DsRNA (double-stranded ribonucleic acid) for inhibiting wheat root rot and application of dsRNA

Abstract

The invention provides dsRNA (double-stranded ribonucleic acid) for inhibiting wheat root rot bacteria and application of the dsRNA. The wheat root rot bacteria are Bipolaris sorokiniana, and the nucleotide sequence of the dsRNA is shown as SEQ ID NO.6. The dsRNA has the advantages that the dsRNA can be used for inhibiting the wheat root rot bacteria, and the dsRNA can be used for inhibiting the wheat root rot bacteria; the preparation method of the dsRNA comprises the following steps: designing a specific primer by taking BsASC1 as a target gene, carrying out PCR (Polymerase Chain Reaction) amplification by taking cDNA (Complementary Deoxyribonucleic Acid) of wheat root rot as a template, and carrying out in-vitro synthesis and transcription to obtain the dsRNA of a target fragment. The dsRNA disclosed by the invention can be used for preventing and treating wheat root rot and remarkably reducing the pathogenicity of wheat root rot and bipolaris hirsuta, the inhibition rate reaches 63%, meanwhile, the expression quantity of BsASC1 is reduced by 79%, the prevention and treatment effect is relatively good, and the dsRNA has a practical application value.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a dsRNA that inhibits wheat root rot fungus and its application. Background Technology

[0002] Wheat root rot is a soil-borne fungal disease worldwide, difficult to control, and severely reduces wheat yield and quality. In recent years, *Helicobacter pylori* (wheat root rot fungus) has been identified as a pathogen. Bipolaris sorokiniana Wheat root rot caused by WD40 is widespread in major wheat-producing areas. The WD40 domain is extremely common in eukaryotes, and the G protein β subunit is a WD protein that has been extensively studied. Research has found that the Gβ subunit participates in cAMP signaling and plays an important role in the growth, development, and infection of plant pathogenic fungi. As analogs of the G protein β subunit, Gβ-like proteins are structurally and functionally similar to the Gβ subunit. BsASC1 is a Gβ-like protein.

[0003] In recent years, RNAi technology has shown broad application prospects in the field of plant disease and pest control. Studies have shown that dsRNA targeting different pathogens in various pathogenic fungi, such as *Fusarium graminearum*, *Botrytis cinerea*, *Magnaporum rice*, and *Sclerotinia sclerotiorum*, has been applied to control pathogens with significant effects. In multiple studies, dsRNAs in the length range of 118-1403 nt have been successfully applied to SIGS, with dsRNAs of 150-550 nt being the most commonly used. In *Fusarium graminearum*, Werner et al. (Werner BT, Gaffar FY, Schuemann J, et al. RNA-spray-mediated silencing of Fusarium graminearumAGO and DCL Genes improve barley disease resistance[J]. Frontiers in plant science, 2020, 11: 476) found that long dsRNAs of 1528-1783 nt and short dsRNAs of 355-374 nt had similar silencing efficiencies; while Höfle et al. (Höfle L, Biedenkopf D, Werner BT, et al. Study on the efficiency of dsRNAs with increasing length in RNA-based silencing of the Fusarium CYP51(Genes. RNA Biology, 2020, 17(4): 463-473.) found that increasing the length of dsRNA from 220 nt to 1500 nt actually reduced the silencing efficiency. Degnan et al. (Degnan RM, McTaggart AR, Shuey LS, et al. Exogenous double-stranded RNA inhibits the infectionphysiology of rust fungi to reduce symptoms in planta[J]. Molecular plantpathology, 2023a, 24(3): 191-207.) found that 340 nt dsRNA was more effective than 685 nt dsRNA in silencing *Myrtle rust*. Austropuccinia psidii The silencing effect of the 28S rRNA gene is better. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a dsRNA that inhibits wheat root rot fungus and its application, which addresses the shortcomings of the prior art. Specific primers are designed with BsASC1 as the target gene, and PCR amplification is performed using cDNA of wheat root rot fungus as a template. The target fragment of dsRNA is obtained through in vitro synthesis and can be used to prevent and control wheat root rot.

[0005] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is: a dsRNA that inhibits wheat root rot fungus, wherein the wheat root rot fungus is Bipolaris sorokiniana, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO.6.

[0006] Preferably, the target gene of the dsRNA is BsASC1, the nucleotide sequence of which is shown in SEQ ID NO.1, and the target sequence of which is shown in SEQ ID NO.2.

[0007] The present invention also provides a method for preparing dsRNA that inhibits wheat root rot, comprising the following steps: designing specific primers dsBsASC1-4-F and dsBsASC1-4-R according to the target sequence of the BsASC1 gene, then using the cDNA of wheat root rot as a template, performing PCR amplification with the specific primers, and obtaining the target fragment dsRNA through in vitro synthesis and transcription; The nucleotide sequence of the BsASC1 gene is shown in SEQ ID NO.1; The target sequence of the BsASC1 gene is shown in SEQ ID NO.2; The nucleotide sequences of the specific primers dsBsASC1-4-F and dsBsASC1-4-R are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. The cDNA sequence of the wheat root rot pathogen is shown in SEQ ID NO.5; The nucleotide sequence of the dsRNA is shown in SEQ ID NO.6.

[0008] The present invention also provides the application of the dsRNA that inhibits wheat root rot fungus in the preparation of a formulation for the prevention and control of wheat root rot.

[0009] This invention has significant technical advantages compared to existing technologies: 1. This invention provides a method for preparing dsRNA that inhibits wheat root rot fungus. Specific primers are designed with BsASC1 as the target gene, and PCR amplification is performed using cDNA of wheat root rot fungus as a template. The target fragment of dsRNA is then synthesized in vitro.

[0010] 2. The dsRNA of this invention can be used to control wheat root rot, significantly reducing the pathogenicity of wheat root rot molluscum with an inhibition rate of 63%. At the same time, the expression level of BsASC1 decreased by 79%, showing good control effect and practical application value.

[0011] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments. Attached Figure Description

[0012] Figure 1 This is a bioinformatics analysis of BsASC1 in Example 1 of the present invention; wherein, A: BsASC1 protein domains; B: BsASC1 protein three-dimensional model; C: sequence alignment of ASC1 proteins from different pathogens, with the WD40 domain indicated by the red box; D: phylogenetic analysis of ASC1 proteins from different pathogens; Figure 2 This is a gel electrophoresis detection image of dsRNA from Example 1 of the present invention; Figure 3 This describes the absorption of Cy3-dsRNA by the hyphae of *Hymenopsporum oryzae* LK9-3 in Example 2 of this invention. Figure 4 This is the result of the growth morphology, colony diameter and hyphal BsASC1 expression level of LK9-3 under different concentrations of dsRNA in Example 2 of the present invention, where A: growth morphology; B: colony diameter; C: hyphal BsASC1 expression level. Figure 5This is an analysis of the control effect of dsRNA on *Helicobacter pylori* in Example 3 of the present invention, wherein A: control effect diagram; B: lesion length; C: expression level of BsASC1. Detailed Implementation

[0013] Example 1 This embodiment describes the inhibition of dsRNA synthesis by wheat root rot fungus: specific primers were designed based on the target sequence of the BsASC1 gene, and then PCR amplification was performed using the specific primers with wheat root rot fungus cDNA as a template. The target fragment of dsRNA was obtained through in vitro synthesis and transcription.

[0014] (1) Determination of target genes and target sequences The gene COCSADRAFT_22774, named BsASC1, is 1263 bp in length. Its nucleotide sequence is shown in SEQ ID NO.1, containing 3 exons and 2 introns, encoding 316 amino acids. Smart database analysis revealed that BsASC1 contains 7 WD40 domains (…). Figure 1 A). Multiple sequence alignment of Gβ and Gβ-like proteins of pathogens such as *Magnaporthe oryzae*, *Neurospora crassa*, *Fusarium oxysporum*, *Verticillium dahliae*, and *Botrytis cinerea* showed that the amino acid sequences of the Gβ-like proteins of these pathogens were highly conserved, all containing 7 WD40 repeat units. Figure 1 C). Phylogenetic trees were constructed using the NJ method, revealing that BsASC1 clustered with Gβ-like proteins from other fungi in the same branch ( Figure 1 D). Furthermore, a three-dimensional model constructed based on the BsASC1 amino acid sequence shows that it possesses a typical 7-β-sheet structure (D). Figure 1 (B) further demonstrates that BsASC1 is a Gβ-like protein. Therefore, BsASC1 is considered a target gene for inhibiting the synthesis of dsRNA by wheat root rot fungus.

[0015] Based on the seven WD40 repeat units of BsASC1, cDNA sequences containing different numbers of WD40 motifs were selected as target sequences, as shown in SEQ ID NO.2.

[0016] (2) Primer design Based on the target sequence of the BsASC1 gene (SEQ ID NO.2), specific primers dsBsASC1-4-F and dsBsASC1-4-R were designed, with nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0017] (3) Preparation of cDNA template for wheat root rot pathogen The target strain of Bipolaris sorokiniana LK9-3 was identified as the pathogen causing wheat root rot. This strain is preserved in the Fungal Pathogen Research Laboratory of Henan Agricultural University.

[0018] Total RNA was extracted from Bipolaris sorokiniana strain LK9-3 using the Plant RNA Extraction Mini Kit (MegGee), and then reverse transcribed into cDNA, as shown in SEQ ID NO.5.

[0019] (4) In vitro synthesis Using cDNA (SEQ ID NO.5) of *Helicobacter oryzae*, the causal agent of wheat root rot, as a template, PCR amplification was performed using specific primers dsBsASC1-4-F and dsBsASC1-4-R. A T7 promoter was added to the 5' segment of the F and R ends of the primers, and dsRNA was synthesized in vitro using the HyperScribe™ T7 High Yield Cy3 RNA Labeling Kit (ApexBio, K1061). The PCR amplification reaction system is shown in Table 1. Table 1 PCR amplification system The PCR reaction procedure is shown in Table 2: Table 2 PCR reaction procedure PCR product recovery: The amplification products were subjected to 1% agarose gel electrophoresis. The target DNA band in the gel was cut under UV light and placed into a sterile centrifuge tube. Add three times the volume of GSB and sol in a 55°C water bath. After the gel is completely melted, cool to room temperature, add 100µL of isopropanol, and mix gently. Add the melted gel solution to the adsorption column, let stand for 1 minute, centrifuge at 10000g for 1 minute, and discard the effluent; Add WB (pre-added with anhydrous ethanol), centrifuge at 10000g for 1 min, and discard the effluent; Centrifuge at 10000g for 2 minutes to remove residual white blood cells (WB); Transfer the adsorption column to a centrifuge tube, add 30µL of preheated EB solution or deionized water at 72℃ to the center of the column, and let stand at room temperature for 1 min. Centrifuge at 10000g for 1 min and elute; store the eluted fragments at -20℃ for later use.

[0020] (5) In vitro transcription Using PCR products as templates, in vitro transcription of dsRNA was performed using the Polanzo T7 RNA Transcription Kit. RNase-free PCR tubes were prepared, containing 4 μL of 4×gDNA wiper Mix, 1 pg-1 μg of template RNA, and RNase-free ddH2O to a final volume of 16 μL. The mixture was gently pipetted and briefly centrifuged at 42°C for 2 min. Then, 4 μL of 5×HiScript II qRT SuperMix II was added directly to the reaction mixture, gently pipetted and briefly centrifuged at 50°C for 15 min, followed by 85°C for 5 s to obtain cDNA products. These products were stored at -20°C for later use. All procedures were performed on ice to prevent RNA degradation.

[0021] The nucleotide sequence of the dsRNA is shown in SEQ ID NO.6, with a length of 388 bp, containing two WD40 domains. The gel electrophoresis image of the dsRNA is shown below. Figure 2 As shown in the figure, M represents DL 2000 DNA Maker.

[0022] Example 2 This example demonstrates a plate inhibition experiment of dsRNA against *Helicobacter pylori*, the causal agent of wheat root rot. The efficiency of dsRNA uptake by LK9-3 hyphae was observed after co-culturing double-stranded dsRNA labeled with fluorescein Cy3 with LK9-3 hyphae.

[0023] The method is as follows: (1) Fluorescein Cy3-labeled dsRNA was synthesized in vitro using the HyperScribe™ T7 High Yield Cy3 RNA Labeling Kit (ApexBio, K1061), and was denoted as Cy3-dsRNA. (2) The concentrations of Cy3-dsRNA were adjusted with RNase-free water to 20 ng / μL, 50 ng / μL, 80 ng / μL, 100 ng / μL, and 150 ng / μL, respectively; (3) Add 100 μL of Cy3-dsRNA at different concentrations to the center of a 90 mm agar plate containing 15 mL of PDA, and use 100 μL of H2O as a control. Spread the dsRNA around the center of the plate using a spreader, and place the LK9-3 strain mycelium in the center of the plate. After incubation at 25℃ for 3 days, photograph and record the colony morphology. Then place the plate at -80℃ for more than 3 hours, scrape the surface hyphae with a sterile scalpel, transfer the hyphae to a 2 mL enzyme-free EP tube, freeze in liquid nitrogen, and store at -80℃. Then extract the hyphal RNA, reverse transcribe it to obtain cDNA, and perform real-time quantitative PCR (qRT-PCR) to determine the expression level of BsASC1 in the hyphae under different concentrations of dsRNA treatment. The method is as follows: ①RNA extraction: Total RNA was extracted using the Plant RNA Extraction Mini Kit (Meg). ② cDNA reverse transcription: cDNA was obtained by reverse transcription using the All-in-One Script Rtpremix kit (Krypton). ③RT-qPCR detection: Using cDNA as a template, β-Actin as an internal reference gene, and H2O treatment as a control, the expression level of BsASC1 was determined using a real-time quantitative PCR system (ABI 7500, USA). The primers are as follows: qPCR-BsASC1-F:ATGACGAGGAATGAGACG, qPCR-BsASC1-R:TATCTCGCTTTCCTTCTC; The primers for the internal reference gene β-Actin are: β-Actin-F: GTATGGGCCAAAAGGACTCA, β-Actin-R: CACGCAGCTCGTTGTAGAAG.

[0024] The reaction system for real-time PCR is shown in Table 3: Table 3. Real-time PCR reaction system The procedure for real-time PCR is shown in Table 4: Table 4. Quantitative Real-Time PCR Reaction Procedure: Figure 3 This figure shows the uptake of Cy3-dsRNA by LK9-3 hyphae. In the figure, Bright represents the bright field, Cy3 represents the fluorescent field, and Merge represents the fused field. The results indicate that LK9-3 hyphae can absorb dsRNA.

[0025] Figure 4 The results show the growth morphology, colony diameter, and BsASC1 expression level of LK9-3 under different concentrations of dsRNA. A: growth morphology; B: colony diameter; C: BsASC1 expression level in LK9-3 hyphae. The results indicate that, compared with the control (H2O treatment), different concentrations of dsRNA had no significant effect on the growth of LK9-3. Figure 4 qRT-PCR results showed that both 80 ng / μL and 100 ng / μL of dsRNA decreased the expression level of BsASC1 in mycelia, and 100 ng / μL of dsRNA decreased the expression level of BsASC1 in mycelia by 57%. The optimal concentration of dsRNA for the uptake of *Hymenochrysis fusiforme* was 100 ng / μL. Figure 4 C).

[0026] Example 3 This example demonstrates the efficacy of dsRNA in controlling the pathogenicity of *Hymenochloa crus-galli*.

[0027] The *Helicobacter oryzae* strain LK9-3 was placed on a PDA plate and cultured at 25°C for 3 days to complete activation. Then, a 5 mm mycelial cake with half of its mycelium attached was taken from the edge of the mycelium and inoculated onto wheat leaves. 50 μL of dsRNA (100 ng / μL) or 50 μL of H2O was added to the mycelial cake before inoculation. After 24 h, the mycelial cake was removed, and another 50 μL of dsRNA (100 ng / μL) or 50 μL of H2O was added to the infected area. Three days after inoculation, the lesion area was measured and photographed. Samples were then taken from the diseased area (the boundary between diseased and healthy tissue) and stored at -80°C for later use. RNA was then extracted from the diseased leaves, reverse transcribed to obtain cDNA, and the expression level of BsASC1 was determined by real-time quantitative PCR (qRT-PCR), using the same method as in Example 2.

[0028] Figure 5 This study analyzed the control effect of 100 ng / μL dsRNA on *Hymenobacter oryzae*, where A: control effect diagram; B: lesion length; C: BsASC1 expression level (* indicates significant difference, * P < 0.05, ** P < 0.01, t-test). The results showed that spraying 100 ng / μL dsRNA on LK9-3 mycelial cakes significantly reduced the pathogenicity of *Hymenobacter oryzae*, with an inhibition rate of 63%, while simultaneously decreasing BsASC1 expression by 79%.

[0029] In summary, dsRNA has a good control effect on infection by *Hymenochrysis fusilli*, indicating that the BsASC1 gene can be used as a target of SIGS to control *Hymenochrysis fusilli*.

[0030] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any way. Any simple modifications, alterations, and equivalent changes made to the above embodiments based on the inventive essence shall still fall within the protection scope of the present invention.

Claims

1. A dsRNA that inhibits wheat root rot fungus, characterized in that, The nucleotide sequence of the dsRNA is shown in SEQ ID NO.

6.

2. The dsRNA for inhibiting wheat root rot fungus according to claim 1, characterized in that, The pathogen causing wheat root rot is *Bipolaris sorokiniana*.

3. The dsRNA for inhibiting wheat root rot fungus according to claim 1, characterized in that, The target gene of the dsRNA is BsASC1, the nucleotide sequence of which is shown in SEQ ID NO.1, and the target sequence of which is shown in SEQ ID NO.

2.

4. A method for preparing dsRNA according to any one of claims 1 to 3, characterized in that, Includes the following steps: Based on the target sequence of the BsASC1 gene, specific primers dsBsASC1-4-F and dsBsASC1-4-R were designed. Then, using the cDNA of wheat root rot fungus as a template, PCR amplification was performed using the specific primers. The target fragment dsRNA was obtained through in vitro synthesis and transcription. The nucleotide sequence of the BsASC1 gene is shown in SEQ ID NO.1; The target sequence of the BsASC1 gene is shown in SEQ ID NO.2; The nucleotide sequences of the specific primers dsBsASC1-4-F and dsBsASC1-4-R are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. The cDNA sequence of the wheat root rot pathogen is shown in SEQ ID NO.5; The nucleotide sequence of the dsRNA is shown in SEQ ID NO.

6.

5. The use of the dsRNA of wheat root rot fungus as described in claim 1 in the preparation of an agent for the prevention and control of wheat root rot.

Images