Application of sunflower receptor-like kinase HaFER1 gene in anti-sclerotinia stem cell disease
By constructing an overexpression vector of the HaFER1 gene in sunflower and using Agrobacterium infection, the resistance of sunflower to sclerotinia rot was enhanced, solving the problem of insufficient resistance in existing varieties and improving the plant's disease resistance.
Patent Information
- Application Number
- CN202511117373.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-11
- Publication Date
- 2026-03-06
- Estimated Expiration
- 2045-08-11
AI Technical Summary
Existing sunflower varieties have weak resistance to sclerotinia stem rot and lack effective control measures. There is an urgent need to discover key disease-resistant genes to enhance plant resistance to sclerotinia stem rot.
By constructing an overexpression vector for the sunflower receptor-like kinase HaFER1 gene and using Agrobacterium infection for transient overexpression, the plant's resistance to sclerotinia rot was improved.
It enhanced the plant's resistance to sclerotinia stem rot, significantly reduced the area of lesions, and improved the plant's disease resistance.
Smart Images

Figure CN120944962B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, and in particular relates to the application of a sunflower receptor-like kinase HaFER1 gene in resistance to sclerotinia stem rot. Background Technology
[0002] Sunflower is an important oilseed and cash crop in my country, second only to rapeseed and soybean in yield. Sunflowers possess strong drought resistance and tolerance to poor soil conditions. The healthy development of the sunflower industry plays an irreplaceable role in conserving water resources, protecting the ecological environment, ensuring an effective supply of agricultural products, and maintaining the sustainable development of the local economy and society. Sclerotinia stem rot, caused by *Sclerotinia sclerotiorum*, is a widespread and highly damaging sunflower disease. However, the control effects of sclerotinia stem rot are limited, and existing sunflower varieties show weak resistance. Therefore, it is urgent to discover key disease-resistant genes in sunflowers and elucidate the molecular mechanisms of sunflower disease resistance, laying a theoretical foundation and providing guidance for sunflower disease-resistant breeding.
[0003] Receptor-like kinases (RLKs) are crucial pathways for plants to sense pathogen infection and transduce signals into the cell, playing an irreplaceable role in plant disease resistance. FERONIA (FER), a member of the cysteine-rich RLK subfamily, has been shown to participate in regulating plant immunity in important crops such as maize and rice. In Arabidopsis thaliana, FERONIA (FER) is a typical receptor-like kinase (RLK), belonging to the CrRLK1L family (a cysteine-rich RLK subfamily). It plays multiple key functions in plant growth and development, environmental responses, and cell signal transduction. Under biotic and abiotic stresses, FER acts as an immune regulatory hub, triggering physical immunoassay (PTI) through a negative regulatory mode. It interacts with bacterial flagellin (flg22), influencing the activation of immune-related MAPK cascades. Under salt stress, FER regulates plasma membrane H+. + -ATPase activity maintains ion homeostasis. In drought response, FER affects stomatal opening and closing and abscisic acid (ABA) signaling. The rice FER gene OsFER1 / 2 and the tomato FER gene SIFER both negatively regulate plant immunity, while the cotton FER gene GhFER regulates lignin synthesis to enhance resistance to Verticillium dahliae. However, to date, FER genes in sunflower have not been reported, and their function in plant immunity remains unknown. Summary of the Invention
[0004] In view of this, the purpose of the present invention is to provide an application of the sunflower receptor-like kinase HaFER1 gene in the treatment of sclerotinia stem rot.
[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0006] This invention provides the application of the sunflower receptor-like kinase HaFER1 gene in resistance to sclerotinia stem rot, and its overexpression enhances the plant's resistance to sclerotinia stem rot.
[0007] Preferably, the method for overexpressing the sunflower receptor-like kinase HaFER1 gene includes the following steps:
[0008] An overexpression vector for the sunflower receptor-like kinase HaFER1 gene was constructed, and the gene was transiently overexpressed in sunflower by injecting it into plant leaves using the Agrobacterium infection method.
[0009] Preferably, the overexpression vector of the sunflower receptor-like kinase HaFER1 gene is pCAMBIA1300-HaFER1-GFP, which uses pCAMBIA1300-GFP as the original vector and clones the sunflower receptor-like kinase HaFER1 gene between the Bgl II and Xba I restriction sites of pCAMBIA1300-GFP.
[0010] Preferably, the Agrobacterium is Agrobacterium GV3101.
[0011] Preferably, the plant includes Nicotiana benthamiana.
[0012] Compared with the prior art, the present invention has the following beneficial effects:
[0013] This invention provides an overexpression vector for the sunflower receptor-like kinase HaFER1 gene. After injecting the overexpression vector into plants using the Agrobacterium-mediated transformation method, it is applied to regulate plant resistance to Sclerotinia sclerotinia disease. This invention enhances plant resistance to Sclerotinia sclerotinia disease by overexpressing the sunflower receptor-like kinase HaFER1 gene. Attached Figure Description
[0014] Figure 1 This is the result of amino acid sequence homology comparison between HaFER1 and AtFER;
[0015] Figure 2 This is a schematic diagram of the HaFER1 protein structure;
[0016] Figure 3 This is a map of the pCAMBIA1300-GFP vector plasmid;
[0017] Figure 4 Heterologous expression of HaFER1 enhances plant resistance to sclerotinia rot (where A is a photograph of inoculated bacteria after transient expression, and B is the statistical result of lesion area in figure A). Detailed Implementation
[0018] This invention provides the application of the sunflower receptor-like kinase HaFER1 gene in resistance to sclerotinia stem rot, and its overexpression enhances the plant's resistance to sclerotinia stem rot.
[0019] In this invention, the method for overexpressing the sunflower receptor-like kinase HaFER1 gene includes the following steps: constructing an overexpression vector for the sunflower receptor-like kinase HaFER1 gene; injecting and infecting plant leaves using Agrobacterium infection to achieve transient overexpression of the sunflower receptor-like kinase HaFER1 gene; the overexpression vector for the sunflower receptor-like kinase HaFER1 gene is pCAMBIA1300-HaFER1-GFP, which uses pCAMBIA1300-GFP as the original vector and clones the sunflower receptor-like kinase HaFER1 gene between the Bgl II and Xba I restriction sites of pCAMBIA1300-GFP; the Agrobacterium is Agrobacterium GV3101; and the plant includes Nicotiana benthamiana.
[0020] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0021] Example 1
[0022] 1. Sequence homology analysis between HaFER1 and its homologous protein FER
[0023] A search for homologous sequences in sunflower using the amino acid sequence of the Arabidopsis receptor kinase FER revealed that the protein numbered XP_021997695.1 (corresponding gene number: LOC110894774) is a homolog of FER. Figure 1 In this invention, it is named HaFER1. Through prediction of the conserved functional domains of HaFER1, it was found that the structural functional domains are highly conserved, consisting of a signal peptide sequence (SP), a maslectin-like domain, a transmembrane domain (TM), and a serine / threonine kinase domain. Figure 2 ).
[0024] 2. Construction and transformation of HaFER1 plant expression vector
[0025] Obtaining the full length of the HaFER1 gene: The target gene fragment was amplified using high-fidelity DNA polymerase. Primers F: CAAGCTGACTCTAGCAGATCTATGAGAACGCCGGAGCATTTTA (as shown in SEQ ID NO: 1) and primer R: TCTTTGCCCATGGCTCTAGAACGTCCATTCGGGTTCATAATC (as shown in SEQ ID NO: 2) were designed using the HaFER1 CDS sequence as a template. Amplification was then performed using sunflower DNA as a template. The size of the target gene band in the PCR product was detected by agarose gel electrophoresis. The target band was purified using the DP214 kit (TIAN GEN) (purchased from Shaanxi Zhongke Yutong Biotechnology Co., Ltd.), following the manufacturer's instructions.
[0026] Ligation and transformation: First, the vector plasmid pCAMBIA1300-GFP (see Zhang Y, Liu X, Yiji Shi Lina Lang Shunxian Tao Qi Zhang Mengfan Qin Kai Wang Yu Xu Lin Zheng Hanming Cao Han Wang Yunlin Zhu Jia Song Keqi Li Aixia Xu Zhen Huang. The B-box transcription factor BnBBX22.A07 enhances salt stress tolerance by indirectly activating BnWRKY33.C03[J]. Plant, Cell & Environment, 2024. Plasmid map as shown) Figure 3 (As shown) The HaFER1 gene was double-digested with restriction endonucleases BglII and XbaI. The digestion products were then detected by electrophoresis, and the linearized vector was purified using the DNA kit described above. Finally, the purified HaFER1 gene sequence and the linearized vector were ligated using homologous recombinase, and the ligation product was transformed into competent E. coli cells. After overnight culture at 37°C, colony PCR was performed for verification. Positive clones with the same band size as the target gene were selected for sequencing. After the alignment results were correct, the plasmid pCAMBIA1300-HaFER1-GFP was extracted and transformed into Agrobacterium GV3101 using the heat shock method.
[0027] 3. Agrobacterium-mediated transient expression
[0028] (1) Take 50 μl of the preserved glycerol bacteria and activate it in 3 mL of LB liquid medium containing the corresponding antibiotic. Incubate at 28℃ and 200 rpm for 20-24 h until the bacterial solution turns orange-yellow.
[0029] (2) Centrifuge at 4000g for 5 minutes, discard the supernatant, and collect the bacterial cells;
[0030] (3) Gently resuspend the bacterial cells in 2 mL MES (MgCl2·6H2O, 2.033 g / L; MES, 2.132 g / L; pH 5.6) resuspension solution and wash away the residual culture medium;
[0031] (4) Centrifuge at 4000g for 5 minutes, discard the supernatant, and collect the bacterial cells;
[0032] (5) Resuspend the bacterial cells in 2 mL LMES resuspension solution, then take 200 μl of the original bacterial solution, dilute it 10 times, and test the concentration;
[0033] (6) Dilute the bacterial solution to the required injection concentration (generally, the injection concentration is OD600 = 0.4). Select the two most flattened leaves of 4-6 week old Tobacco Benedict seedlings. Use a 1mL syringe without needle to draw up the bacterial solution and inject it from the back of the leaf. Two days later, inoculate with Sclerotinia sclerotiorum mycelium (cultured on PDA solid medium for 3 days). Observe and count the size of the lesions after 24 hours.
[0034] Experimental results: such as Figure 4 As shown in the figure, compared with the control group GFP, the lesions on one side overexpressing HaFER1 were smaller, indicating that overexpression of HaFER1 can inhibit the infection of Sclerotinia sclerotiorum and improve plant disease resistance.
[0035] As can be seen from the above embodiments, the present invention enhances the plant's resistance to sclerotinia stem rot by overexpressing the sunflower receptor-like kinase HaFER1 gene.
[0036] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. Use of the sunflower receptor-like kinase HaFER1 gene in resistance to sclerotinia disease caused by Sclerotinia sclerotiorum, characterized in that, The application discloses a method for improving the resistance of plants to sclerotinia stem rot by overexpressing a sunflower receptor-like kinase HaFER1 gene, wherein the sunflower receptor-like kinase HaFER1 gene has a gene number of LOC110894774, and the plants are Nicotiana benthamiana or sunflower.
2. Use according to claim 1, characterized in that, The method for overexpressing the sunflower receptor-like kinase HaFER1 gene comprises the following steps: The method comprises the following steps: constructing an overexpression vector of the sunflower receptor-like kinase HaFER1 gene, and performing injection infection on plant leaves by using an agrobacterium infection method to realize transient overexpression of the sunflower receptor-like kinase HaFER1 gene in the plants.
3. Use according to claim 2, characterized in that, The overexpression vector of the sunflower receptor-like kinase HaFER1 gene is pCAMBIA1300-HaFER1-GFP, and the pCAMBIA1300-HaFER1-GFP takes pCAMBIA1300-GFP as an original vector, and the sunflower receptor-like kinase HaFER1 gene is cloned between enzyme cutting sites of Bgl II and Xba I of the pCAMBIA1300-GFP.
4. Use according to claim 2, characterized in that, The agrobacterium is agrobacterium GV3101.
Citation Information
Patent Citations
Disease-resistant function application of rape gene BnFER1
CN114317484A
Sunflower disease resistance genes
US6608240B1