes symptoms such as stunted growth and leaf deformities, making it one of the most influential plant viruses currently known. TuMV viral RNA has a 3' poly(A) tail but lacks a 5' cap structure. The 5' untranslated regions (UTR) of TuMV viral RNA can form a complex structure to replace the 5' cap, recruiting the eIF4E of the host cell's eIF4F complex, and then binding to the 43S preinitiation complex (PIC) to initiate cap-independent translation, achieving efficient synthesis of viral proteins. Furthermore, the TuMV 5'UTR may participate in evading the host immune mechanism, protecting the viral RNA from degradation by host cells. Developing novel gene expression regulatory elements using the TuMV 5'UTR sequence can achieve efficient and stable expression of exogenous genes or metabolic pathways in plants, which is of great significance for research in plant synthetic biology. Summary of the Invention
[0005] This invention provides a regulatory element TuMV-S, which is modified from the 5'UTR sequence of turnip mosaic virus (TuMV). It can significantly improve the stability and translation efficiency of exogenous gene mRNA expression in tobacco cells, effectively solving the current problems of low and unstable expression intensity of exogenous genes in tobacco.
[0006] One of the technical solutions provided by the present invention is a regulatory element TuMV-S, the nucleic acid sequence of which is shown in SEQ ID NO.2; Furthermore, the TuMV-S is modified from the 5'UTR sequence of turnip mosaic virus (TuMV), and the TuMV 5'UTR nucleic acid sequence is shown in SEQ ID NO.1.
[0007] The second technical solution provided by this invention is the application of the regulatory element TuMV-S described in the first technical solution, particularly its application in gene expression regulation; Furthermore, its application is in the regulation of exogenous gene expression in tobacco cells; Furthermore, it is applied to improving the expression of exogenous genes in tobacco cells; particularly in improving the stability and translation efficiency of mRNA expressed by exogenous genes in tobacco cells. Furthermore, the tobacco includes, but is not limited to: Nicotiana tabacum , Nicotiana benthamiana , Nicotiana tomentosiformis , Nicotiana sylvestris or Nicotiana rustica .
[0008] The third technical solution provided by the present invention is a nucleic acid molecule encoding a target protein, wherein the nucleic acid molecule contains the regulatory element TuMV-S described in the first technical solution; Furthermore, the nucleic acid molecule also contains the coding sequence of the target protein; the target protein is a plant-derived protein. Furthermore, the plant exogenous proteins include, but are not limited to, transcription factors (such as MYB, NAC), enzymes (such as TPS, UGT), or reporter proteins (GFP, GUS).
[0009] The fourth technical solution provided by the present invention is a recombinant plasmid, wherein the recombinant plasmid carries the regulatory element TuMV-S described in the first technical solution or the nucleic acid molecule described in the third technical solution; Furthermore, the expression vectors used for the recombinant plasmids include, but are not limited to: pBI121, pBI221, pCAMBIA1300, pCAMBIA1301, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, or pCAMBIA2302.
[0010] The fifth technical solution provided by the present invention is a recombinant cell, wherein the genome of the recombinant cell integrates the regulatory element TuMV-S as described in the first technical solution; or, the genome of the recombinant cell integrates the nucleic acid molecule as described in the third technical solution; or, the recombinant cell is transfected with the recombinant plasmid as described in the fourth technical solution. Furthermore, the hosts used for the recombinant cells include, but are not limited to: Escherichia coli, yeast, tobacco, rice, or Arabidopsis thaliana; Preferably, the host used for the recombinant cells is tobacco ( Nicotiana tabacum (e.g., tobacco K326, etc.)
[0011] Beneficial effects: This invention prepares a plant expression vector by placing the viral element TuMV-S between the gene's open reading frame (ORF) and the promoter element (CMV35S). Based on an Agrobacterium-mediated transient tobacco transformation system, real-time quantitative PCR, Western blotting, and in vitro enzyme activity experiments revealed that, compared to not using the viral element, the TuMV-S element increased the target gene mRNA abundance by approximately 8.4 times, enzyme protein accumulation by approximately 28.6 times, and enzyme protein catalytic activity by approximately 19.8 times. Furthermore, the original TuMV 5'UTR increased the target gene mRNA abundance by approximately 7.1 times, enzyme protein accumulation by approximately 6.8 times, and enzyme protein catalytic activity by approximately 5.9 times. Therefore, the regulatory element TuMV-S provided by this invention can significantly regulate the expression of the target protein, resulting in a comprehensive improvement in the target protein's mRNA abundance, protein expression level, and enzyme activity. Attached Figure Description
[0012] Figure 1 RNA secondary structures of TuMV 5'UTR (left) and TuMV-S (right).
[0013] Figure 2 DNA band electrophoresis diagram The first lane band is Marker 2000, the second lane band is TuMV 5'UTR, and the third lane band is TuMV-S.
[0014] Figure 3 This is a plasmid map of pBI121-TuMV 5'UTR.
[0015] Figure 4 This is a plasmid map of pBI121-TuMV-S.
[0016] Figure 5 For tobacco leaves that transiently express pBI121, pBI121-TuMV 5'UTR and pBI121-TuMV-S GUS Gene mRNA abundance.
[0017] Figure 6 To measure GUS activity in tobacco leaves transiently expressing pBI121, pBI121-TuMV 5'UTR, and pBI121-TuMV-S.
[0018] Figure 7 The abundance of GUS protein in tobacco leaves transiently expressing pBI121, pBI121-TuMV 5'UTR, and pBI121-TuMV-S. In this text, red text indicates the grayscale value of the protein band. Detailed Implementation
[0019] The present invention will be described in full and in detail below through examples, which are intended to help readers thoroughly understand the contents disclosed herein, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples are all commercially available.
[0020] In this application, the 5'UTR from Turnip mosaic virus (TuMV) is named TuMV 5'UTR, and its nucleic acid sequence is shown in SEQ ID NO.1: 5'-aaaaaatataaaaactcaacataacatacacaaaacgattaaagcaaacacaaatctttcaaagcattcaagcaatcaaagattctcaaatctttcatcgttatcaaagcaatcaccaacagcaaaccaa-3'.
[0021] In this application, TuMV-S is obtained by modifying the TuMV 5'UTR sequence, and the nucleic acid sequence of TuMV-S is shown in SEQ ID NO.2: 5'-aaaacgattaaagcaaacacaacaacaaatctttcaacaacaaagcattcaagcaacaacaaatcaaagattctcaacaacaaatctttcatcgttatc-3'.
[0022] The present application will be further explained and illustrated below through specific embodiments.
[0023] Example 1: Design of component TuMV-S The full-length genome sequence of TuMV was downloaded from the NCBI public database, and the TuMV 5'UTR element was identified and isolated. Its nucleic acid sequence is shown in SEQ ID NO.1. Using ViennaRNA Package 2.0, the minimum free energy (MFE) at 28°C was calculated, and the RNA secondary structure of the TuMV 5'UTR was plotted based on the MFE base pairing probability. Figure 1 (Left). The linear regions at both ends of the 5'UTR of TuMV were removed, and a CAACAA motif was inserted into the stem-loop domain. Finally, an artificial element TuMV-S was obtained, whose nucleic acid sequence is shown in SEQ ID NO.2 (RNA secondary structure is shown in...). Figure 1 right).
[0024] Example 2: Cloning of components TuMV 5'UTR and TuMV-S DNA fragments of TuMV 5'UTR and TuMV-S were synthesized by Beijing Liuhe BGI Genomics Co., Ltd. according to the sequences shown in SEQ ID NO.1 and SEQ ID NO.2, and were used as templates for PCR amplification. Primers are shown in Table 1.
[0025] Table 1. Amplification primers for TuMV 5'UTR and TuMV-S
[0026] PCR amplification was performed using TakaRa PrimeSTARMax DNA polymerase. The PCR conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min. The PCR products were detected by 1% agarose gel electrophoresis. The TuMV 5'UTR fragment size was 130 bp, and the TuMV-S fragment size was 98 bp, both consistent with the expected sizes. Figure 2 ).
[0027] The target gene fragments were recovered using an agarose gel electrophoresis recovery kit. The TuMV 5'UTR and TuMV-S fragments were ligated to the TA cloning site of the pEASY-Blunt Zero vector (FullGen: CB101-01), and then transformed into *E. coli* DH5α clones. The transformation conditions were as follows: 5 μL of ligation product was added to 100 μL of competent cells, gently mixed, and incubated on ice for 30 min; the cells were then rapidly heat-shocked in a 42°C water bath for 90 s, immediately placed on ice for 2 min; 1 mL of LB liquid medium was added, and the cells were incubated at 37°C for 1 h; the bacterial suspension was centrifuged at 5000 rpm for 2 min, 900 μL of supernatant was discarded, the bacterial cells were resuspended, and plated on LB agar plates containing ampicillin (Amp, 100 mg / L) and incubated upside down in the dark for 14 h. Positive clones were screened using colony PCR, and positive single colonies were selected, plasmids were extracted, and the colonies were sent for sequencing.
[0028] Sequencing analysis yielded the 5'UTR of TuMV, whose nucleic acid sequence is shown in SEQ ID NO.1, containing 130 bases. A recombinant plasmid, pEASY-TuMV5'UTR, was obtained by inserting TuMV 5'UTR into the pEASY-Blunt Zero cloning vector. Similarly, sequencing yielded TuMV-S, whose nucleic acid sequence is shown in SEQ ID NO.2, containing 98 bases. A recombinant plasmid, pEASY-TuMV-S, was obtained by inserting TuMV-S into the pEASY-Blunt Zero cloning vector.
[0029] Example 3: Construction of expression vector Using pEASY-TuMV 5'UTR plasmid as a template, the TuMV 5'UTR fragment was amplified using TakaRa PrimeSTARMax DNA polymerase. The forward primer was TuMV 5'UTR-F-. Xba I: 5'-TCTAGaAAAACGAAAAGCAAACACAAC-3', reverse primer TuMV 5'UTR-R- Bam HI: 5'-GGATCCTTGGTTTGCTGTTGGTGATTGC-3'. PCR products were detected by 1% agarose gel electrophoresis. The target gene fragment was recovered using an agarose gel recovery kit. Bam HI and Xba I was subjected to double enzyme digestion, and with Bam HI and Xba pBI121 (Beijing Huayueyang Biotechnology: VECT0480), double-digested with enzyme I, carries the reporter gene. GUS(Gene) plasmid ligation. The ligation product was transformed into E. coli, clones were picked and cultured, and plasmids were extracted and sequenced. The positive plasmid was named pBI121-TuMV 5'UTR ( Figure 3 ).
[0030] Similarly, using pEASY-TuMV-S plasmid as a template, the TuMV-S fragment was amplified using TakaRa's PrimeSTARMax DNA polymerase, with the forward primer TuMV-SF- Xba I: 5'-TCTAGaAAACGAAAAGCAAACACAAC-3', reverse primer TuMV-SR- Bam HI: 5'-GGATCCGTCGTGGTTTGTTGTTGGTC-3'. PCR products were detected by 1% agarose gel electrophoresis. The target gene fragment was recovered using an agarose gel recovery kit. Bam HI and Xba I was subjected to double enzyme digestion, and with Bam HI and Xba The pBI121 plasmid (Beijing Huayueyang Biotechnology: VECT0480) was ligated after double digestion with enzyme I. The ligation product was transformed into E. coli, clones were picked and cultured, and plasmids were extracted and sequenced. The positive plasmid was named pBI121-TuMV-S (…). Figure 4 ).
[0031] Example 4: Agrobacterium-mediated transformation pBI121-TuMV 5'UTR and pBI121-TuMV-S, as well as the empty vector pBI121, were transformed into GV3101 Agrobacterium competent cells. The transformation conditions were as follows: 5 μL of empty vector pBI121, plasmid pBI121-TuMV 5'UTR, or pBI121-TuMV-S were added to 100 μL of competent cells, and the mixture was gently mixed and then subjected to liquid nitrogen cold shock for 2 min; the cells were incubated in a 37°C water bath for 30 min; 1 mL of LB liquid medium was added, and the cells were incubated at 28°C for 3 h; the bacterial culture was centrifuged at 8000 rpm for 2 min, 900 μL of supernatant was discarded, the bacterial cells were resuspended and plated on LB agar plates containing rifampicin (50 mg / L), gentamicin (50 mg / L), and kanamycin (50 mg / L), and incubated upside down in the dark for 48 h. Agrobacterium GV3101 / pBI121, GV3101 / pBI121-TuMV 5'UTR, and GV3101 / pBI121-TuMV-S containing the target plasmid were screened by colony PCR.
[0032] Example 5: Instantaneous transformation of tobacco The positive Agrobacterium strains GV3101 / pBI121, GV3101 / pBI121-TuMV 5'UTR, and GV3101 / pBI121-TuMV-S selected in Example 4 were inoculated into 5 mL of LB liquid medium (containing 50 mg / L rifampin, 50 mg / L gentamicin, and 50 mg / L kanamycin) and cultured in the dark at 28°C and 220 rpm for 48 h. The cells were then collected by centrifugation at 8000 rpm for 2 min, resuspended in MMA solution (containing 10 mM MES, 10 mM MgCl2, and 0.2 mM Acetosyringone), and adjusted to OD200. 600 =0.3, used as the bacterial solution for infection.
[0033] Using 4-week-old common tobacco seedlings K326 (culture conditions: temperature 24 ℃, light 16 h / dark 8 h) as experimental material, the three bacterial suspensions prepared above were injected into tobacco leaves using a 1 mL syringe (approximately 0.1 mL / cm³). 2 Meanwhile, uninjected leaves served as a control. The injected tobacco continued to be cultured in an artificial climate chamber, and tobacco leaves were sampled 48 hours after injection and placed in liquid nitrogen for subsequent experiments in Examples 6, 7, and 8.
[0034] Example 6: GUS mRNA abundance determination of genes qRT-PCR was used to measure the activity of tobacco leaf cells. GUS mRNA abundance of genes.
[0035] Total RNA extraction (CTAB method): 0.2 g tobacco leaves were placed in a 2 mL centrifuge tube, one sterile steel bead was added, and the mixture was frozen in liquid nitrogen and ground using a ball mill. 1000 μL of CTAB extraction buffer was added, and the mixture was incubated at 65°C for 1 h, inverting several times every 15 min during incubation. 300 μL of chloroform:isopropanol (24:1) solution was added, inverted to mix, and centrifuged at 13000 rpm at 4°C for 5 min. The supernatant was transferred to a new 2 mL centrifuge tube. 500 μL of chloroform:isopropanol (24:1) solution was added, inverted to mix, and centrifuged at 13000 rpm at 4°C for 5 min. The supernatant was transferred to a new 2 mL centrifuge tube. 300 μL of lithium chloride (8 M) solution was added, and the mixture was incubated at -20°C for 3 h. The mixture was centrifuged at 13000 rpm at 4°C for 5 min, the supernatant was discarded, and the mixture was washed with 75% ethanol. Dissolve in 50 μL of RNase-free ddH2O and store at -80℃.
[0036] RNA was reverse transcribed into cDNA using the Novizan HiScript III RT SuperMix for qPCR (+gDNA wiper) kit. The genomic DNA removal reaction mixture was as follows: 1 μg plant RNA, 4 μL 4×gDNA wiper Mix, and RNase-free ddH2O to a final volume of 16 μL. Genomic DNA removal reaction conditions: 42℃ for 2 min. Then, 4 μL of 5×HiScriptIII qRT SuperMix was added. Reverse transcription reaction conditions: 37℃ for 15 min, 85℃ for 5 s. After the reaction, the cDNA was diluted 10-fold with RNase-free ddH2O and used as a template for the qPCR reaction.
[0037] Real-time quantitative qPCR was performed using the Novizan ChamQ SYBR Color qPCR Master Mix kit. The reaction mixture consisted of: 10 μL 2×ChamQ SYBR Color qPCR Master Mix, 0.5 μL Primer F (10 µM), 0.5 μL Primer R (10 µM), 1 μL cDNA, and 8.5 μL RNase-free ddH2O. The qPCR reaction conditions were: 95℃ pre-denaturation for 30 s; 95℃ for 10 s, 60℃ for 30 s, for 40 cycles; and 95℃ for 10 s, 60℃ for 30 s, 95℃ for 10 s.
[0038] Primer information for qRT-PCR: qRT- GUS The forward primer is 5'-GTCTTTATACCGAAAGGTTGGGC-3'; qRT- GUS The reverse primer is 5'-GCTGCGATGGATTCCGGCATAG-3'; qRT- NtActin The forward primer for the (internal reference gene) is 5'-GATGAAGATACTCACAGAAAGA-3'; qRT- NtActin The reverse primer for the (internal reference gene) is 5'-GTGGTTTCATGAATGCCAGCA-3'.
[0039] The differences in the expression of pBI121, pBI121-TuMV 5'UTR, and pBI121-TuMV-S vectors in tobacco leaves were compared by RT-qPCR. GUS Differences in gene expression levels.
[0040] The results showed that, compared with pBI121, pBI121-TuMV 5'UTR, which contains the original viral element TuMV 5'UTR, can facilitate the exogenous... GUS The mRNA abundance of the gene increased by 7.1-fold, and pBI121-TuMV-S containing TuMV-S can enable exogenous... GUS The mRNA abundance of the gene increased by 8.4 times. Figure 5 ).
[0041] Example 7: Determination of GUS activity Use Coollabo GUS The reporter gene quantitative assay kit was used to determine the activity of GUS in tobacco leaf cells.
[0042] Total protein extraction: Take 0.1 g of fresh tobacco leaves, add steel balls, freeze in liquid nitrogen, and crush using a ball mill. Add 1 mL of protein extraction buffer and mix thoroughly. Centrifuge at 13000 rpm, 4℃ for 5 min. Transfer the supernatant to a new centrifuge tube and centrifuge at 13000 rpm, 4℃ for 5 min. The resulting supernatant is the protein extract and should be stored at -80℃.
[0043] Total protein concentration determination: Completely dissolve the protein standard, and dilute 10 μL to 250 μL, with a final concentration of 0.2 mg / ml. Add 0, 1, 2, 4, 8, 12, 16, and 20 μL of the standard to the wells of a 96-well plate, and add standard diluent to bring the total to 20 μL. Add an appropriate volume of sample to the wells of the 96-well plate, and add standard diluent to bring the total to 20 μL. Add 200 μL of diluted 1×G-250 staining solution (1:4 diluted with water) to each well, mix well, and incubate at room temperature for 5 min. Measure the absorbance at 595 nm using a microplate reader. Calculate the total protein concentration in the sample based on the standard curve.
[0044] GUS activity assay: Take 150 μL of protein extract and add 150 μL of 4-MTG substrate solution, incubate at 37℃ for 10 min. Take 100 μL of the above reaction system and add it to 900 μL of stop solution, mix well, and store in the dark. Excite the solution at 365 nm using a microplate reader, and measure the fluorescence value at 456 nm. Calibrate the fluorescence value of the 4-MT generated in the reaction solution using the fluorescence value of the standard solution. Calculate the GUS activity (MT / min / μg total protein).
[0045] The β-glucuronidase levels in tobacco leaves transiently expressing pBI121, pBI121-TuMV 5'UTR, and pBI121-TuMV-S vectors were compared using in vitro enzyme activity assays. GUS Enzyme activity (enzymes encoding proteins).
[0046] The results showed that, compared with pBI121, pBI121-TuMV 5'UTR, which contains the original viral element TuMV 5'UTR, increased β-glucuronidase activity by 5.9 times, and pBI121-TuMV-S, which contains TuMV-S, increased β-glucuronidase activity by 19.8 times. Figure 6 ).
[0047] Example 8: Western Blotting The abundance of GUS protein in tobacco leaf cells was determined using Western blotting.
[0048] Take the protein extract prepared in Example 7, add 5 × loading buffer, and incubate at 95°C for 5 min. Separate the target protein by SDS-PAGE gel electrophoresis, with a protein loading amount of 50 ng. Electrophoresis conditions: stacking gel 80 V, 40 min; separating gel 120 V, 90 min. Place filter paper, PVDF membrane, protein gel, and filter paper sequentially on the transfer plate, ensuring the PVDF membrane is close to the positive electrode and free of air bubbles between it and the gel. Perform transfer at a constant voltage of 200 V. After transfer, place the PVDF membrane in blocking buffer and block at room temperature for 1 h. Place the blocked PVDF membrane in diluted primary antibody solution and incubate at 4°C for 12 h. After primary antibody incubation, wash the PVDF membrane three times consecutively with a sufficient volume of TBST solution, 10 min each time. Place the washed PVDF membrane in diluted secondary antibody solution and incubate at room temperature for 1 h. After secondary antibody incubation, wash the PVDF membrane three times consecutively with a sufficient volume of TBST solution, 10 min each time. After dropping the freshly prepared enhanced chemiluminescence colorimetric solution onto the PVDF membrane and incubating it at room temperature for 1 min, the PVDF membrane was placed in a gel imaging scanner for exposure and color development.
[0049] Western blotting was used to compare the levels of β-glucuronidase in tobacco leaves transiently expressing pBI121, pBI121-TuMV 5'UTR, and pBI121-TuMV-S vectors, respectively. GUS Protein accumulation (gene-encoded proteins).
[0050] The results showed that, compared with pBI121, pBI121-TuMV 5'UTR, which contains the original viral element TuMV 5'UTR, increased the accumulation of β-glucuronidase protein by 6.8 times, and pBI121-TuMV-S, which contains TuMV-S, increased the accumulation of β-glucuronidase protein by 28.6 times. Figure 7 ).
[0051] The above results indicate that the regulatory element TuMV-S can significantly regulate the expression of the target protein, thereby comprehensively enhancing the mRNA abundance, protein expression level, and enzyme activity of the target protein.
[0052] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of the invention.
[0053] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. A control element TuMV-S, characterized in that, The nucleic acid sequence of the TuMV-S is shown in SEQ ID NO.
2.
2. The application of the regulatory element TuMV-S as described in claim 1 in gene expression regulation.
3. The application as described in claim 2, characterized in that, It is used in the regulation of exogenous gene expression in tobacco cells.
4. The application as described in claim 3, characterized in that, It is used to improve the stability and translation efficiency of exogenous gene mRNA expressed in tobacco cells.
5. The application as described in claim 3, characterized in that, The tobacco includes, but is not limited to: Nicotiana tabacum , Nicotiana benthamiana , Nicotiana tomentosiformis , Nicotiana sylvestris or Nicotiana rustica .
6. A nucleic acid molecule encoding a target protein, characterized in that, The nucleic acid molecule contains the regulatory element TuMV-S as described in claim 1; the nucleic acid molecule also contains the coding sequence of the target protein.
7. A recombinant plasmid, characterized in that, The recombinant plasmid carries the regulatory element TuMV-S as described in claim 1 or the nucleic acid molecule as described in claim 6.
8. The recombinant plasmid as described in claim 7, characterized in that, The expression vectors used for the recombinant plasmids include, but are not limited to: pBI121, pBI221, pCAMBIA1300, pCAMBIA1301, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, or pCAMBIA2302.
9. A recombinant cell, characterized in that, The recombinant cell has the regulatory element TuMV-S of claim 1 integrated into its genome; or, the recombinant cell has the nucleic acid molecule of claim 6 integrated into its genome; or, the recombinant cell is transfected with the recombinant plasmid of claim 7.
10. The recombinant cell as described in claim 9, characterized in that, The hosts used for the recombinant cells include, but are not limited to: Escherichia coli, yeast, tobacco, rice, or Arabidopsis thaliana. Preferably, the host used for the recombinant cells is tobacco ( Nicotiana tabacum (e.g., tobacco K326, etc.)