Biosensor for detecting staphylococcus aureus by regulating G-quadruplex AuNRs etching

By constructing a CRISPR/Cas12a biosensor system, combined with specific nucleic acid elements and gold nanorods, a highly efficient, sensitive, and specific detection of Staphylococcus aureus was achieved, solving the problems of low sensitivity, slow speed, and insufficient specificity of existing detection methods, and making it suitable for rapid detection of food samples.

CN120945016APending Publication Date: 2025-11-14UNIV OF JINAN
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511050626.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-29
Publication Date
2025-11-14

AI Technical Summary

Technical Problem

Existing methods for detecting Staphylococcus aureus suffer from low sensitivity, slow speed, insufficient specificity, and complex operation, failing to meet the needs of on-site testing.

Method used

By employing the CRISPR/Cas12a biosensor system combined with isothermal nucleic acid amplification technology, a colorimetric sensor was constructed by designing specific nucleic acid elements such as the arched probe Apt-T, the NL chain of the nucleic acid lock, gold nanorods modified with G4 chains, crRNA, Cas12a protein, Mg2+, heme, and K+. The sensor utilizes the non-targeted cleavage activity of CRISPR/Cas12a and the formation of G-quadruplexes to achieve efficient and sensitive detection of Staphylococcus aureus.

Benefits of technology

It enables rapid, sensitive, and specific detection of Staphylococcus aureus, with a detection limit of 4.26 CFU/mL and a detection range of 10-105 CFU/mL. It reduces non-specific background, is suitable for the detection of real food samples, and has good recovery and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120945016A_ABST
    Figure CN120945016A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of medical microbiological detection, and provides a biosensor for detecting staphylococcus aureus by regulating and controlling G-quadruplex AuNRs etching, the biosensor comprises an arch probe Apt-T, a nucleic acid locked NL chain, a G4 chain modified gold nanorod, crRNA, Cas12a protein, Mg < 2 + >, heme and K < + >; the nucleic acid lock NL chain is of a hairpin structure; the arched probe Apt-T is formed by hybridizing Apt and a T chain; the G4 chain is modified on the surface of the gold nanorod through sulfydryl; the nucleotide sequences of the Apt, the T chain, the nucleic acid lock NL chain, the G4 chain and the crRNA are respectively as shown in SEQ ID NO: 1-5. The sensor has good detection efficiency and specificity, can be used for detection of real food samples, has good recovery rate and accuracy, and provides a novel practical detection method for detection of food-borne pathogenic bacteria and other trace molecules.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of medical microbiology detection technology, specifically relating to a fluorescent biosensor for detecting Staphylococcus aureus. Background Technology

[0002] The information disclosed in this background section is intended to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Foodborne pathogens are a common and significant cause of illness and even death. Staphylococcus aureus, Escherichia coli, Salmonella typhimurium, Listeria monocytogenes, and Vibrio parahaemolyticus are among the most common foodborne pathogens, and their toxins can adversely affect human health. Staphylococcus aureus, a widely distributed Gram-positive bacterium, produces heat-resistant toxins. Even trace amounts of this bacterium in food can cause sepsis, osteomyelitis, pneumonia, toxic shock syndrome, and endocarditis. Infants and the elderly are particularly at high risk of infection, and the harm is extremely significant. Although many methods for detecting Staphylococcus aureus have been developed, existing methods still have certain drawbacks, thus limiting their practical application. For example, conventional methods such as plate counting and PCR are time-consuming and cannot meet the needs of on-site testing. Therefore, it is crucial to develop a sensitive, rapid, and highly specific method for detecting Staphylococcus aureus in food.

[0004] Due to their unique structure, simple preparation, good stability, high affinity, and high cleavage efficiency, DNAzymes have been widely used in the design of nanomachines and biosensor platforms. Although DNAzyme-based nanobiosensors are mostly used for detection such as live cell imaging, a well-designed DNAzyme structure can effectively assist in the detection of foodborne pathogens.

[0005] In recent years, the CRISPR / Cas system, as an adaptive immune system for archaea and bacteria, has attracted widespread attention in the fields of genome editing and nucleic acid-related detection. Among the Cas protein family, Cas12a (Cpf1) has garnered significant interest due to its non-targeted trans-cleavage activity. Furthermore, the combination of CRISPR / Cas technology and nucleic acid amplification technology has been widely applied in recent years. Therefore, considering the advantages of combining CRISPR / Cas12a with isothermal nucleic acid amplification technology in achieving efficient and sensitive detection of pathogenic bacteria, constructing a CRISPR / Cas12a biosensor system is of significance for the detection of Staphylococcus aureus. Summary of the Invention

[0006] To address the problems of low sensitivity, slow speed, insufficient specificity, and complex operation in Staphylococcus aureus detection, this invention proposes a sensitive and efficient colorimetric biosensor for Staphylococcus aureus detection.

[0007] To achieve the above objectives, the present invention adopts the following technical solution.

[0008] A colorimetric sensor for detecting Staphylococcus aureus, comprising: Arched probe Apt-T, NL chain of nucleic acid lock, gold nanorods modified with G4 chain, crRNA, Cas12a protein, Mg 2+ Heme and K + ; The nucleic acid lock NL chain has a hairpin structure; the arched probe Apt-T is formed by hybridization of Apt and T chains; the G4 chain is modified on the surface of gold nanorods with thiol groups; The nucleotide sequences of the Apt, T strand, NL strand, G4 strand, and crRNA are shown in SEQ ID NO:1-5, respectively; and the 17th position of the NL strand is a ribonucleotide; the 5' end of the G4 strand is modified with a thiol group.

[0009] The preparation of the arched probe Apt-T includes the following steps: thermally denaturing the Apt and T chains in solution and then naturally cooling them to room temperature.

[0010] The preparation of the nucleic acid lock NL chain includes the following steps: the Apt and T chains are obtained by thermal denaturation in solution and cooling on ice.

[0011] The method for preparing gold nanorods modified with G4 chains includes the following steps: mixing G4 chains and gold nanorods (AuNRs) in a solution at a molar ratio of 80:1 and incubating at room temperature to obtain an incubation solution; gradually increasing the NaCl concentration in the incubation solution, allowing it to stand, centrifuging at 6000 rpm and resuspending, repeating twice to obtain a precipitate, which is the gold nanorods modified with G4 chains.

[0012] Preferably, the method for preparing AuNRs includes the following steps: (1) Mix HAuCl4 solution with CTAB solution, and then add ice-cold NaBH4 solution while stirring vigorously. Incubate in a warm water bath at 25°C for 1 hour to obtain seed liquid. (2) Mix 100 mL of 0.2 M CTAB solution with 100 mL of 0.01 M HAuCl4 solution, stir gently, and then add 6 mL of 0.004 M AgNO3 to obtain the growth solution; (3) Add 19.4 mg of ascorbic acid to 1.4 mL of growth medium, then add 240 μL of seed liquid, and incubate at 28 °C for 8 h; after separation and purification, short rod-shaped gold nanoparticles AuNRs are obtained.

[0013] In the above steps, the molar ratio of HAuCl4, CTAB and NaBH4 is 2.5:1000:6; the molar ratio of HAuCl4, CTAB and AgNO3 is 50:1000:1.2; and the volume ratio of seed solution to growth solution is 6:35.

[0014] A kit comprising the aforementioned colorimetric sensor.

[0015] A method for detecting Staphylococcus aureus includes the following steps: The colorimetric sensor, hydrogen peroxide, and either the test sample or a blank sample are mixed and incubated. Then, TMB is added to initiate the reaction. After terminating the reaction, the wavelength change (Δλ) of the absorption peak in the test sample relative to the blank sample is measured. A blue shift of the maximum absorption peak indicates the presence of Staphylococcus aureus. The concentration of Staphylococcus aureus can be calculated based on the change in the wavelength of the maximum absorption peak.

[0016] The detection principle of this invention is as follows: Figure 1 As shown, the sequences of each nucleic acid element are as follows: Apt: CCCCCCAGTCCGTCCTCCCAGCCTCACACC; T: GGTGTGAGGCTGATTTGACGGACTGGGGGG; NL: CCCCCCAGTCCGTTGT / rA / GGCCTGTTTTTTGC TCCGAGCCGGTCGA AACAATCAGCCTCACACC; G4: SH-polyT (10)-TGGGTAGGGCGGGTGGGTTTACAAGGAACGCCCTAC; crRNA: UAAUUUCUACUAAGUGUAGAUUUACAACGGACUGGGGGG; NL contains ribonucleotides, and the bolded part is the active site of the DNAzyme.

[0017] In the above nucleic acid elements, the Apt and T chains form an arched probe Apt-T through base complementarity; The NL chain contains a ribonucleotide site and a DNAzyme sequence, and the sequence contains complementary parts that can form a hairpin structure. The sequence also contains a part complementary to the T chain. The G4 chain can be modified with thiol groups at one end to modify the surface of gold nanorods, and it is also rich in G to form G-quadruplexes.

[0018] The above structure can undergo the following reaction process A in the presence of the target substance: The Apt in the arched probe Apt-T specifically binds to Staphylococcus aureus, thereby releasing the T chain; The released T chain hybridizes with the NL chain, undergoing a conformational change and the hairpin is opened in Mg. 2+ In its presence, the DNAzyme activity of the NL strand is activated, which cleaves the ribonucleotide site (autocleavage) and releases the S strand (SEQ ID NO:6, CCCCCCAGTCCGTTGT). The S strand activates CRISPR / Cas12a, which, guided by crRNA, cleaves the G4 strand, resulting in the loss of a portion of the sequence that forms the G-quadruplex, even in the presence of heme and K. + Under these conditions, peroxidase-like activity cannot be formed. After adding TMB and H2O2, due to the lack of catalytic action of G-quadruplex, ·OH cannot be formed, AuNRs cannot be etched accordingly, and the relevant changes in the position of the ultraviolet absorption peak cannot occur.

[0019] In the presence of the target substance, the above structure can undergo the following reaction process B: the G4 chain modified on AuNRs reacts with heme and K... + Under the combined action of these factors, a corresponding spatial structure (G-quadruplex) is formed, which promotes the function of peroxidase-like enzymes, catalyzes the transformation of TMB into oxTMB to etch and change the morphology of AuNRs, and induces a blue shift in the absorption peak position.

[0020] The present invention has the following advantages: The biosensor provided by this invention has a detection limit of 4.26 cfu / mL for Staphylococcus aureus and a detection range of 10-10. 5The cfu / mL concentration is superior to most existing methods. Furthermore, compared to existing detection methods, this method effectively reduces non-specific background. The sensor coupled with a CRISPR / Cas12a system can effectively improve the sensor's detection efficiency and specificity. Moreover, this sensor can be used for the detection of real food samples, exhibiting good recovery and accuracy. Therefore, the biosensor constructed in this invention can provide a new and practical detection method for foodborne pathogens and other trace molecules. Attached Figure Description

[0021] Figure 1 This is a schematic diagram illustrating the principle of the present invention; Figure 2 This is a diagram for verifying the feasibility of the sensor. Figure 3 This is an optimized diagram of the reaction conditions for the colorimetric sensor. Figure 4 To determine the analytical performance of the colorimetric sensor. Detailed Implementation

[0022] The present invention will be further described below with reference to the embodiments and accompanying drawings, but the present invention is not limited to the following embodiments.

[0023] Example 1: Construction of Biosensors (1) Preparation of arched probe Equal volumes of 10 μM Apt probe and 10 μM T chain were co-incubated in NEBuffer 2.1 reaction buffer solution at 95 °C for 5 min, and then naturally cooled to room temperature to form an Apt-T complementary arched probe.

[0024] (2) Preparation of nucleic acid lock NL The 10 μM NL chain was incubated in NEBuffer 2.1 reaction buffer solution in a 95°C water bath for 5 min, and then quickly placed in an ice-water bath for 40 min.

[0025] (3) Gold nanorods modified with G4 chains (G4-AuNRs) Mix 5 mL of HAuCl4 (0.0005 M) with 5 mL of CTAB solution (0.2 M), and then add 0.6 mL of ice-cold NaBH4 (0.01 M) while stirring vigorously. Incubate in a warm water bath at 25 °C for 1 h to obtain the seed culture. Mix 100 mL of 0.2 M CTAB solution with 100 mL of 0.01 M HAuCl4 solution, stir gently, and then add 6 mL of 0.004 M AgNO3 to obtain the growth solution. When 19.4 mg of ascorbic acid was added to 1.4 mL of growth medium, the color of the solution rapidly changed from dark yellow to colorless. Add 240 μL of seed culture to the growth medium and incubate at 28 °C for 8 h; then centrifuge at 8500 rpm for 10 min, discard the supernatant, and obtain short rod-shaped gold nanoparticles AuNRs; Add 10 μL of G4 chain (10 μM) to 1 mL of AuNRs (1.25 nM) solution and incubate at room temperature for more than 6 hours; Over 20 h, 10 µL of NaCl (5 M) was slowly added in 10 equal portions to the reaction solution of G4 chain and AuNRs, and then allowed to stand at room temperature for 24 h. Then, the solution was centrifuged at 6000 rpm, resuspended, and washed again by centrifugation for a total of 3 times, 20 min each time, to purify G4-AuNRs. After centrifugation, the precipitate was resuspended in 1×TBE solution.

[0026] Example 2: Sensor Feasibility 1. Bacterial Sample Preparation Staphylococcus aureus was cultured in LB medium (12 g / L tryptone, 7 g / L sodium chloride, 6 g / L yeast extract) at 37 °C for 12 h in a shaker. The culture medium was then centrifuged to obtain a bacterial precipitate, which was then added to PBS and centrifuged again to obtain the precipitate. The precipitate was then resuspended in PBS, and the bacterial concentration was determined by plate counting.

[0027] 2. Detection of Staphylococcus aureus 3 μL of Staphylococcus aureus (1×10⁻⁶) was added. 5 CFU / mL, curve a) or PBS (curve b) was added to 27 μL of a mixed solution consisting of Apt-T arch probe (3 μL, 10 μM), G4-AuNRs solution (3 μL), CRISPR / Cas12a (3 μL, 2 μM), crRNA (3 μL, 2 μM), NEBuffer 2.1 buffer (3 μL), KCl (3 μL, 200 mM), Hemin (3 μL, 100 μM), MgCl2 (3 μL, 100 mM), and H2O2 (3 μL, 40 mM). Finally, 1 μL of ribonuclease inhibitor was added. After thorough mixing, the mixture was incubated in a metal bath at 37 °C for 90 min. Subsequently, TMB was added, and the reaction was stopped by adding H2SO4 (10 μL, 1 M) after reacting at room temperature for 30 min. The color changes of the corresponding solutions were observed, and quantitative determination was performed using a UV-Vis spectrophotometer. To verify the specificity of the method, three additional experimental groups were set up: no CRISPR / Cas12a (curve c), no NL (curve d), and non-target Salmonella (curve e).

[0028] The results are as follows Figure 2As shown, the absence of any step in the component or the presence of a non-target substance causes a blue shift of the maximum absorption peak, indicating that the formation of G-quadruplexes and the etching of AuNRs cannot be suppressed. This demonstrates that this detection strategy can be used for the specific detection of Staphylococcus aureus.

[0029] Example 3: Optimization of Sensor Response Conditions 1. Effect of reaction time 3 μL of Staphylococcus aureus (1×10⁻⁶) was added. 5 Add either CFU / mL or PBS solution to 27 μL of a mixed solution consisting of Apt-T arch probe (3 μL, 10 μM), G4-AuNRs solution (3 μL), CRISPR / Cas12a (3 μL, 2 μM), crRNA (3 μL, 2 μM), NEBuffer 2.1 buffer (3 μL), KCl (3 μL, 200 mM), Hemin (3 μL, 100 μM), MgCl2 (3 μL, 100 mM), and H2O2 (3 μL, 40 mM). Finally, add 1 μL of ribonuclease inhibitor. After thorough mixing, incubate at 37°C in a metal bath for 0, 15, 30, 45, 60, 75, and 90 min. Subsequently, add reagent TMB, react at room temperature for 30 min, and then add H2SO4 (10 μL, 1 M) to terminate the reaction. Observe the color change of the corresponding solution, measure it using a UV-Vis spectrophotometer, and calculate the change in the maximum absorption peak compared to the PBS solution.

[0030] The detection efficiency of the sensor can be reflected by the reaction time, as shown in the results. Figure 3 As shown in Figure A, the blue shift of the maximum absorption peak is proportional to the reaction time, reaching its maximum value at 60 min. However, the peak value will no longer change significantly with increasing time.

[0031] 2. Effect of reaction temperature 3 μL of Staphylococcus aureus (1×10⁻⁶) was added. 5Add either CFU / mL or PBS solution to 27 μL of a mixed solution consisting of Apt-T arched probe (3 μL, 10 μM), G4-AuNRs solution (3 μL), CRISPR / Cas12a (3 μL, 2 μM), crRNA (3 μL, 2 μM), NEBuffer 2.1 buffer (3 μL), KCl (3 μL, 200 mM), Hemin (3 μL, 100 μM), MgCl2 (3 μL, 100 mM), and H2O2 (3 μL, 40 mM). Finally, add 1 μL of ribonuclease inhibitor. After thorough mixing, incubate in a metal bath at 25, 28, 31, 37, and 43 °C for 60 min. Subsequently, add reagent TMB, react at room temperature for 30 min, and then add H2SO4 (10 μL, 1 M) to terminate the reaction. Observe the color changes of the corresponding solutions using a UV-Vis spectrophotometer and calculate the change in the maximum absorption peak compared to the PBS solution.

[0032] The results are as follows Figure 3 As shown in Figure B, ∆λ gradually increases with increasing temperature, reaching its maximum value at 37℃, indicating that the cutting efficiency of Cas12a is at its strongest. ∆λ decreases as the temperature continues to rise, suggesting that the cutting efficiency of Cas12a is highest at 37℃.

[0033] 3. Effect of Hemin concentration 3 μL of Staphylococcus aureus (1×10⁻⁶) was added. 5 Add either CFU / mL or PBS solution to 27 μL of a mixed solution consisting of Apt-T arched probe (3 μL, 10 μM), G4-AuNRs solution (3 μL), CRISPR / Cas12a (3 μL, 2 μM), crRNA (3 μL, 2 μM), NEBuffer 2.1 buffer (3 μL), KCl (3 μL, 200 mM), Hemin (3 μL, 0, 50, 100, 150 μM), MgCl2 (3 μL, 100 mM), and H2O2 (3 μL, 40 mM). Finally, add 1 μL of ribonuclease inhibitor. After thorough mixing, incubate at 37°C in a metal bath for 60 min. Subsequently, add reagent TMB, react at room temperature for 30 min, and then add H2SO4 (10 μL, 1 M) to terminate the reaction. Observe the color changes of the corresponding solutions and measure them using a UV-Vis spectrophotometer, calculating the change in the maximum absorption peak compared to the PBS solution.

[0034] Hemin can assist in the formation of G-quadruplexes with catalase-like activity by facilitating G-rich sequences, and its concentration has a significant impact on the subsequent catalytic TMB reaction, as shown in the results. Figure 3As shown in Figure C, ∆λ reaches its maximum value when the final Hemin concentration reaches 100 μM. Therefore, a Hemin concentration of 100 μM is selected as the optimal concentration.

[0035] 4. Effect of H2O2 concentration 3 μL of Staphylococcus aureus (1×10⁻⁶) was added. 5 Add either CFU / mL or PBS solution to 27 μL of a mixed solution consisting of Apt-T arched probe (3 μL, 10 μM), G4-AuNRs solution (3 μL), CRISPR / Cas12a (3 μL, 2 μM), crRNA (3 μL, 2 μM), NEBuffer 2.1 buffer (3 μL), KCl (3 μL, 200 mM), Hemin (3 μL, 100 μM), MgCl2 (3 μL, 100 mM), and H2O2 (3 μL, 10, 20, 30, 40, 50 mM). Finally, add 1 μL of ribonuclease inhibitor. After thorough mixing, incubate at 37°C in a metal bath for 60 min. Subsequently, add reagent TMB, react at room temperature for 30 min, and then add H2SO4 (10 μL, 1 M) to terminate the reaction. Observe the color changes of the corresponding solutions and measure them using a UV-Vis spectrophotometer, calculating the change in the maximum absorption peak compared to the PBS solution.

[0036] H2O2 plays a crucial role in the etching process that catalyzes the TMB reaction to form oxTMB and AuNRs, as shown in the results. Figure 3 As shown in Figure D, the maximum absorption peak gradually blue-shifts with increasing H2O2 concentration, and ∆λ reaches its maximum value at 40 μM.

[0037] Example 4 Sensor Analysis Performance Evaluation 3 μL of Staphylococcus aureus (10⁻⁵ × 10⁻⁵) was added. 4 Add either CFU / mL or PBS solution to 27 μL of a mixed solution consisting of Apt-T arch probe (3 μL, 10 μM), G4-AuNRs solution (3 μL), CRISPR / Cas12a (3 μL, 2 μM), crRNA (3 μL, 2 μM), NEBuffer 2.1 buffer (3 μL), KCl (3 μL, 200 mM), Hemin (3 μL, 100 μM), MgCl2 (3 μL, 100 mM), and H2O2 (3 μL, 40 mM). Finally, add 1 μL of ribonuclease inhibitor. After thorough mixing, incubate at 37°C in a metal bath for 60 min. Subsequently, add reagent TMB, react at room temperature for 30 min, and then add H2SO4 (10 μL, 1 M) to terminate the reaction. Observe the color changes of the corresponding solutions and measure them using a UV-Vis spectrophotometer, calculating the change in the maximum absorption peak compared to the PBS solution.

[0038] Quantitative detection results of Staphylococcus aureus are as follows Figure 4 As shown in A and 4B, as the concentration of Staphylococcus aureus gradually decreased, the UV absorption peak underwent a blue shift, accompanied by a change in solution color. This is because the target concentration gradually decreased, leading to a decrease in the recognition efficiency of Apt-T for the target, which in turn reduced the cleavage efficiency of CRISPR / Cas12a. This resulted in some G-quadruplexes undergoing self-folding and the formation of catalase-like functions under the action of Hemin. The addition of TMB and H2O2 etched AuNRs, thus causing the gradual blue shift of the UV absorption peak. Figure 4 B shows that the logarithm of the Staphylococcus aureus concentration corresponds to the change in the wavelength of the maximum absorption peak within 10⁻⁵ × 10⁻⁵. 4 A good linear relationship was observed within the cfu / mL range. The regression equation was Y = 74.061 + 142.384lgC, where Y is ∆λ and the correlation coefficient R is 1 / 2. 2 The value was 0.985. The limit of detection (LOD) was calculated to be 4.26 cfu / mL based on the rule of three times the standard deviation of the blank response.

[0039] The color comparison results before and after the reaction are as follows: Figure 4 As shown in Figure A, the solution color gradually changes from gray to red, indicating the formation of an etching phenomenon caused by the inability to cleave the G-quadruplexes of AuNRs. Therefore, Staphylococcus aureus can be analyzed with the naked eye. With the gradual increase in the concentration of Staphylococcus aureus, the maximum absorption peak undergoes a blue shift, accompanied by a change in solution color. This is because the target concentration gradually decreases, leading to a decrease in the recognition efficiency of Apt-T on the target, causing a decrease in the cleavage efficiency of CRISPR / Cas12a. This results in some G-quadruplexes undergoing self-folding and the formation of catalase-like functions under the action of Hemin. The addition of TMB and H2O2 achieves etching of AuNRs, thus causing the gradual blue shift of the absorption peak.

[0040] The above description is merely an embodiment of this application and is not intended to limit the scope of this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the scope of the claims of this application.

Claims

1. A colorimetric sensor for detecting Staphylococcus aureus, characterized in that, include: Arched probe Apt-T, NL chain of nucleic acid lock, gold nanorods modified with G4 chain, crRNA, Cas12a protein, Mg 2+ Heme and K + ; The nucleic acid lock NL chain has a hairpin structure; the arched probe Apt-T is formed by hybridization of Apt and T chains; the G4 chain is modified on the surface of gold nanorods with thiol groups; The nucleotide sequences of the Apt, T strand, NL strand, G4 strand, and crRNA are shown in SEQ ID NO:1-5, respectively; and the 17th position of the NL strand is a ribonucleotide; the 5' end of the G4 strand is modified with a thiol group.

2. The colorimetric sensor according to claim 1, characterized in that, The preparation of the arched probe Apt-T includes the following steps: thermally denaturing the Apt and T chains in solution and then naturally cooling them to room temperature; The preparation of the nucleic acid lock NL chain includes the following steps: thermal denaturation of Apt and T chains in solution followed by cooling on ice; The method for preparing the gold nanorods modified with G4 chains includes the following steps: mixing G4 chains and gold nanorods in a solution at a molar ratio of 80:1 and incubating at room temperature to obtain an incubation solution; gradually increasing the NaCl concentration in the incubation solution, allowing it to stand, centrifuging at 6000 rpm and resuspending, repeating twice to obtain the precipitate, which is the gold nanorods modified with G4 chains. The preparation method of gold nanorods includes the following steps: (1) Mix HAuCl4 solution with CTAB solution, and then add ice-cold NaBH4 solution while stirring vigorously. Incubate in a warm water bath at 25°C for 1 hour to obtain seed liquid. (2) Mix 100 mL of 0.2 M CTAB solution with 100 mL of 0.01 M HAuCl4 solution, stir gently, and then add 6 mL of 0.004 M AgNO3 to obtain the growth solution; (3) Add 19.4 mg of ascorbic acid to 1.4 mL of growth medium, then add 240 μL of seed liquid, and incubate at 28 °C for 8 h; after separation and purification, gold nanorods are obtained.

3. The colorimetric sensor according to claim 1, characterized in that, The molar ratio of HAuCl4, CTAB, and NaBH4 was 2.5:1000:6; the molar ratio of HAuCl4, CTAB, and AgNO3 was 50:1000:1.2; and the volume ratio of seed solution to growth solution was 6:

35.

4. A kit comprising a colorimetric sensor as described in any one of claims 1-3.

5. A method for detecting Staphylococcus aureus, characterized in that, Includes the following steps: The colorimetric sensor as described in any one of claims 1-3, hydrogen peroxide, and the sample to be tested or a blank sample are mixed and incubated. Then, TMB is added to react. After the reaction is terminated, the wavelength change of the sample to be tested relative to the blank sample is measured to see if there is a maximum absorption peak.

6. The method according to claim 5, characterized in that, A blue shift in the absorption peak indicates the presence of Staphylococcus aureus; the concentration of Staphylococcus aureus can be calculated based on the change in the wavelength of the maximum absorption peak.