Use of cassava common mosaic virus tgbp1 in inhibiting rna silencing

By expressing the TGBp1 gene of cassava common mosaic virus or its encoded protein in plants, the problem of viral repressive RNA silencing was solved, the expression level of GFP protein and the formation of Arabidopsis mRNA degradation pathway processors were increased, and the antiviral ability of plants was enhanced, providing a new gene target for cassava disease resistance breeding.

CN120944956BActive Publication Date: 2026-02-27SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511479106.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-16
Publication Date
2026-02-27
Estimated Expiration
2045-10-16

AI Technical Summary

Technical Problem

In the current technology, the function of cassava mosaic virus TGBp1 is not clear, and it is difficult to effectively inhibit RNA silencing, leading to virus infection and yield loss.

Method used

By using the cassava mosaic virus TGBp1 gene or its encoded protein, and expressing it in plants via recombinant vectors or host bacteria, GFP silencing was inhibited and its expression level was increased, and the formation of Arabidopsis mRNA degradation pathway processors was enhanced.

Benefits of technology

It increased the expression level of GFP protein, suppressed the silencing of the target gene MeGRXC3, enhanced the plant's resistance to viruses, and provided a new target gene for cassava disease resistance breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120944956B_ABST
    Figure CN120944956B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to application of cassava common mosaic virus TGBp1 in inhibiting RNA silencing. The application research finds that TGBp1 has a silencing inhibition function, can inhibit mRNA of GFP from being degraded, and thus improves the expression amount of GFP protein; it is also found that TGBp1 can inhibit a target gene MeGRXC3 from being silenced and improve the expression function thereof; in addition, it is also found that TGBp1 can improve the number of mRNA degradation pathway processing bodies (a complex formed by interaction of Dcp1 protein and Dcp2 protein) of Arabidopsis. The research result not only lays a foundation for elucidating the function of TGBp1, but also provides a new target gene for cassava disease resistance breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to application of cassava common mosaic virus TGBp1 in inhibition of RNA silencing. BACKGROUND

[0002] Viruses are obligate parasites, and must escape or tolerate various anti-viral defense mechanisms of host cells to successfully infect. How viruses escape or tolerate various immune defense mechanisms such as post-transcriptional gene silencing (PTGS) of hosts to enhance pathogenicity is a research hotspot in recent years, and great progress has been made. PTGS is a conserved gene expression regulation mechanism in eukaryotes, which not only plays an important role in responding to development regulation, metabolism, maintaining the stability of genome, and resisting biological and non-biological stresses, but also is one of the important anti-viral immune mechanisms. Plants have formed multiple anti-viral PTGS signal pathways with different proteins participating, different functions but mutual overlapping in the evolution process. Viruses are obligate parasites, and must escape or tolerate degradation of host cells to successfully infect. Most plant viruses produce one or more silencing suppressors (Viral suppressors of RNA silencing, VSRs) in the co-evolution with plants, which are used to resist the anti-viral immune function of host PTGS. VSRs from different viruses have no homology in sequence and no similarity in structure, so their modes of action and mechanisms are also different.

[0003] Cassava (Manihot esculenta) is a perennial crop of Euphorbiaceae, mainly planted in tropical and subtropical countries and regions, and is the sixth largest food crop in the world. It is planted in many provinces (regions) in South China and central China, and the related industry occupies an important position in agricultural economy. Cassava mosaic virus disease has a devastating impact on the cassava industry, and the annual loss of cassava production due to mosaic disease worldwide is 25 million tons. Cassava common mosaic virus (CsCMV) is a virus of the genus Potexvirus in the family Alphaflexiviridae. CsCMV was first reported in southern Brazil and is widespread in Latin America. CsCMV has the typical molecular characteristics of Potexvirus viruses, is a single-partition positive-sense ssRNA (+) curved virus, and the virus particle size is about 15 nm x 495 nm. The genome size is about 6.4 kb, and there are cap structures and poly (A) tails at the 5' and 3' ends, respectively, to produce three subgenomic RNAs (sgRNAs), including five open reading frames (ORFs): ORF1 at the 5' end encodes a 165 kD RNA-dependent RNA polymerase (RdRp) essential for virus replication; the middle three ORFs 2, 3 and 4 encode three overlapping triple gene blocks (TGBs), respectively, TGBp1 of 25 kD, TGBp2 of 12 kD and TGBp3 of 10 kD; ORF5 at the 3' end encodes a 24 kD coat protein (CP). Among them, ORF1 is directly translated from viral genomic RNA, and other ORFs are translated from sgRNAs. Studies have shown that RdRp is the only virus protein absolutely required for virus replication, and TGBp1-3 and CP are essential for intercellular or long-distance movement of the virus. It is not clear whether TGBp1 has a silencing inhibition function. SUMMARY

[0004] The purpose of the present application is to overcome the deficiencies in the prior art, and to provide the application of cassava common mosaic virus TGBp1 in inhibiting RNA silencing.

[0005] The first aspect of the present application provides application of a TGBp1 gene, or a protein encoded by the TGBp1 gene, or a recombinant vector or host bacteria containing a coding region of the TGBp1 gene in inhibiting silencing of GFP and / or increasing GFP expression in plants, wherein the nucleotide sequence of the TGBp1 gene is shown as SEQ ID NO: 1.

[0006] Further, the plant is 16C transgenic Nicotiana benthamiana.

[0007] The second aspect of the present application provides application of a TGBp1 gene, or a protein encoded by the TGBp1 gene, or a recombinant vector or host bacteria containing a coding region of the TGBp1 gene in inhibiting degradation of GFP and increasing expression and / or accumulation of GFP protein, wherein the nucleotide sequence of the TGBp1 gene is shown as SEQ ID NO: 1.

[0008] The third aspect of the present application provides a TGBp1 gene, or a protein encoded by the TGBp1 gene, or a recombinant vector or host bacteria containing a coding region of the TGBp1 gene in inhibiting silencing of a target gene MeGRXC3 and increasing expression of the target gene, wherein the nucleotide sequence of MeGRXC3 is shown as SEQ ID NO: 2.

[0009] The fourth aspect of the present application provides application of a TGBp1 gene, or a protein encoded by the TGBp1 gene, or a recombinant vector or host bacteria containing a coding region of the TGBp1 gene in increasing processing bodies, wherein the nucleotide sequence of the TGBp1 gene is shown as SEQ ID NO: 1, the processing body is a complex formed by interaction of Dcp1 protein and Dcp2 protein, the nucleotide sequence of a gene encoding the Dcp1 protein is shown as SEQ ID NO: 3, and the nucleotide sequence of a gene encoding the Dcp2 protein is shown as SEQ ID NO: 4.

[0010] The present application finds that TGBp1 has a silencing inhibition function, can inhibit degradation of mRNA of GFP, and thus increase expression of GFP protein; finds that TGBp1 can inhibit silencing of a target gene MeGRXC3 and increase expression of the target gene; and finds that TGBp1 can increase the number of processing bodies (a complex formed by interaction of Dcp1 protein and Dcp2 protein) in a mRNA degradation pathway of Arabidopsis thaliana. The research results not only lay a foundation for elucidating the function of TGBp1, but also provide a new target gene for cassava breeding. BRIEF DESCRIPTION OF DRAWINGS

[0011] Figure 1Figure 6. GFP accumulation in 16C leaves infiltrated with pG1300 and TGBp1 expression vectors. pG1300: plant expression vector expressing GFP; CP-StHA: plant expression vector pCP-StHA expressing CP-StHA; TGBp1-StHA: plant expression vector pTGBp1-StHA expressing TGBp1-StHA; StHA: plant expression vector p1300-StHA expressing Ster and HA tag only; 16C: transgenic N. benthamiana overexpressing GFP; 5dpa: 5 days post Agroinfiltration.

[0012] Figure 2 Figure 7. GFP accumulation in 16C leaves infiltrated with pG1300 and TGBp1 expression vectors. pG1300: plant expression vector expressing GFP; CP-StHA: plant expression vector pCP-StHA expressing CP-StHA; TGBp1-StHA: plant expression vector pTGBp1-StHA expressing TGBp1-StHA; StHA: plant expression vector p1300-StHA expressing Ster and HA tag only; 16C: transgenic N. benthamiana overexpressing GFP; 5dpa: 5 days post Agroinfiltration; a-GFP: GFP antibody; CBB: Coomassie Brilliant Blue staining.

[0013] Figure 3 Figure 8. Effect of TGBp1 on GFP mRNA expression. GFP: GFP mRNA; CP-StHA: plant expression vector pCP-StHA expressing CP-StHA; TGBp1-StHA: plant expression vector pTGBp1-StHA expressing TGBp1-StHA; StHA: plant expression vector p1300-StHA expressing Ster and HA tag only.

[0014] Figure 4 Figure 9. GFP accumulation in N. benthamiana leaves infiltrated with YNs-MeGRXC3 and TGBp1-Flag expression vectors. YNs-MeGRXC3: plant expression vector expressing YNs-MeGRXC3; EV: plant expression vector p1300-Flag expressing Flag tag only; TGBp1-Flag: plant expression vector pTGBp1-Flag expressing TGBp1-Flag; 3dpa: 3 days post Agroinfiltration; a-GFP: GFP antibody; CBB: Coomassie Brilliant Blue staining.

[0015] Figure 5To improve the formation of mRNA degradation pathway processing body of Arabidopsis thaliana for TGBp1. A. Confocal microscopic observation; B. Processing body number statistics. YN-Dcpl: fluorescent double-molecule plant expression vector pYN-Dcpl expressing Arabidopsis thaliana Dcpl; Dcp2-YC: fluorescent double-molecule plant expression vector Dcp2-YC1 expressing Arabidopsis thaliana Dcp2; TGBp1: plant expression vector pTGBp1-StHA expressing TGBp1; EV: empty vector p1300-StHA. DETAILED DESCRIPTION

[0016] The present application will be further described below with reference to the accompanying drawings and specific examples in order to better understand the present application. In the examples, unless specific techniques or conditions are mentioned, the techniques or conditions described in the literature in the art or according to the product manual are used. Unless the manufacturer is mentioned, the reagents or instruments used are all conventional products that can be commercially available.

[0017] 1 Plant material

[0018] 16C Transgenic N. benthamiana (Qu, F., Ren, T., & Morris, T. J. (2003). The coat protein of turnip crinkle virus suppresses posttranscriptional gene silencing at an early initiation step. Journal of virology, 77(1), 511-522.).

[0019] 2 Experimental methods and results

[0020] 2.1 Construction of plant expression vector

[0021] (1) The construction method of empty vector p1300-StHA is as follows:

[0022] Synthetic StHA-XbaI & SacI fragment (see Table 1 for specific sequence) and double enzyme digestion with XbaI and SacI, and connect with the same double enzyme digestion pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154-166) large fragment, the positive clone is named p1300-StHA after correct sequencing identification.

[0023] (2) The construction method of plant expression vector pCP-StHA is as follows:

[0024] AD-CP (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154-166) as a template, and primer CP-1F Xba and CP-1053RBamHI (see Table 2 for specific sequence) to amplify known silencing suppressor TCV CP (Qu, F., Ren, T., & Morris, T. J. (2003). The coat protein of turnip crinkle virus suppresses posttranscriptional gene silencing at an early initiation step. Journal of virology, 77(1), 511-522.). The reaction system is as follows:

[0025]

[0026] The reaction procedure is as follows:

[0027]

[0028] The amplified product was double-digested with XbaI and BamHI and ligated with the large fragment of p1300-StHA that was also double-digested, and the positive clone was named pCP-StHA after being identified as correct by sequencing.

[0029] (3) The construction method of the plant expression vector pTGBp1-StHA is as follows:

[0030] The target fragment TGBp1-XbaI & BamHI (the specific sequence is shown in Table 1) was artificially synthesized by Shanghai Shengong Bioengineering Co., Ltd. with XbaI and BamHI added at both ends. The target fragment was double-digested with XbaI and BamHI and ligated with the large fragment of p1300-StHA that was also double-digested, and the positive clone was named pTGBp1-StHA after being identified as correct by sequencing.

[0031] (4) The construction method of the empty vector p1300-Flag is as follows:

[0032] The target fragment Flag-XbaI & SacI (the specific sequence is shown in Table 1) was artificially synthesized by Shanghai Shengong Bioengineering Co., Ltd. and double-digested with XbaI and SacI and ligated with the large fragment of pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154-166) that was also double-digested, and the positive clone was named p1300-Flag after being identified as correct by sequencing.

[0033] (5) The construction method of the plant expression vector p1300-TGBp1-Flag is as follows:

[0034] The above successfully constructed pTGBp1-StHA was used as the template, and the TGBp1 was amplified with primers TGBp1-1F SpeI and TGBp1-780R KpnI (the specific sequences are shown in Table 2), and the reaction system was as follows:

[0035]

[0036] The reaction procedure is as follows:

[0037]

[0038] The amplified product was double-digested with Spel and Kpnl and ligated with the same double-digested p1300-Flag large fragment. The positive clone was named p1300-TGBpl-Flag after being identified correctly by sequencing.

[0039] (6) The construction method of the plant expression vector YNs-MeGRXC3 is as follows:

[0040] The target fragment MeGRXC3-MluI & SacI (the specific sequence is shown in Table 1) was artificially synthesized by Shanghai Shengong Bioengineering Co., Ltd. and double-digested with Mlu and SacI and ligated with the same double-digested p1300-YN1 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154-166) large fragment. The positive clone was named YNs-MeGRXC3 after being identified correctly by sequencing.

[0041] Table 1 Sequence of target fragment

[0042] Fragment name Sequence (5' - 3') StHA-XbaI & SacI TCTAGA TGGAGCCACCCGCAGTTCGAAAAAGGTGGAGGTTCTGGCGGTGGATCGGGAGGTTCAGCGTGGAGCCACCCGCAGTTCGAGAAAGGTGCTTCTGGTGAAGGTTACCCATACGATGTTCCTGACTATTAA G AGCTC ]]> ​ Flag-BamHI & SacI GGATCCACGCGTATGgactacaaggacgacgatgacaaggattacaaagatgacgacgataaggactataaggacgatgatgataaatagTAAGAGCTC TGBpl-XbaI & BamHI TCTAGA ATGAGAAGAGGTGCCTATACCCCCCGTTCTACTCCATTCTCTCGTGACCGGAGATCGTATAATGCCGGTAAGGGTAGATCATTTCGTTCTTACCGTCGTCGTGGACCTGTTCGTCCATTAGTTCGTCGGAACCTGTTTGGTGATGACCATGCACGTGCATTTACGTATAAGACCGTATCGGAGGATCAATTTGGACCGGATTTTACCATACATAATAATAATTATAAGTCATCGTATATATCTATGCCTGCCAAAACACGTGCCCTTAGCGATAACAGGGTAGGTGATTATATCAAACTTGTAAATATATCATTTACAGGTACAGTGTGTATTAAAAACAGCCAGATGGAATCTGACGGAAGCCCAATGTTGGGCCTGCATGGGCTGTTTACTTGTGTATTGGTCCGGGATAAGACCCCTCGTATATATTCTGCCACTGAGCCTTTGATACCTTTCCCACAGTTGTTTGGGTCCATAAACGCGAGCTATGCGGATTTGTCTATACAAGACCCATATAAGGATCGGTTCACAGTTATCCGTCAGGTGTCTTACCCAGTTAATACGGAGAAGGGTGATCATATGTGTCGTTTCAAAGGCACTCGACGTTTTGTTGGTAGATACCCTATCTGGACTAGTTTTAAAGATGATGGTGGCATTGGAGATTCATCGGGATTATATAGTAATACGTATAAAAATGCCATACTTGTATATTATGTATGGCTCAGCGACGTATCGTCACAATTGGAAATGTATTGTAAATATGTAACTCGATATATTGGT GGATCC ]]> ​ MeGRXC3-MluI & SacI ACGCGT GACGCAGTGACAAGAATGGTTGCAGAGAGACCACTGGTGATCTTCAGCAGGAGCACCTGTGACATGTGCCACTCCATTAAGACACTGATACTTGGATTTGGAGCAAATCCTACAATCTATGAGCTTGATCAAATTCCGAACGGCCAGCAAATTGAAAGAGCATTGCAGCAGCTAGGGTGCCAGAACTTACCAGCAGTATTCATAGGGGGCGAGTGTGTGGGTGGTGACAGGCAAGTCATGAGCTTACTGCTGAAGAACCAGTTAGGCCCATTGCTAAAGAGGGCTGGTGCCATATGGGTCTGGAATGATGGTACCGGATCCTGGAGCCACCCGCAGTTCGAAAAAGGTGGAGGTTCTGGCGGTGGATCGGGAGGTTCAGCGTGGAGCCACCCGCAGTTCGAGAAATAA GAGCTC ]]> ​

[0043] Table 2 Primers used

[0044] Primer name Sequence CP-1F XbaI TCTAGA ATGGAAAATGATCCTAGAGTC]]> ​ CP-1053R BamHI GGATCC CCCGGGAATTCTGAGTGCTTGCCATTTAC]]> ​ TGBpl-1F Spel ACTAGT ATGAGAAGAGGTGCCTATAC]]> ​ TGBpl-780R Kpnl GGTACC ACCAATATATCGAGTTACATA]]> ​ qNbActin-128F AAAGACCAGCTCATCCGTGG qNbActin-256R CCAGCAGCTTCCATTCCGAT qsGFP-306F GGACGACGGCAACTACAAGA qsGFP-519R TTCGATGTTGTGGCGGATCT

[0045] 2.2 Observation of TGBpl silencing inhibition function

[0046] The single-stranded green fluorescent protein expression vector pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154-166) was preserved in our laboratory.

[0047] (1) Recombinant plasmid transformation of Agrobacterium (GV3101) competent cells

[0048] Plant expression vectors pG1300, p1300-StHA, pCP-StHA and pTGBp1-StHA were transformed into Agrobacterium GV3101 competent cells according to the GV3101 Chemically Competent Cell product manual. After transformation, the resuspended bacterial mass was evenly coated on LB plates containing Kan and Rif, and placed in a 28°C constant temperature incubator for 72-90 h. After 2-3 days, 2-3 mm Agrobacterium colonies were selected for PCR identification.

[0049] (2) Infiltration of transgenic 16C Nicotiana benthamiana

[0050] The resuspended bacterial solution of the recombinant vector was mixed and injected into the leaves of transgenic 16C Nicotiana benthamiana, and the operation steps were as follows:

[0051] (a) Use the gun head to pick single colonies identified by colony PCR as positive into 5 ml LB liquid medium containing the corresponding antibiotics, and place in a 28°C 200 r / min constant temperature shaker for overnight culture.

[0052] (b) Centrifuge the bacterial solution at 7000 rmp / min for 15 min, then discard the supernatant.

[0053] (c) Prepare injection buffer: take 2 mL of 1 mol / L MgCl2, 2 mL of 1 mol / L MES and 200 μL of 100 mg / mL AS, and finally dilute to 200 mL with ultrapure water.

[0054] (d) Resuspend the bacterial pellet with 5 mL of injection buffer, shake well and measure the OD600 value of the bacterial solution, and adjust the concentration of the bacterial solution to OD600 = 0.5.

[0055] (e) After dilution, the bacterial solution was placed at room temperature for 2-3 h, and then mixed at a ratio of 1:1 by volume according to the desired combination (see Table 3).

[0056] (f) Transgenic 16C Nicotiana benthamiana in the vigorous growth stage with 5-7 leaves was injected with a 1 mL needle syringe, and the injection was about 2 cm in range. All combinations were injected on the same leaf, and 10 leaves were injected. After injection, the Nicotiana benthamiana was treated in the dark overnight, and then cultured under normal conditions. 2

[0057] (g) On the 5th day after injection, the expression of GFP fluorescence of each combination was observed under blue excitation light (495 nm) using a handheld fluorescent protein observation lamp (LUYOR-3415RG) with LUV-30A yellow glasses, and photographs were taken for record. After taking the photographs, the range of tobacco infection was circled using a marker pen.

[0058] Table 3. Different combinations of Agrobacterium injected into 16C Nicotiana benthamiana

[0059] Group Recombinant plasmid Combination 1 p1300-StHA + pG1300 Combination 2 pCP-StHA + pG1300 Combination 3 pTGBpl-StHA + pG1300

[0060] The results are shown in Figure 1 p1300-StHA co-injected tobacco leaves only showed weak fluorescence. It was preliminarily judged that TGBp1 had silencing suppression function as the known silencing suppressor CP (SEQ ID NO: 5), which could improve the expression of GFP.

[0061] 2.3 Detection of the silencing suppression function of TGBp1

[0062] 2.3.1 Total protein and RNA were extracted from the tobacco leaves of the above different injection combinations on the 5th day, and Western Blot (WB) and RT-qPCR detection were performed, respectively, to verify the fluorescence observation results. The specific methods are as follows:

[0063] (1) Extraction of plant total protein and Western Blot. Refer to the literature (Liu Linyu, Master's Thesis "Cassava mosaic virus silencing suppressor AC4 hijacks UPF1 to promote virus infection".

[0064] The results are shown in Figure 2 ​As shown, the GFP expression was increased by 1.54 and 2.65 times respectively compared with the sample co-infiltrated with empty vector p1300-StHA (StHA) after co-infiltration of pG1300 and pTGBp1-StHA (TGBp1-StHA) or pCP-StHA (CP-StHA). Rubiso Coomassie brilliant blue staining (CBB) showed that the loading amount was basically consistent. The WB detection result further confirmed the fluorescence observation result, indicating that TGBp1 had silencing inhibition function as the known virus silencing inhibitor CP, and could improve the expression of GFP.

[0065] (2) Total RNA extraction of plant leaves and real-time fluorescence quantitative (RT-qPCR) detection of relative expression amount of GFP

[0066] The total RNA of tobacco was extracted according to the instruction of TRNzol Universal total RNA extraction reagent of Tian Gen Company, and then the RNA sample was reversely transcribed by using two-step method according to the instruction of reverse transcription kit product; the obtained cDNA sample was used as a template, qNbActin-128F and qNbActin-256R were used as internal reference primers, and qsGFP-306F and qsGFP-519R were used as GFP detection primers for real-time fluorescence quantitative (qRT-PCR) detection. The results are shown in Figure 3 As shown, the GFP mRNA expression amount co-expressed with TGBp1 or with the known silencing inhibitor CP was significantly improved, indicating that the increase of GFP protein expression amount co-expressed with TGBp1 or the known silencing inhibitor CP was caused by the increase of GFP mRNA expression amount. The results show that TGBp1 has the same silencing inhibition function as the known silencing inhibitor CP.

[0067] 2.3.2. For further verification of the silencing inhibition effect of TGBp1, the plant expression vector with streptomycin tag was co-infiltrated with YNs-MeGRXC3 and empty vector p1300-Flag (EV) or p1300-TGBp1-Flag (TGBp1-Flag) respectively by using the same method of 2.2(2), and the protein was extracted on the third day after injection and detected by Western Blot using Strep and Flag antibodies. The results are shown in Figure 4 The Strep antibody detection result shows that the expression amount of YNs-MeGRXC3 co-infiltrated with p1300-TGBp1-Flag is increased by 4.95 times compared with the sample co-infiltrated with empty vector. Figure 4 The Flag antibody detection result shows that TGBp1 has been expressed, and Coomassie brilliant blue staining shows that the loading amount is basically consistent. The results further show that the expression amount of MeGRXC3 can be significantly improved on the third day after injection.

[0068] 2.4 TGBp1 enhances the formation of processing bodies in Arabidopsis mRNA decay pathway

[0069] 2.4.1 Plant expression vectors YN-Dcp2 and Dcp1-YC (Wu, K., Xie, Q., Liu, X., Fu, Y., Li, S., Yu, X., Li, W., Zhao, P., Ren, Y., Ruan, M., & Zhang, X. (2025). Capsid protein of turnip crinkle virus suppresses antiviral RNA decay by degrading Arabidopsis Dcp1 via ubiquitination pathway. The Plant journal : for cell and molecular biology, 121(5), e70075.) were preserved in our laboratory.

[0070] 2.4.2 To further verify the silencing inhibition effect of TGBp1, we used fluorescence double-molecule complementation experiments to observe the fluorescence particles formed by the restoration of Dcp1 and Dcp2 interaction using confocal microscopy. The specific method is as follows: First, use the method of 2.2.1 (1) for expression vector Agrobacterium transformation; second, refer to the method of 2.2.1 (2) to inject the two combinations of recombinant plasmids in Table 4 into wild-type Nicotiana benthamiana; then take about 1-2 cm 2 The laser confocal microscope (Olympus FV3000) was used to observe the fluorescence of tobacco cells. The excitation light of GFP was 488 nm, and protein extraction and Western blot detection were performed.

[0071] The results are shown in Figure 5 A, the fluorescence particles of processing bodies co-expressed with p1300-TGBp1-Flag were significantly more than those co-injected with empty vector p1300-Flag in tobacco leaves, and Figure 5 B, the processing body statistics showed that the number of processing bodies in tobacco leaves co-injected with empty vector p1300-StHA was significantly reduced compared with pTGBp1-StHA. This result further proves that TGBp1 has silencing inhibition function.

[0072] Table 4 Different combinations of Agrobacterium injection of wild-type Nicotiana benthamiana

[0073] Group Recombinant plasmid Combination 1 pYN-Dcp2 + pDcpl-YC + p1300-Flag Combination 2 pYN-Dcp2 + pDcpl-YC + p1300-TGBpl-Flag

[0074] RNA silencing refers to a phenomenon found in eukaryotes that is mediated by small RNA (21-30 nt) to cause target gene expression to be inhibited in a sequence-specific manner. In plants, in addition to being able to regulate growth and development, RNA silencing also plays a very important role in resisting the invasion of viruses. Because viruses are obligate parasites, they have developed viral silencing suppressors during long-term coevolution with plants to interfere with and destroy different links in the RNA silencing pathway. When cultivating transgenic virus-resistant crops, a key gene sequence of a viral silencing suppressor can be transferred into plants, so that the plants can continuously produce siRNA against the virus in the body, so that the plants can start the RNAi mechanism in advance to clear the virus once the real virus invades. The host proteins that interact with the viral silencing suppressor in the plant can also be modified by gene editing or transgenic technology to enhance the affinity of the host proteins to the viral silencing suppressor. The host proteins can more efficiently "grasp" more types of viral silencing suppressors, so that even if the virus mutates, its suppressor can be easily identified, thereby activating the anti-disease response in a broad spectrum. Or change the function of the host protein, optimize the combination of the part responsible for "anti-disease signal transduction" and the part responsible for "binding suppressor" in the host protein, and create a new anti-disease gene. Once the viral suppressor enters the cell, it is like triggering an "alarm switch" to immediately trigger a strong defense response. The present application finds that TGBp1 has a silencing suppression function, can inhibit the degradation of the mRNA of GFP, and thus increase the expression amount of GFP protein; it also finds that TGBp1 can inhibit the silencing of the target gene MeGRXC3 and increase its expression function; in addition, it also finds that TGBp1 can increase the number of mRNA degradation pathway processing body (Dcp1 protein and Dcp2 protein interact to form a complex) particles. Therefore, the present application not only lays a foundation for elucidating the function of TGBp1 but also provides a new target gene for cassava disease-resistant breeding.

[0075] The specific embodiments of the present application are described in detail above, but they are only examples, and the present application is not limited to the specific embodiments described above. Any equivalent modifications and alternatives to the present application made by those skilled in the art are also within the scope of the present application. Therefore, equivalent transformations and modifications made without departing from the spirit and scope of the present application should be included in the scope of the present application.

Claims

1. The application of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector, host bacterium, or expression cassette containing the coding region of the TGBp1 gene, in inhibiting GFP silencing and / or increasing GFP expression in 16C transgenic Nicotiana benthamiana, wherein, The nucleotide sequence of the TGBp1 gene is shown in SEQ ID NO:

1.

2. The application of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector, host bacterium, or expression cassette containing the coding region of the TGBp1 gene, in inhibiting the degradation of GFP in 16C transgenic Nicotiana spp., increasing its expression, and / or increasing the accumulation of GFP protein levels in 16C transgenic Nicotiana spp., wherein, The nucleotide sequence of the TGBp1 gene is shown in SEQ ID NO:1.

Citation Information

Patent Citations

  • Application of cassava common mosaic virus TGBp1 in down-regulation of MeGRXC3

    CN120193015A