SNP molecular markers for constructing a dna fingerprint of camellia sinensis in shaoyang

Abstract

The present application relates to a kind of SNP molecular marker combination for constructing shaoyang tea tree DNA fingerprint, its nucleotide sequence is as shown in SEQ ID NO.49-SEQ ID NO.64.The corresponding PCR amplification primer pair is also provided, nucleotide sequence is as shown in SEQ ID NO.1-SEQ ID NO.48, utilize 16 pairs of primer pair combination therein can construct shaoyang tea tree fingerprint, to establish the molecular identity card of shaoyang tea tree, to verify the authenticity of tea tree germplasm.The 16 KASP markers have high variability, and are very effective for genotyping and variety identification.The present application can not only meet the needs of precise identification and resource protection of tea varieties, but also promote the in-depth development of tea genetic research, and has important scientific significance and application value.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and germplasm resources, and relates to a combination of SNP molecular markers for constructing DNA fingerprinting of Shaoyang tea trees and primer pairs for detecting molecular markers. Background Technology

[0002] As an important economic crop, the accurate identification of tea varieties and the protection of its resources are crucial for the sustainable development of the tea industry. Traditionally, the identification of tea varieties has relied mainly on morphological characteristics, but this method has many limitations, such as susceptibility to environmental factors, long identification cycles, and strong subjectivity, making it difficult to meet the needs of the modern tea industry for precise variety management and protection. Furthermore, the existence of "different species with the same name" and "different names for the same species" among tea variety resources has caused great difficulties for the protection and utilization of tea varieties.

[0003] With the rapid development of molecular biology techniques, molecular marker technology has gradually become an important tool for plant variety identification and genetic research. Common molecular marker technologies include RAPD, AFLP, ISSR, and SSR, which have played a significant role in tea variety identification and genetic diversity analysis. However, most of these marker technologies have certain limitations, such as poor reproducibility, complex operation, and high cost. SNP (single nucleotide polymorphism) molecular markers, as an emerging molecular marker technology, have advantages such as abundant quantity, wide distribution, high genetic stability, and simple detection. In recent years, SNP marker technology has been widely used in tea variety identification and genetic research. For example, by mining expressed sequence tags (ESTs) in tea plants to develop SNP markers and using these markers to construct DNA fingerprints of tea varieties, it is possible to effectively distinguish different tea varieties.

[0004] Shaoyang region boasts abundant tea tree resources, which possess unique genetic backgrounds and excellent quality characteristics, making them crucial for the development of the tea industry. However, current genetic research on Shaoyang tea trees is relatively limited, lacking systematic methods for constructing DNA fingerprint profiles and identifying varieties. Therefore, developing SNP molecular markers for Shaoyang tea trees and constructing their DNA fingerprint profiles is of significant practical importance for the protection and utilization of Shaoyang tea tree resources.

[0005] SNP markers offer significant advantages in constructing DNA fingerprints for tea plants. First, SNP markers exhibit high polymorphism, providing rich genetic information and enabling more precise differentiation between different tea varieties. Second, SNP marker detection technologies are relatively mature; the application of high-throughput detection technologies such as microfluidic chip methods makes SNP marker detection more efficient and accurate. Furthermore, DNA fingerprints constructed based on SNP markers can be combined with basic information about tea varieties to form a unique molecular identity, facilitating the digital management and rapid identification of tea variety resources. Summary of the Invention

[0006] In view of this, the purpose of this invention is to provide a combination of SNP molecular markers for constructing a DNA fingerprint of Shaoyang tea trees and primer pairs for detecting the molecular markers.

[0007] To achieve the above objectives, the present invention provides the following technical solution:

[0008] 1. A combination of SNP molecular markers used to construct the DNA fingerprint of Shaoyang tea trees, including the following SNP molecular markers:

[0009] The first SNP molecular marker is c1-48249235, and its nucleotide sequence is shown in SEQ ID NO.49;

[0010] The second SNP molecular marker is c10-51410146, and its nucleotide sequence is shown in SEQ ID NO.50;

[0011] The third SNP molecular marker is c11-48181411, and its nucleotide sequence is shown in SEQ ID NO.51;

[0012] The fourth SNP molecular marker is c11-105858509, and its nucleotide sequence is shown in SEQ ID NO.52;

[0013] The fifth SNP molecular marker is c11-88392839, and its nucleotide sequence is shown in SEQ ID NO.53;

[0014] The sixth SNP molecular marker is c12-50817361, and its nucleotide sequence is shown in SEQ ID NO.54;

[0015] The 7th SNP molecular marker is c14-50614012, and its nucleotide sequence is shown in SEQ ID NO.55;

[0016] The 8th SNP molecular marker is c15-47257681, and its nucleotide sequence is shown in SEQ ID NO.56;

[0017] The 9th SNP molecular marker is c2-50061511, and its nucleotide sequence is shown in SEQ ID NO.57;

[0018] The 10th SNP molecular marker is c3-42104702, and its nucleotide sequence is shown in SEQ ID NO.58;

[0019] The 11th SNP molecular marker is c4-48084248, and its nucleotide sequence is shown in SEQ ID NO.59;

[0020] The 12th SNP molecular marker is c6-51528820, and its nucleotide sequence is shown in SEQ ID NO.60;

[0021] The 13th SNP molecular marker is c6-9020026, and its nucleotide sequence is shown in SEQ ID NO.61;

[0022] The 14th SNP molecular marker is c7-49150804, and its nucleotide sequence is shown in SEQ ID NO.62;

[0023] The 15th SNP molecular marker is c8-44723634, and its nucleotide sequence is shown in SEQ ID NO.63;

[0024] The 16th SNP molecular marker is c8-110902402, and its nucleotide sequence is shown in SEQ ID NO.64.

[0025] 2. The PCR amplification primer pair combination of the SNP molecular marker combination described in Scheme 1 is designed based on the SNP molecular marker site sequence and includes 2 upstream genotyping primers and 1 downstream universal primer.

[0026] The two upstream typing primers are respectively labeled with fluorescent tags: f: GAAGGTGACCAAGTTCATGCT; h: GAAGGTCGGAGTCAACGGATT.

[0027] Furthermore, the present invention also provides a specific combination of PCR amplification primer pairs:

[0028] The nucleotide sequences of the PCR amplification primer pairs targeting the first SNP molecular marker are shown in SEQ ID NO. 1-3;

[0029] The nucleotide sequences of the PCR amplification primer pairs targeting the second SNP molecular marker are shown in SEQ ID NO.4-6;

[0030] The nucleotide sequences of the PCR amplification primer pairs targeting the third SNP molecular marker are shown in SEQ ID NO.7-9;

[0031] The nucleotide sequences of the PCR amplification primer pairs targeting the fourth SNP molecular marker are shown in SEQ ID NO.10-12;

[0032] The nucleotide sequences of the PCR amplification primer pairs targeting the 5th SNP molecular marker are shown in SEQ ID NO.13-15;

[0033] The nucleotide sequences of the PCR amplification primer pairs targeting the 6th SNP molecular marker are shown in SEQ ID NO.16-18;

[0034] The nucleotide sequences of the PCR amplification primer pairs targeting the 7th SNP molecular marker are shown in SEQ ID NO.19-21;

[0035] The nucleotide sequences of the PCR amplification primer pairs targeting the 8th SNP molecular marker are shown in SEQ ID NO.22-24;

[0036] The nucleotide sequences of the PCR amplification primer pairs targeting the 9th SNP molecular marker are shown in SEQ ID NO.25-27;

[0037] The nucleotide sequences of the PCR amplification primer pairs targeting the 10th SNP molecular marker are shown in SEQ ID NO.28-30;

[0038] The nucleotide sequences of the PCR amplification primer pairs targeting the 11th SNP molecular marker are shown in SEQ ID NO.31-33;

[0039] The nucleotide sequences of the PCR amplification primer pairs targeting the 12th SNP molecular marker are shown in SEQ ID NO.34-36.

[0040] The nucleotide sequences of the PCR amplification primer pairs targeting the 13th SNP molecular marker are shown in SEQ ID NO.37-39;

[0041] The nucleotide sequences of the PCR amplification primer pairs targeting the 14th SNP molecular marker are shown in SEQ ID NO.40-42;

[0042] The nucleotide sequences of the PCR amplification primer pairs targeting the 15th SNP molecular marker are shown in SEQ ID NO.43-45;

[0043] The nucleotide sequences of the PCR amplification primer pairs targeting the 16th SNP molecular marker are shown in SEQ ID NO.46-48.

[0044] 3. The present invention also provides an application of a PCR amplification primer pair combination for detecting SNP molecular marker combinations in constructing a DNA fingerprint of Shaoyang tea trees. The specific nucleotides of the SNP molecular marker combination are shown in SEQ ID NO.49-SEQ ID NO.64.

[0045] Furthermore, the PCR amplification primer pair combination is the PCR amplification primer pair combination shown in SEQ ID NO.1-SEQ ID NO.48.

[0046] 4. The present invention also provides an application of a PCR amplification primer pair combination for detecting SNP molecular marker combinations in the identification of Shaoyang tea germplasm. The specific nucleotides of the SNP molecular marker combinations are shown in SEQ ID NO.49-SEQ ID NO.64.

[0047] Furthermore, the PCR amplification primer pair combination is the PCR amplification primer pair combination shown in SEQ ID NO.1-SEQ ID NO.48.

[0048] 5. The present invention also provides a kit containing PCR amplification primers for detecting nucleotide sequences as shown in SEQ ID NO.49-SEQ ID NO.64.

[0049] 6. As shown in the attached diagram of the instruction manual. Figure 19 The fingerprint spectrum of Shaoyang tea trees shown is also within the scope of protection of this invention.

[0050] The beneficial effects of this invention are as follows: Based on the simplified genome resequencing comparison of Shaoyang tea trees, a total of 13,883 SNPs of Shaoyang tea trees were obtained. Through SNP sequencing quality control, SNP site quality control, and the setting of SNP screening thresholds, a set of SNPs for identifying Shaoyang tea tree germplasm was finally obtained. Furthermore, primers were designed for these SNPs to convert them into KASP markers, thus obtaining a standardized process for constructing SNP fingerprint maps, which can be used to establish molecular identification for Shaoyang tea trees. The PCR amplification primer pairs using the SNP molecular marker combinations provided by this invention were used for detection and identification, and the detection results were 100% accurate, providing high reliability. This has significant protective value for establishing a complete Shaoyang tea tree germplasm and DNA fingerprint database, thereby identifying Shaoyang tea tree germplasm resources.

[0051] This invention evaluated newly developed KASP primers using 55 Shaoyang tea germplasm resources, identifying candidate sites that could produce reliable genotyping results, and further optimizing and screening them by integrating first-generation sequencing data. Finally, KASP technology was used to identify single nucleotide polymorphisms (SNPs), identifying 16 key SNP sites. KASP primers for these key SNP sites were then used for subsequent analysis. These primers enable rapid identification of Shaoyang tea germplasm resources. Using these core SNPs, DNA fingerprinting of Shaoyang tea materials was constructed, and QR codes for the DNA fingerprinting were generated using an online generator. See [link to documentation]. Figure 20 and Figure 21 As shown, these markers contain fingerprint information to verify the authenticity of tea germplasm. These 16 KASP markers exhibit high variability and are highly effective for genotyping and variety identification.

[0052] In conclusion, the development of SNP molecular markers for constructing DNA fingerprints of Shaoyang tea trees can not only meet the needs of precise identification of tea varieties and resource protection, but also promote the in-depth development of tea tree genetic research, which has important scientific significance and application value. Attached Figure Description

[0053] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the following figures are provided for illustration:

[0054] Figure 1 This is a genotyping diagram of the c6-9020026 SNP site in a tea tree sample from Shaoyang.

[0055] Figure 2 This is a genotyping diagram of the Shaoyang tea tree sample at the c8-110902402 SNP site.

[0056] Figure 3 This is a genotyping diagram of the c11-88392839 SNP site in a tea tree sample from Shaoyang.

[0057] Figure 4 This is a genotyping diagram of the c11-105858509 SNP site in a tea tree sample from Shaoyang.

[0058] Figure 5 This is a genotyping diagram of the c1-48249235 SNP site in a tea tree sample from Shaoyang.

[0059] Figure 6 This is a genotyping diagram of the c2-50061511 SNP site in a tea tree sample from Shaoyang.

[0060] Figure 7 This is a genotyping diagram of the c3-42104702 SNP site in a Shaoyang tea tree sample.

[0061] Figure 8 This is a genotyping diagram of the c4-48084248 SNP site in a tea tree sample from Shaoyang.

[0062] Figure 9 This is a genotyping diagram of the c6-51528820 SNP site in a tea tree sample from Shaoyang.

[0063] Figure 10 This is a genotyping diagram of the Shaoyang tea tree sample at the c7-49150804 SNP site.

[0064] Figure 11 This is a genotyping diagram of the c8-44723634 SNP site in a tea tree sample from Shaoyang.

[0065] Figure 12 This is a genotyping diagram of the c10-51410146 SNP site in a tea tree sample from Shaoyang.

[0066] Figure 13 This is a genotyping diagram of the c11-48181411 SNP site in a Shaoyang tea tree sample.

[0067] Figure 14 This is a genotyping diagram of the c12-50817361 SNP site in a tea tree sample from Shaoyang.

[0068] Figure 15 This is a genotyping diagram of the c14-50614012 SNP site in a tea tree sample from Shaoyang.

[0069] Figure 16 This is a genotyping diagram of the c15-47257681 SNP site in a tea tree sample from Shaoyang.

[0070] Figure 17 A phylogenetic tree for tea tree samples from Shaoyang.

[0071] Figure 18 This is a PCA analysis chart.

[0072] Figure 19 DNA fingerprinting of 55 tea plant samples based on KASP markers.

[0073] Figure 20 This is a partial two-dimensional barcode image of 55 Shaoyang tea trees constructed based on 16 KASPs.

[0074] Figure 21 This is a partial two-dimensional barcode image of 55 Shaoyang tea trees constructed based on 16 KASPs.

[0075] Figure 22 This is a schematic diagram of the Shaoyang tea tree germplasm at the time of sample collection. Detailed Implementation

[0076] The preferred embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention. Experimental methods not specified with specific conditions in the embodiments are generally performed under conventional conditions or as recommended by the manufacturer.

[0077] Example 1

[0078] SNP site filtering and primer design for Shaoyang tea trees

[0079] 1. Using tea tree leaves collected from different locations in Shaoyang as samples, the information table of Shaoyang tea trees from different sources is shown in Table 1. Among them, the source of sample number SH is Shunhuang Mountain, Xinning County, Shaoyang, with latitude and longitude of 111.01240° and 26.44152°; the source of sample number GL is Gulou Township, Dongkou County, Shaoyang, with latitude and longitude of 110.46383° and 27.04818°; the source of sample number DC is Pengdong Township, Chengbu County, Shaoyang, with latitude and longitude of 110.28948° and 26.06293°; and the source of sample number GD is Baiyunyan, Xinshao County, Shaoyang, with latitude and longitude of 111.31504° and 27.36747°.

[0080] 2. Figure 22 This image shows a partial schematic diagram of Shaoyang tea tree germplasm. The DNA of this species was digested using various restriction endonucleases, and appropriate enzymes were selected for subsequent experiments based on the results. This experiment used double digestion with NlaIII (Hin1II, CATG^) at the Read1 end and EcoRI (G^AATTC) at the Read2 end.

[0081] Table 1 Information on Shaoyang Tea Trees from Different Sources

[0082]

[0083]

[0084] 2. For DNA samples that pass quality inspection, pair-end libraries with a length range of 300-500bp are constructed using the ddRAD library construction method.

[0085] 3. Illumina HiSeq PE150 sequencing was used to obtain valuable data for analysis and identification of a large number of SNP markers. The raw reads (paired-end sequences) obtained from sequencing were evaluated to obtain the raw reads for each sample. Then, stacks (2.59) were used to call SNPs. After filtering the SNPs, the obtained SNP markers were used for PCA, phylogenetic tree analysis, population structure analysis, etc.

[0086] 3.1 SNP site steps

[0087] (1) First step: SNP sites are conserved in the DNA strands on the chromosome with a sequence greater than 50 bp before and after them. Filtering yields 3,683,656 SNP markers.

[0088] (2) In the second step, the following markers are retained: average depth of 5X or above, minimum integrity greater than 0.9, minimum allele frequency greater than 0.05, and SNP is biallelic. 86,364 SNP markers are obtained by filtering.

[0089] (3) The third step is to extract 100bp sequences upstream and downstream of the SNP marker, and then use blast software (version: 2.10.1+) to align the sequences with the reference genome, remove markers at multiple positions in the alignment, and filter to obtain 11053 SNP markers;

[0090] (4) Fourth step, retain the labels with polymorphic information content (PIC) greater than 0.35. The PIC calculation formula is referenced (Botstein D, et al. 1980 and Zhang, et al. 2020). Finally, 1309 SNP labels are obtained by filtering. Some results are shown in Table 2.

[0091] Table 2 shows some SNP markers.

[0092]

[0093]

[0094] Example 2

[0095] Primers were designed for the SNP markers obtained in Example 1 and converted into KASP markers. Sixteen markers were successfully designed, and the results are shown in Table 3.

[0096] Table 3

[0097]

[0098]

[0099]

[0100] KASP experimental method:

[0101] Main reagents and consumables: FASA™ PCR Master Mix (2×), ABclonal; 96-well PCR Tape, Shanghai Sangon Biotech Co., Ltd.

[0102] 1. Add a universal fluorescent tag to the 5' end of the primer: FAM: GAAGGTGACCAAGTTCATGCT; HEX: GAAGGTCGGAGTCAACGGATT. The specific primer sequences are shown in Table 3.

[0103] The newly synthesized primers were diluted to 10 μM with TE (pH 8.0), and then mixed in a ratio of upstream genotyping primer f: upstream genotyping primer h: downstream universal primer r = 1:1:3 before being added to the instrument. 1.25 μL of primer mixture was added to every 5 μL of reaction system.

[0104] The sequences detected by KASP and their corresponding SNP sites are shown in Table 4:

[0105] Table 4

[0106]

[0107]

[0108]

[0109]

[0110] Note: N = A, T, C or G.

[0111] 2. DNA sample dilution and addition:

[0112] The DNA samples were diluted in batches according to the lowest concentration sample to a single-digit ratio (the concentration of the diluted sample was 2-20 ng; when using this concentration, no H2O was added to the reaction system). Table 5 shows the PCR reaction system, with each 5 μl reaction system containing 1.25 μl of diluted DNA sample.

[0113] Table 5. Construction of PCR reaction system

[0114]

[0115]

[0116] 3. Seal the 96-well PCR reaction plate, shake, and centrifuge to ensure the reaction system is thoroughly mixed.

[0117] 4. After centrifugation, perform the PCR reaction. The reaction conditions are shown in Table 6 below:

[0118] Table 6 PCR reaction conditions

[0119]

[0120] 5. If the genotyping results are not ideal, they can be optimized by increasing the PCR reaction, as shown in Table 7 below:

[0121] Table 7

[0122] Step Tem Time NO. of cycle 1 95℃ 20 seconds 3 2 55℃ 60 seconds

[0123] The genotyping results of all samples at 16 SNP loci are shown in Table 8. Further, the efficiency of the screened markers that could successfully undergo KASP experiments was plotted.

[0124] The genotyping diagrams of each sample at the c6-9020026 SNP site are as follows: Figure 1 As shown, the genotyping diagrams of each sample at the c8-110902402 SNP site are as follows. Figure 2 As shown; the genotyping diagram at the c11-88392839 SNP site is as follows. Figure 3 As shown; the genotyping diagram at the c11-105858509 SNP site is as follows. Figure 4 As shown; the genotyping diagram at the c1-48249235 SNP site is as follows. Figure 5 As shown; the genotyping diagram at the c2-50061511 SNP site is as follows. Figure 6 As shown; the genotyping diagram at the c3-42104702 SNP site is as follows. Figure 7 As shown; the genotyping diagram at the c4-48084248 SNP site is as follows. Figure 8 As shown; the genotyping diagram at the c6-51528820 SNP site is as follows. Figure 9 As shown; the genotyping diagram at the c7-49150804 SNP site is as follows. Figure 10 As shown; the genotyping diagram at the c8-44723634 SNP site is as follows. Figure 11 As shown; the genotyping diagram at the c10-51410146 SNP site is as follows. Figure 12 As shown; the genotyping diagram at the c11-48181411 SNP site is as follows. Figure 13 As shown; the genotyping diagram at the c12-50817361 SNP site is as follows. Figure 14 As shown; the genotyping diagram at the c14-50614012 SNP site is as follows. Figure 15 As shown; the genotyping diagram at the c15-47257681 SNP site is as follows. Figure 16As shown in the figure, the horizontal axis shows a higher proportion of FAM fluorescence, indicating homozygous type 1 (yellow); the vertical axis shows a higher proportion of VIC / HEX fluorescence, indicating homozygous type 2 (blue); the middle area shows an equal proportion of the two fluorescence types, indicating heterozygous type (green, red); the black area in the lower left corner is the negative control (NTC). Figure 17 Phylogenetic tree of Shaoyang tea tree samples, Figure 18 For PCA analysis chart, Figure 19 This is a DNA fingerprint map of 55 tea tree samples based on KASP markers. The horizontal axis represents the sample, and the vertical axis represents the locus: chromosome + location + reference + substitution. Gray areas indicate genotype deletion. Green indicates heterozygotes (0 / 1), red indicates pure unmutated (0 / 0), and blue indicates pure mutated (1 / 1). The two-dimensional barcode map of the 55 Shaoyang tea trees constructed based on KASP primer pairs at 16 SNP loci is shown below. Figure 20 and Figure 21 As shown.

[0125] Table 8 Summary of Classification Results

[0126]

[0127]

[0128] Note: UD is an abbreviation for undetermined.

[0129] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made to it in form and detail without departing from the scope defined by the claims of the present invention.

Claims

1. A combination of SNP molecular markers for constructing a DNA fingerprint of Shaoyang tea trees, characterized in that, Including the following SNP molecular markers: The first SNP molecular marker is c1-48249235, and its nucleotide sequence is shown in SEQ ID NO.49; The second SNP molecular marker is c10-51410146, and its nucleotide sequence is shown in SEQ ID NO.50; The third SNP molecular marker is c11-48181411, and its nucleotide sequence is shown in SEQ ID NO.51; The fourth SNP molecular marker is c11-105858509, and its nucleotide sequence is shown in SEQ ID NO.52; The fifth SNP molecular marker is c11-88392839, and its nucleotide sequence is shown in SEQ ID NO.53; The sixth SNP molecular marker is c12-50817361, and its nucleotide sequence is shown in SEQ ID NO.54; The 7th SNP molecular marker is c14-50614012, and its nucleotide sequence is shown in SEQ ID NO.55; The 8th SNP molecular marker is c15-47257681, and its nucleotide sequence is shown in SEQ ID NO.56; The 9th SNP molecular marker is c2-50061511, and its nucleotide sequence is shown in SEQ ID NO.57; The 10th SNP molecular marker is c3-42104702, and its nucleotide sequence is shown in SEQ ID NO.58; The 11th SNP molecular marker is c4-48084248, and its nucleotide sequence is shown in SEQ ID NO.59; The 12th SNP molecular marker is c6-51528820, and its nucleotide sequence is shown in SEQ ID NO.60; The 13th SNP molecular marker is c6-9020026, and its nucleotide sequence is shown in SEQ ID NO.61; The 14th SNP molecular marker is c7-49150804, and its nucleotide sequence is shown in SEQ ID NO.62; The 15th SNP molecular marker is c8-44723634, and its nucleotide sequence is shown in SEQ ID NO.63; The 16th SNP molecular marker is c8-110902402, and its nucleotide sequence is shown in SEQ ID NO.

64.

2. A PCR amplification primer pair combination for amplifying the SNP molecular marker combination according to claim 1, characterized in that, The primers were designed based on the SNP molecular marker site sequence, including two upstream typing primers and one downstream universal primer.

3. The PCR amplification primer pair combination according to claim 2, characterized in that, in, The nucleotide sequences of the PCR amplification primer pairs targeting the first SNP molecular marker are shown in SEQ ID NO. 1-3; The nucleotide sequences of the PCR amplification primer pairs targeting the second SNP molecular marker are shown in SEQ ID NO.4-6; The nucleotide sequences of the PCR amplification primer pairs targeting the third SNP molecular marker are shown in SEQ ID NO.7-9; The nucleotide sequences of the PCR amplification primer pairs targeting the fourth SNP molecular marker are shown in SEQ ID NO.10-12; The nucleotide sequences of the PCR amplification primer pairs targeting the 5th SNP molecular marker are shown in SEQ ID NO.13-15; The nucleotide sequences of the PCR amplification primer pairs targeting the 6th SNP molecular marker are shown in SEQ ID NO.16-18; The nucleotide sequences of the PCR amplification primer pairs targeting the 7th SNP molecular marker are shown in SEQ ID NO.19-21; The nucleotide sequences of the PCR amplification primer pairs targeting the 8th SNP molecular marker are shown in SEQ ID NO.22-24; The nucleotide sequences of the PCR amplification primer pairs targeting the 9th SNP molecular marker are shown in SEQ ID NO.25-27; The nucleotide sequences of the PCR amplification primer pairs targeting the 10th SNP molecular marker are shown in SEQ ID NO.28-30; The nucleotide sequences of the PCR amplification primer pairs targeting the 11th SNP molecular marker are shown in SEQ ID NO.31-33; The nucleotide sequences of the PCR amplification primer pairs targeting the 12th SNP molecular marker are shown in SEQ ID NO.34-36; The nucleotide sequences of the PCR amplification primer pairs targeting the 13th SNP molecular marker are shown in SEQ ID NO.37-39; The nucleotide sequences of the PCR amplification primer pairs targeting the 14th SNP molecular marker are shown in SEQ ID NO.40-42; The nucleotide sequences of the PCR amplification primer pairs targeting the 15th SNP molecular marker are shown in SEQ ID NO.43-45; The nucleotide sequences of the PCR amplification primer pairs targeting the 16th SNP molecular marker are shown in SEQ ID NO.46-48.

4. The application of a PCR amplification primer pair combination for detecting the SNP molecular marker combination described in claim 1 in constructing a DNA fingerprint of Shaoyang tea trees.

5. The application according to claim 4, characterized in that, The PCR amplification primer pair combination is the PCR amplification primer pair combination described in claim 2 or claim 3.

6. The application of a PCR amplification primer pair combination for detecting the SNP molecular marker combination described in claim 1 in the identification of Shaoyang tea germplasm.

7. The application according to claim 6, characterized in that, The PCR amplification primer pair combination is the PCR amplification primer pair combination described in claim 2 or claim 3.

8. A reagent kit, characterized in that, It contains the PCR amplification primers as described in claim 2 or claim 3.

Images