Production of CAR modifiers for tumor treatment

Abstract

The present disclosure provides a modified immune cell or a precursor thereof (e.g., a T cell) comprising a first chimeric antigen receptor (CAR) capable of binding to human IL13R [alpha] 2, a second CAR capable of binding to EGFR or an isoform thereof, and a dominant negative TGFRII receptor (DN-TGFRII). Compositions and methods of treatment are also provided.

Description

[0001] Cross-references to related applications This application claims priority to U.S. Provisional Patent Application No. 63 / 489,979, filed March 13, 2023, pursuant to 35 USC § 119(e), the entire contents of which are incorporated herein by reference. Background Technology

[0002] Malignant gliomas—including grade IV gliomas, also known as glioblastomas (GBM)—are the most common primary malignant brain tumors and are associated with high morbidity and mortality. The invasive nature of glioma cells, which grow infiltrate the central nervous system (CNS), makes complete resection impossible. Despite the availability of the best treatment options, including surgical resection, radiation therapy, chemotherapy, and other cancer therapies, the median survival for GBM patients is only 12–17 months, and for grade III glioma patients, it is 2–5 years.

[0003] Redirected T-cell adoptive immunotherapy is a viable strategy for treating these malignancies. Patients with refractory chronic lymphocytic leukemia have achieved long-term disease-free survival after treatment with CD19-targeting chimeric antigen receptor-modified autologous T-cells (CAR T-cells), and 90% of patients with relapsed acute lymphoblastic leukemia (ALL) have achieved complete remission through this strategy. However, to date, the antitumor activity of CAR T-cells in solid tumors has been much milder. Humanized anti-EGFR variant III (EGFRvIII) CAR T-cells (2173BBz) were previously used in a phase I clinical trial (NCT02209376) in 10 patients with relapsed GBM. Following CAR T-cell infusion, the tumor microenvironment underwent significant alterations, including a reduction in EGFRvIII target antigens associated with CAR T-cell transport and in situ functional activation. However, this study could not determine clinical response (median overall survival was 251 days). A recent report describes repeated intratumoral and intrathecal infusions of redirected T cells expressing IL13 zetakine (a mutated IL13 cytokine fused with T cell signaling domains) in a single patient with recurrent multifocal GBM, which resulted in complete tumor regression at 7.5 months.

[0004] Interleukin-13 receptor α2 (IL13Rα2) is expressed in various types of human tumors, but not in normal human tissues except for the adult testis. IL13 signaling via IL13Rα2 plays a crucial role in cell migration and invasion. Previous studies have found that 82% of GBM cases express IL13Rα2. Neutralizing antibodies and drug-conjugated antibodies targeting IL13Rα2 inhibit tumor growth in xenograft mouse models. IL13Rα2-based tumor vaccines have also benefited pediatric glioma patients. Although IL13 zetakine-redirected T cells bind to IL13Rα2 and induce limited clinical responses, they also bind to IL13Rα1, which is expressed in some normal human tissues, and exhibit undesirable off-target effects.

[0005] Tumor heterogeneity and the immunosuppressive tumor microenvironment (TME) are major obstacles to chimeric antigen receptor (CAR) T-cell therapy in GBM. The decreased site specificity of EGFRvIII after CAR T-therapy is consistent with the observed intratumoral heterogeneity in GBM. Importantly, immunohistochemical analysis of the tissues revealed an adaptive response within the GBM TME that closely followed the timeline of CAR T activation. Following treatment, IDO1, PD-L1, IL10, and TGFβ were all increased in tumor tissue near CAR T cells. These immunomodulatory pathways play a crucial role in tumor immune evasion in numerous cases and indicate the development of adaptive resistance within GBM, which further weakens the intratumoral immune response.

[0006] There is a need in the art for improved CAR T-therapy that targets multiple antigens and disrupts immunosuppressive signaling within the TME. This invention addresses and fulfills this need. Summary of the Invention

[0007] As described herein, the present invention relates to modified immune cells or their precursors (e.g., T cells) comprising a first chimeric antigen receptor (CAR) capable of binding human IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative (dominantly inactivated) TGF-β. Type II receptor (DN-TGFβRII). Compositions and treatment methods are also provided.

[0008] In one aspect, the present invention includes nucleic acids, said nucleic acids comprising The first polynucleotide sequence encoding a first chimeric antigen receptor (CAR) includes a first antigen-binding domain, a transmembrane domain, and an intracellular domain that bind to human IL13Rα2. The second polynucleotide sequence encoding the second CAR includes a second antigen-binding domain that binds to the epidermal growth factor receptor (EGFR) or its isotype, a transmembrane domain, and an intracellular domain. Encoding dominant-negative TGF Type II receptor (DN-TGF) The third polynucleotide sequence of RII.

[0009] In some embodiments, the first and / or second antigen-binding domains are selected from full-length antibodies or their antigen-binding fragments, Fab, single-chain variable region fragments (scFv), or single-domain antibodies.

[0010] In some implementations, the first antigen-binding domain includes: The heavy chain variable region comprises three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence TKYGVH (SEQ ID NO: 1), HCDR2 contains the amino acid sequence GVKWAGGSTDYNSALMS (SEQ ID NO: 3), and HCDR3 contains the amino acid sequence DHRDAMDY (SEQ ID NO: 4); and The light chain variable region comprises three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence TASLSVSSTYLH (SEQ ID NO: 5), LCDR2 contains the amino acid sequence STSNLAS (SEQ ID NO: 6), and LCDR3 contains the amino acid sequence HQYHRSPLT (SEQ ID NO: 7).

[0011] In some embodiments, the first antigen-binding domain includes a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 8; and / or a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 9.

[0012] In some embodiments, the first antigen-binding domain is a single-chain variable region fragment (scFv) containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 10 or 11.

[0013] In some embodiments, the first polynucleotide sequence encodes a CAR, said CAR comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 23, 24, 42, or 43.

[0014] In some embodiments, the second antigen-binding domain includes: The heavy chain variable region comprises three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence GYSITSDFAWN (SEQ ID NO: 25), HCDR2 contains the amino acid sequence GYISYSGNTRYNPSLK (SEQ ID NO: 26), and HCDR3 contains the amino acid sequence VTAGRGFPYW (SEQ ID NO: 27); and The light chain variable region comprises three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence HSSQDINSNIG (SEQ ID NO: 28), LCDR2 contains the amino acid sequence HGTNLDD (SEQ ID NO: 29), and LCDR3 contains the amino acid sequence VQYAQFPWT (SEQ ID NO: 30).

[0015] In some embodiments, the second antigen-binding domain includes a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 31; and / or a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 32.

[0016] In some embodiments, the second antigen-binding domain is a single-chain variable region fragment (scFv) containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 33 or 71.

[0017] In some embodiments, the second polynucleotide sequence encodes a CAR, which contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 35 or 75.

[0018] In some embodiments, DN-TGFβRII comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 2.

[0019] In some embodiments, the nucleic acid encodes an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 77 or 79.

[0020] In some embodiments, the transmembrane domain is selected from artificial hydrophobic sequences, and the transmembrane domains of type I transmembrane proteins, the α, β or ζ chains of T cell receptors, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, OX40 (CD134), 4-1BB (CD137) and CD154, or the transmembrane domains derived from suicide immunoglobulin-like receptors (KIR).

[0021] In some implementations, the transmembrane domain includes the transmembrane domain of CD8.

[0022] In some implementations, the transmembrane domain of CD8 is the transmembrane domain of CD8α.

[0023] In some implementations, the intracellular domain includes a co-stimulatory signal transduction domain and an intracellular signal transduction domain.

[0024] In some embodiments, the intracellular domain comprises a co-stimulatory domain of a protein selected from the TNFR superfamily, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS, NKG2C, and B7-H3 (CD276), or variants thereof, or an intracellular domain derived from the suicide immunoglobulin-like receptor (KIR).

[0025] In some implementations, the intracellular domain includes a 4-1BB co-stimulatory domain.

[0026] In some embodiments, the intracellular signaling domain comprises an intracellular domain selected from the following: human CD3ζ chain (CD3ζ), FcγRIII, FcsRI, the cytoplasmic tail region of the Fc receptor, a cytoplasmic receptor carrying an immune receptor tyrosine-based activation motif (ITAM), TCRζ, FcRγ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d, or variations thereof.

[0027] In some implementations, the intracellular signal transduction domain includes the intracellular domain of CD3ζ.

[0028] In another aspect, the present invention includes a nucleic acid comprising a first polynucleotide sequence encoding a chimeric antigen receptor (CAR) capable of binding to IL13Rα2 and encoding a dominant-negative TGF-β2. The second polynucleotide sequence of the type II receptor (DN-TGFβRII), The CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen-binding domain comprises: The heavy chain variable region comprises three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence TKYGVH (SEQ ID NO: 1), HCDR2 contains the amino acid sequence GVKWAGGSTDYNSALMS (SEQ ID NO: 3), and HCDR3 contains the amino acid sequence DHRDAMDY (SEQ ID NO: 4); and The light chain variable region comprises three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence TASLSVSSTYLH (SEQ ID NO: 5), LCDR2 contains the amino acid sequence STSNLAS (SEQ ID NO: 6), and LCDR3 contains the amino acid sequence HQYHRSPLT (SEQ ID NO: 7).

[0029] In some embodiments, the antigen-binding domain includes a heavy chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 8; and / or a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 9.

[0030] In some embodiments, the antigen-binding domain is scFv, which contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 10 or 11.

[0031] In some embodiments, the CAR comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 23, 24, 42, or 43.

[0032] In some embodiments, DN-TGFβRII comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 2.

[0033] In another aspect, the present invention includes nucleic acids, said nucleic acids comprising The first polynucleotide sequence encoding CAR contains an antigen-binding domain that binds to the epidermal growth factor receptor (EGFR) or its isotype, a transmembrane domain, and an intracellular domain, as well as Encoding dominant-negative TGF Type II receptor (DN-TGF) The second polynucleotide sequence of RII).

[0034] In some embodiments, the antigen-binding domain includes a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 31; and / or a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 32.

[0035] In some embodiments, the antigen-binding domain is scFv, which contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 33 or 71.

[0036] In some embodiments, the CAR comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 23, 24, 35, 42, 43, or 75.

[0037] In some embodiments, DN-TGFβRII comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 2.

[0038] In some embodiments, the nucleic acid encodes an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 81, 83, or 85.

[0039] In another aspect, the present invention includes a nucleic acid comprising a first polynucleotide sequence encoding a first CAR capable of binding IL13Rα2, a second polynucleotide sequence encoding a second CAR capable of binding epidermal growth factor receptor (EGFR) or its isotype, and a third polynucleotide sequence encoding a dominant-negative TGFβ type II receptor (DN-TGFβRII), wherein: The first CAR includes an antigen-binding domain, the antigen-binding domain comprising: The heavy chain variable region comprises three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence TKYGVH (SEQ ID NO: 1), HCDR2 contains the amino acid sequence GVKWAGGSTDYNSALMS (SEQ ID NO: 3), and HCDR3 contains the amino acid sequence DHRDAMDY (SEQ ID NO: 4); and The light chain variable region comprises three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence TASLSVSSTYLH (SEQ ID NO: 5), LCDR2 contains the amino acid sequence STSNLAS (SEQ ID NO: 6), and LCDR3 contains the amino acid sequence HQYHRSPLT (SEQ ID NO: 7), and The second CAR includes an antigen-binding domain, which comprises: The heavy chain variable region comprises three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence GYSITSDFAWN (SEQ ID NO: 25), HCDR2 contains the amino acid sequence GYISYSGNTRYNPSLK (SEQ ID NO: 26), and HCDR3 contains the amino acid sequence VTAGRGFPYW (SEQ ID NO: 27); and The light chain variable region comprises three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence HSSQDINSNIG (SEQ ID NO: 28), LCDR2 contains the amino acid sequence HGTNLDD (SEQ ID NO: 29), and LCDR3 contains the amino acid sequence VQYAQFPWT (SEQ ID NO: 30), and The DN-TGFβRII contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2.

[0040] In another aspect, the present invention includes a nucleic acid comprising a first polynucleotide sequence encoding a first CAR capable of binding IL13Rα2, a second polynucleotide sequence encoding a second CAR capable of binding epidermal growth factor receptor (EGFR) or an isotype thereof, and a third polynucleotide sequence encoding DN-TGFβRII, wherein: The first CAR includes: A heavy chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 44 or 54; and A light chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 48 or 58; and The second CAR includes: A heavy chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 73; and The light chain variable region is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 74.

[0041] In another aspect, the present invention includes a nucleic acid comprising a first polynucleotide sequence encoding a first CAR capable of binding IL13Rα2, a second polynucleotide sequence encoding a second CAR capable of binding epidermal growth factor receptor (EGFR) or an isotype thereof, and a third polynucleotide sequence encoding DN-TGFβRII, wherein: The first CAR comprises a single-stranded variable region fragment (scFv) encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 64, 65, 66, or 69; and The second CAR comprises a single-stranded variable region fragment (scFv) encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 70.

[0042] In another aspect, the present invention includes a nucleic acid comprising a first polynucleotide sequence encoding a first chimeric antigen receptor capable of binding IL13Rα2, a second polynucleotide sequence encoding a second chimeric antigen receptor (CAR) capable of binding epidermal growth factor receptor (EGFR) or its isotype, and a third polynucleotide sequence encoding DN-TGFβRII, wherein: The first polynucleotide sequence comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 62, or SEQ ID NO: 63; and The second polynucleotide sequence comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 34.

[0043] In some embodiments, DN-TGFβRII comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 2, or is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 14.

[0044] In some implementations, the first polynucleotide sequence and the second polynucleotide sequence are separated by a linker.

[0045] In some implementations, the second and third polynucleotide sequences are separated by a linker.

[0046] In some implementations, the nucleic acid comprises a 5' to 3' second polynucleotide sequence, a linker, and a first polynucleotide sequence.

[0047] In some implementations, the nucleic acid comprises a 5' to 3' second polynucleotide sequence, a linker, a first polynucleotide sequence, a linker, and a third polynucleotide sequence.

[0048] In another aspect, the present invention includes a vector comprising the nucleic acid of any one of the preceding claims.

[0049] In some embodiments, the carrier is an expression carrier.

[0050] In some embodiments, the vector is selected from DNA vectors, RNA vectors, plasmids, lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, and retroviral vectors.

[0051] In some embodiments, the carrier of any aspect of the above-described aspects or embodiments disclosed herein further includes the EF-1 promoter.

[0052] In some embodiments, the vector of any aspect of the above-described aspects or embodiments disclosed herein further comprises a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE).

[0053] In some embodiments, the carrier of the foregoing aspects or implementations or any aspect of the implementations disclosed herein also includes a rev response element (RRE).

[0054] In some embodiments, the carrier of the above aspects or embodiments or any aspect of the embodiments disclosed herein also includes a cPPT sequence.

[0055] In some embodiments, the carrier is a self-deactivating carrier.

[0056] In another aspect, the present invention includes modified immune cells or precursor cells thereof, comprising a nucleic acid of any one of claims 1-38 or a vector of any one of claims 39-46.

[0057] In another aspect, the present invention includes modified immune cells or precursor cells thereof, comprising: It contains a first chimeric antigen receptor (CAR) capable of binding to the first antigen-binding domain of IL13Rα2; and The second chimeric antigen receptor (CAR) includes a second antigen-binding domain capable of binding to the epidermal growth factor receptor (EGFR) or its isotype. And dominant-negative TGFβ type II receptor (DN-TGFβRII).

[0058] In another aspect, the present invention includes modified immune cells or their precursor cells comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGF) RII), where: The first CAR includes: The heavy chain variable region comprises three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence TKYGVH (SEQ ID NO: 1) or SRNGMS (SEQ ID NO: 12), HCDR2 contains the amino acid sequence GVKWAGGSTDYNSALMS (SEQ ID NO: 3) or TVSSGGSYIYYADSVKG (SEQ ID NO: 13), and HCDR3 contains the amino acid sequence DHRDAMDY (SEQ ID NO: 4) or QGTTALATRFFDV (SEQ ID NO: 15); and The light chain variable region comprises three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence TASLSVSSTYLH (SEQ ID NO: 5) or KASQDVGTAVA (SEQ ID NO: 16), LCDR2 contains the amino acid sequence STSNLAS (SEQ ID NO: 6) or SASYRST (SEQ ID NO: 17), and LCDR3 contains the amino acid sequence HQYHRSPLT (SEQ ID NO: 7) or QHHYSAPWT (SEQ ID NO: 18); and The second CAR includes: The heavy chain variable region comprises three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence GYSITSDFAWN (SEQ ID NO: 25), HCDR2 contains the amino acid sequence GYISYSGNTRYNPSLK (SEQ ID NO: 26), and HCDR3 contains the amino acid sequence VTAGRGFPYW (SEQ ID NO: 27); and The light chain variable region comprises three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence HSSQDINSNIG (SEQ ID NO: 28), LCDR2 contains the amino acid sequence HGTNLDD (SEQ ID NO: 29), and LCDR3 contains the amino acid sequence VQYAQFPWT (SEQ ID NO: 30).

[0059] In another aspect, the present invention includes modified immune cells or their precursor cells comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGFβRII), of which: The first CAR includes: Heavy chain variable region, the heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 8 or 19; and / or A light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 9 or 20; and The second CAR includes: Heavy chain variable region, said heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 31; and / or The light chain variable region comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 32.

[0060] In another aspect, the present invention includes modified immune cells or their precursor cells comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGF) RII), where: The first CAR includes a single-stranded variable region fragment (scFv) containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 10 or 11; and The second CAR includes a single-stranded variable region fragment (scFv) containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 33 or 71.

[0061] In another aspect, the present invention includes modified immune cells or their precursor cells comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGFβRII), of which: The first CAR contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 23, 24, 42, or 43; and The second CAR contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 35 or 75.

[0062] In another aspect, the present invention includes modified immune cells or their precursor cells comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGFβRII), of which: The first CAR includes: A heavy chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 44 or 54; and A light chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 48 or 58; and The second CAR includes: A heavy chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 73; and The light chain variable region is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 74.

[0063] In another aspect, the present invention includes modified immune cells or their precursor cells comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGFβRII), of which: The first CAR comprises an scFv encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 64, 65, 66, or 69; and The second CAR comprises an scFv encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 70.

[0064] In another aspect, the present invention includes modified immune cells or their precursor cells comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGFβRII), of which: The first polynucleotide sequence comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 62, or SEQ ID NO: 63; and The second polynucleotide sequence comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 34.

[0065] In some embodiments, DN-TGFβRII comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 2, or is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 14.

[0066] In some implementations, the second CAR can bind to EGFR isotypes selected from: wild-type EGFR (wtEGFR), mutant EGFR, and EGFR. A289V EGFR A289D EGFR A289T EGFR A289T EGFR R108K EGFR R108G EGFR G598V EGFR D126Y EGFR C628F EGFR R108K / A289V EGFR R108K / D126Y EGFRA289V / G598V EGFR A289V / C628F and EGFR variant II, or any combination thereof.

[0067] In some implementations, the modified cells are modified T cells.

[0068] In some implementations, the modified cells are autologous cells.

[0069] In some implementations, the modified cells are autologous cells obtained from a human subject.

[0070] In some embodiments, DN-TGFβRII comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 2.

[0071] In another aspect, the present invention includes a pharmaceutical composition comprising a therapeutically effective amount of the modified cells according to any one of claims 47-61.

[0072] In another aspect, the invention includes a method of treating a disease in a subject in need of treatment, comprising administering to the subject an effective amount of any of the modified cells of claims 47-61 or the pharmaceutical composition of claim 62.

[0073] In some implementations, the disease is cancer.

[0074] In some implementations, the cancer is a glioma.

[0075] In some implementations, the cancer is an astrocytoma.

[0076] In some implementations, the cancer is a high-grade astrocytoma.

[0077] In some implementations, the cancer is glioblastoma.

[0078] In another aspect, the present invention includes a method of treating glioblastoma in a subject in need of treatment, comprising administering an effective amount of modified T cells to the subject, said modified T cells comprising: It contains a first chimeric antigen receptor (CAR) capable of binding to the first antigen-binding domain of IL13Rα2; and The second chimeric antigen receptor (CAR) comprises a second antigen-binding domain capable of binding to epidermal growth factor receptor (EGFR) or its isotype; and dominant-negative TGF. Type II receptor (DN-TGFβRII).

[0079] In another aspect, the present invention includes a method of treating glioblastoma in a subject in need of treatment, comprising administering an effective amount of modified T cells to the subject, said modified T cells comprising: a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGFβRII), among which The first CAR includes: The heavy chain variable region comprises three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence TKYGVH (SEQ ID NO: 1) or SRNGMS (SEQ ID NO: 12), HCDR2 contains the amino acid sequence GVKWAGGSTDYNSALMS (SEQ ID NO: 3) or TVSSGGSYIYYADSVKG (SEQ ID NO: 13), and HCDR3 contains the amino acid sequence DHRDAMDY (SEQ ID NO: 4) or QGTTALATRFFDV (SEQ ID NO: 15); and The second CAR includes: The heavy chain variable region comprises three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence GYSITSDFAWN (SEQ ID NO: 25), HCDR2 contains the amino acid sequence GYISYSGNTRYNPSLK (SEQ ID NO: 26), and HCDR3 contains the amino acid sequence VTAGRGFPYW (SEQ ID NO: 27); and The light chain variable region comprises three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence HSSQDINSNIG (SEQ ID NO: 28), LCDR2 contains the amino acid sequence HGTNLDD (SEQ ID NO: 29), and LCDR3 contains the amino acid sequence VQYAQFPWT (SEQ ID NO: 30).

[0080] In another aspect, the present invention includes a method of treating glioblastoma in a subject in need of treatment, comprising administering an effective amount of modified T cells to the subject, said modified T cells comprising: a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGFβRII), of which: The first CAR includes: The heavy chain variable region comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 8 or 19; and A light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 9 or 20; and The second CAR includes: Heavy chain variable region, said heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 31; and / or The light chain variable region comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 32.

[0081] In another aspect, the present invention includes a method of treating glioblastoma in a subject in need of treatment, comprising administering an effective amount of modified T cells to the subject, said modified T cells comprising: a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGF) RII), where: The first CAR contains an scFv, the scFv containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 21, or SEQ ID NO: 22, and The second CAR contains scFv, which contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 33 or 71.

[0082] In another aspect, the present invention includes a method of treating glioblastoma in a subject in need of treatment, comprising administering an effective amount of modified T cells to the subject, said modified T cells comprising: a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGF) RII), where: The first CAR contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 42, or SEQ ID NO: 43; and The second CAR contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 35 or 75.

[0083] In some implementations, DN-TGF RII contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 2, or is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 14.

[0084] In another aspect, the present invention includes a method of treating glioblastoma in a subject in need of treatment, comprising administering an effective amount of modified T cells to the subject, said modified T cells comprising: a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGF) RII), where: The first CAR includes: A heavy chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 44 or 54; and A light chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 48 or 58; and The second CAR includes: A heavy chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 73; and The light chain variable region is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 74.

[0085] In another aspect, the present invention includes a method of treating glioblastoma in a subject in need of treatment, comprising administering an effective amount of modified T cells to the subject, said modified T cells comprising: a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGF) RII), where: The first CAR comprises an scFv encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 64, 65, 66, or 69; and The second CAR comprises an scFv encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 70.

[0086] In another aspect, the present invention includes a method of treating glioblastoma in a subject in need of treatment, comprising administering an effective amount of modified T cells to the subject, said modified T cells comprising: a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGF) RII), where: The first CAR contains a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 62, or SEQ ID NO: 63; and The second CAR contains a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 34.

[0087] In some implementations, DN-TGF RII contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 2, or is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 14.

[0088] In another aspect, the present invention includes a method of treating glioblastoma in a subject in need of treatment, comprising administering an effective amount of modified T cells to the subject, the modified T cells comprising a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 76 or 78. Attached Figure Description

[0089] The foregoing and other features and advantages of the present invention will be more fully understood by taking into account the following detailed description of exemplary embodiments in conjunction with the accompanying drawings.

[0090] Figure 1 Schematic diagram of the dominant-negative TGFβ-RII CART-EGFR-IL13Rα2 construct. To inhibit inhibitory signaling pathways, a truncated TGF-β receptor II was generated, lacking an intracellular kinase domain at residue 199as, preventing it from phosphorylating downstream signals. This was integrated into a construct containing parallel CARs targeting EGFR and IL13Rα2 to overcome the dual challenges of antigenic heterogeneity and the suppressive tumor microenvironment.

[0091] Figure 2A-2D TGF 1 is highly expressed in GBM. Figure 2A Based on RNA-seq data from the Cancer Genome Atlas (TCGA) database, TGF-β isolated from glioma histology was analyzed. 1. Expression. The y-axis represents the relative expression level for each case. Figure 2B Based on the high and low TGF levels in the Cancer Genome Atlas (TCGA) database The overall survival curve of the expression group 1, TGF was analyzed by Kaplan-Meier analysis. 1. Calculation of the upper and lower quartiles of the expression. Figure 2C TGF 1. Expression in GBM cell lines. Different glioblastoma cell lines were expressed at 3 x 10⁻⁶ cells per flask. 6 Cells were cultured at a density of 1000 mcg for 3 days. Conditioned medium was collected to test the potential TGF in the glioblastoma cell line. Secretion. PC3 is one of the cell lines that has been shown to have high levels of secretion—compared to the GBM cell line, which was used as a positive control. Figure 2DImmunohistochemical staining of anti-TGF-β1 antibody on tissue sections from NSG mice with intracranial implanted U87 and D270 gliomas. Spleen and cerebral cortex sections were used as positive and negative controls, respectively. Statistically significant differences were calculated using the Kruskal-Wallis test, with **p<0.01, ***p<0.001, and ****p<0.001 as defined.

[0092] Figures 3A-3D : Expression of dnTGF RII construct T-cell blockade immunosuppressive TGF-β Signal transmission. Figure 3A : 806-Hu07-dnTGF RII, 806-Hu07-mCherry and dnTGF A schematic diagram of the RII-M5 CAR construct. 806Hu07mCherry serves as the corresponding control, and dnTGFβRII-M5 is a mesothelin CAR containing dnTGFβRII, which is used as a relevant negative control. Figure 3B Flow cytometry analysis of T cell transduction. T cells were transduced using a lentiviral vector. CAR T cell expression was approximately equal in the three groups. Anti-TGF was used. Antibody screening on CAR T cells revealed TGF receptor II expression. Expression was approximately 35% of CARs with dnTGFβRII. This confirmed successful expression of both CAR and dominant / negative TGFβRII on T cells. Biotinylated protein L was used to stain the upper column for CAR expression and the lower column for TGFβRII expression. Figure 3C D: TGF-β was assessed in each group by intracellular phosphorylation of Smad2 / 3. Signal induction and quantification in (D). dnTGFβRII blocks immunosuppressive TGF in CAR-806-Hu07. Signal transmission.

[0093] Figures 4A-4B Short-term CAR cytotoxicity was not affected by dnTGFβRII in vitro. Figure 4A U87vIII-CBG luciferase target cells and effector T cells were co-cultured for 16 hours with different effector:target ratios in 20 ng / ml hTGFβ1 or in culture medium alone. Figure 4B D270 target cells and effector T cells were co-cultured for 37 hours and screened by axion impedance.

[0094] Figure 5:806Hu07dnTGFβRII CAR T cells showed reduced PD1 expression in in vitro co-culture. Transduced or UTD T cells (2 × 10⁶ cells per well in 100 μL R10 medium) were cultured. 5 (100 cells) and target cells (2 × 10⁶ cells per well in 100 μL R10 medium) 5 T cells were cultured in 96-well round-bottom tissue culture plates at 37°C and 5% CO2 for 20 hours. T cells were collected and stained with CD3+PD1+, and analyzed using MFI.

[0095] Figures 6A-6B Human TGFβ1 does not reduce the activation of 806Hu07dnTGFβ CAR T cells in vitro. Transduced or UTD T cells (2 × 10⁶ cells per well) were added to 100 μL R10 medium. 5 (100 cells) and target cells (2 × 10⁶ cells per well in 100 μL R10 medium) 5 T cells were cultured in 96-well round-bottom tissue culture plates at 37°C and 5% CO2 for 16 hours. T cells were collected and stained with CAR+CD69+ or CAR+CD25+.

[0096] Figure 7 dnTGFβRII promotes CAR T cell proliferation through repeated stimulation. U87vIII tumor cell lines were restimulated weekly with conditioned medium or medium alone. 806-Hu07-dnTGF was present in conditioned medium or medium alone. Comparison of proliferation between RII and 806-Hu07-mCherry CAR T cells.

[0097] Figure 8 Supernatants were collected from the proliferation co-culture plates on days 7, 14, and 21 and then stored at -80°C for future analysis of cytokine secretion. In addition to improved proliferation, 806-Hu07-dnTGFβRII CAR T cells secreted higher levels of effector cytokines, including IFN-γ, TNF-α, IL-12, GM-CSF, and IL-2, than 806-Hu07-mCherry CAR T cells.

[0098] Figure 9: 806-Hu07-dnTGFβRII alters the effector cell phenotype. Figure 9A Weekly in vitro long-term restimulation assays were performed to collect and stain T cells to assess their phenotypic evolution over time, specifically on days 0, 14, and 21. These changes were evaluated in different subsets: central memory (CM) T cells, naive (N) T cells, effector (E) T cells, and effector memory (EM) T cells. Figure 9B The most significant changes occurred in the cohort receiving 20 ng / ml TGF-β1. On day 14, 806-Hu07-dnTGFβRII cells exhibited a significantly more pronounced effector T cell phenotype than 806-Hu07-mCherry CAR T cells (p = 0.0015). Figure 9C On day 21, the final time point, 806-Hu07-dnTGFβRII cells exhibited an enhanced “effect memory” phenotype (p = 0.0009). Figure 9D Comparison of CAR expression in 806-Hu07-dnTGFβRII and 806-Hu07-mCherry CAR T cells. These cells were placed in conditioned medium (+) or medium-only (-) and the comparison was performed at the same time points as described above. CAR expression was normalized to 41% on day 0 to begin subsequent assays.

[0099] Figure 10A-10D The dnTGFβRII construct is safe in vivo. Figure 10A Schematic diagram of the D270-CBG-GFP-NSG mouse model (n=5 per cohort). 5×10 5 Each mouse was treated with subcutaneous implantation of tumor cells and intravenous infusion of CAR-T cells 7 days post-implantation. Tumor burden was managed with BLI for 3–4 days. Figure 10B Measure the weight of the mice every 3-4 days. Figure 10C The tumor area is determined by measuring its length and width using calipers. Figure 10D Tumor regression was compared between mice treated using BLI.

[0100] Figure 11A-11D :806-Hu07-dnTGFβRII CAR T cells enhance the eradication of GBM tumors in vivo. Figure 11A Schematic diagram of the U87vIII CBG-GFP NSG mouse model (n=5 per cohort). 5×10 5 Each mouse was treated with intracranial implantation of tumor cells and intravenous infusion of CAR T cells 8 days post-implantation. Tumor burden was managed with BLI for 3–4 days. Figure 11B Survival curves for treated mice were calculated using a log-rank test, with P-values ​​adjusted for Bonferroni correction for multiple comparisons. Survival rates were plotted using Kaplan-Meier curves based on time to the experimental endpoint. Figure 11C-11D Tumor size was compared between each treated mouse using BLI. Detailed Implementation

[0101] This invention provides compositions and methods comprising modified immune cells or their precursors (e.g., modified T cells), said modified immune cells or their precursors comprising a first chimeric antigen receptor (CAR) capable of binding human IL13Rα2, a second CAR capable of binding epidermal growth factor receptor (EGFR) or its isotype, and dominant-negative TGF. Type II receptor (DN-TGF) R). The provided compositions and methods can be used to treat cancers such as glioma, high-grade astrocytoma, and glioblastoma.

[0102] Transforming growth factor β (TGF) TGFβ—a ligand of TGFβRII and a cytokine with recognized roles in cancer suppression—is highly expressed in GBM and increases after CART-EGFRvIII treatment. Numerous immunosuppressive features in the tumor microenvironment (TME) are attributed to TGFβ, including M2 polarization of macrophages, iTregs, and direct effects on the proliferation, differentiation, and function of naive and effector T cells. Expression of truncated type II TGFβ (TGFβRII), lacking its kinase domain, acts as a dominant-negative TGFβ. Type II receptor (DN-TGF) R) to inhibit TGF in cells Signal transduction. In a prostate cancer xenograft model, DN-TGF was expressed in CAR-containing human T cells using a lentiviral vector. R enhanced the anti-tumor effect in vivo. Considering TGF To mitigate TGF-β-mediated inhibitory activity in GBM, a dominant-negative TGF-β receptor II (dnTGFbRII) was bound to a bicistronic CART-EGFR-IL13Rα2 construct to generate CART-EGFR-IL13Rα2-dnTGFbRII (a three-module construct). Without being bound by theory, it was hypothesized that this approach would more effectively disrupt the observed resistance mechanisms of GBM. The data presented in this paper demonstrate that CART-EGFR-IL13Rα2-dnTGFbRII significantly enhanced T cell proliferation and functional responses, particularly in TGFβ-rich tumor environments. Furthermore, in vivo studies validated the safety and efficacy of dnTGFβRII synergistically with CARs in targeting and eradicating GBM in an NSG mouse model.

[0103] To improve the clinical efficacy of CAR T-guided strategies, it is necessary to overcome adaptive changes in the local tumor microenvironment and address antigenic heterogeneity. This disclosure demonstrates the effectiveness of bicistronic CAR constructs with truncated TGF. Receptor II works effectively. Combining dominant-negative TGFβRII with CAR constructs (including CART-EGFR-IL13Rα2) offers several benefits, including protection against immunosuppressive TGF. Inhibition of signal transduction and reduction of PD-1 expression via immune effector cells. In some embodiments, the DN-TGFβRII receptor enhances the proliferative capacity of CAR T cells in the presence of chronic antigen stimulation without significant side effects and leads to enhanced tumor eradication. In some embodiments, the three-module CAR T construct disclosed herein—comprising TGFβRII CART-EGFR-IL13Rα2—addresses the clinical challenges of antigenic heterogeneity and immunosuppressive TME in GBM.

[0104] It should be understood that the methods described in this disclosure are not limited to the specific methods and experimental conditions disclosed herein, as these methods and conditions can be modified. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0105] Furthermore, unless otherwise stated, the experiments described herein utilize routine molecular and cell biological techniques, as well as immunological techniques, within the scope of the art. These techniques are well known to skilled practitioners and are well explained in the literature. See, for example, Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, NY (1987–2008), with all appendices; Molecular Cloning: A Laboratory Manual (4th edition) by MR Green and J. Sambrook; and Harlow et al., Antibodies: A Laboratory Manual, Chapter 14, Cold Spring Harbor Laboratory, Cold Spring Harbor (2013, 2nd edition).

[0106] A. Definition Unless otherwise defined, scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art. In the event of any potential ambiguity, the definitions provided herein take precedence over any dictionary or external definitions. Unless the context otherwise requires, singular terms shall include plural forms, and plural terms shall include singular forms. Unless otherwise stated, the use of “or” means “and / or”. The use of the term “including” and other forms such as “includes” and “included” is unrestricted.

[0107] In general, the terminology used herein related to cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization is well-known and commonly used in the art. Unless otherwise stated, the methods and techniques provided herein are generally performed according to conventional methods known in the art and as described in the various general and more specific references cited and discussed throughout this specification. Enzymatic reactions and purification techniques are performed according to the manufacturer's instructions, as is commonly done in the art or as described herein. The terminology and laboratory procedures and techniques described herein in conjunction with analytical chemistry, synthetic organic chemistry, and pharmaceutical chemistry are well-known and commonly used in the art. Standard techniques are used in chemical synthesis, chemical analysis, drug preparation, formulation and delivery, and patient treatment.

[0108] To facilitate understanding of this disclosure, the terms are defined as follows.

[0109] The articles “a” and “a kind” used in this article refer to one or more kinds of the grammatical object (i.e., at least one kind). For example, “a kind of element” means one or more kinds of elements.

[0110] As used herein, “about” when referring to a measurable value (such as a quantity, time period, etc.) means including a variation of ±20% or ±10% from a given value, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1%, provided that such variation is suitable for performing the disclosed method.

[0111] As used in this article, “activation” refers to the state of T cells that have been adequately stimulated to induce detectable cell proliferation. Activation can also be associated with induced cytokine production and detectable effector function. The term “activated T cell” refers to a T cell that has undergone cell division, etc.

[0112] As used in this article, “alleviating” a disease means reducing the severity of one or more symptoms of the disease.

[0113] As used herein, the term "antigen" is defined as a molecule that triggers an immune response. This immune response may involve antibody production, or activation of specific immune-active cells, or both. Those skilled in the art will understand that any macromolecule—in fact, all proteins or peptides—can act as an antigen.

[0114] Furthermore, antigens can be derived from recombinant DNA or genomic DNA. Those skilled in the art will understand that any DNA—containing a nucleotide sequence or partial nucleotide sequence encoding a protein that elicits an immune response—is encoded as such by the term "antigen" as used herein. Furthermore, those skilled in the art will understand that antigens do not necessarily have to be encoded solely by the full-length nucleotide sequence of a gene. It is readily apparent that the invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene, and that these nucleotide sequences are arranged in different combinations to elicit a desired immune response. Furthermore, those skilled in the art will understand that antigens do not necessarily have to be encoded by a "gene" at all. It is readily apparent that antigens can be produced, synthesized, or derived from biological samples. Such biological samples may include, but are not limited to, tissue samples, tumor samples, cells, or biological fluids.

[0115] As used in this article, the term "self" refers to any substance originating from the same individual that is subsequently introduced back into that individual.

[0116] "Costimulatory molecules" refer to cognate binding partners on T cells that specifically bind to costimulatory ligands, thereby mediating costimulatory responses on T cells—such as, but not limited to, proliferation. Costimulatory molecules include, but are not limited to, MHC class I molecules, BTLA, and Toll ligand receptors.

[0117] As used in this article, “co-stimulatory signals” refer to signals that bind to primary signals, such as TCR / CD3 linkages, leading to T cell proliferation and / or upregulation or downregulation of key molecules.

[0118] "Disease" is a state of health in an animal in which the animal is unable to maintain homeostasis, and in which the animal's health continues to deteriorate if the disease is not treated. In contrast, "disorder" in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's health is less favorable than it would be if it were not in the state of disorder. Without treatment, disorder does not necessarily lead to a further decline in the animal's health.

[0119] As used in this article, “downregulation” refers to a reduction or elimination of gene expression in one or more genes.

[0120] The terms "effective amount" or "therapeutic effective amount" are used interchangeably herein and refer to the amount of a compound, formulation, material, or composition as described herein that is effective in achieving a specific biological outcome or providing a therapeutic or preventative benefit. Such an outcome may include, but is not limited to, the amount that, when administered to a mammal, elicits a detectable level of immunosuppression or tolerance compared to an immune response detected in the absence of the compositions of the present invention. Immune responses can be readily evaluated by a variety of methods known in the art. Those skilled in the art will understand that the amounts of compositions administered herein are variable and can be readily determined based on a variety of factors, such as the disease or condition being treated, the age and health and physical condition of the mammal being treated, the severity of the disease, the specific compound administered, etc.

[0121] "Encoding" refers to the inherent property of a specific sequence of nucleotides in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of other polymers and macromolecules in biological processes. These polymers and macromolecules possess any of the defined sequences of nucleotides (i.e., rRNA, tRNA, and mRNA) or amino acids, and the biological properties derived from them. Therefore, if the transcription and translation of mRNA corresponding to a gene produces a protein in a cell or other biological system, then that gene encodes a protein. Both the nucleotide sequence equivalent to the mRNA sequence and typically provided in the sequence listing (coding strand) and the non-coding strand used as a template for transcribing a gene or cDNA can be referred to as encoding the protein or other product of that gene or cDNA.

[0122] As used in this article, “endogenous” means any substance that originates from or is produced within an organism, cell, tissue, or system.

[0123] As used herein, the term "epitope" is defined as a small chemical molecule on an antigen that can elicit an immune response (inducing a B cell response and / or a T cell response). An antigen may have one or more epitopes. Most antigens have multiple epitopes; that is, they are multivalent. Generally, an epitope is about 10 amino acids and / or sugars in size. Preferably, an epitope is about 4-18 amino acids, more preferably about 5-16 amino acids, even more preferably 6-14 amino acids, more preferably about 7-12 amino acids, and most preferably about 8-10 amino acids. Those skilled in the art will understand that, generally speaking, the overall three-dimensional structure of the molecule, rather than the specific linear sequence of the molecule, is the primary criterion for antigen specificity and thus for distinguishing one epitope from another. Based on this disclosure, the peptides used in this invention can be epitopes.

[0124] As used herein, the term “exogenous” means any substance introduced from or produced outside an organism, cell, tissue, or system.

[0125] As used herein, the term "expansion" refers to an increase in number, such as an increase in the number of T cells. In one embodiment, the number of expanded T cells in vitro is increased relative to the number originally present in the culture. In another embodiment, the number of expanded T cells in vitro is increased relative to the number of other cell types in the culture. As used herein, the term "in vitro" refers to cells that have been removed from a living organism (e.g., a human) and multiplied outside that organism (e.g., in a culture dish, test tube, or bioreactor).

[0126] As used herein, the term “expression” is defined as the transcription and / or translation of a sequence driven by a promoter of a specific nucleotide sequence.

[0127] "Expression vector" refers to a vector containing a recombinant polynucleotide that includes an expression control sequence operatively linked to a nucleotide sequence to be expressed. The expression vector contains sufficient cis-acting elements for expression; other elements for expression may be supplied by the host cell or in an in vitro expression system. Expression vectors include all expression vectors known in the art, such as clomids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., Sendai virus, lentivirus, retrovirus, adenovirus, and adeno-associated virus) incorporating recombinant polynucleotides.

[0128] As used herein, “identity” refers to the identity of subunit sequences between two polymer molecules, particularly between two amino acid molecules, such as two polypeptide molecules. Two amino acid sequences are identical when they have the same residues at the same positions; for example, if each of two polypeptide molecules has a position occupied by arginine, then they are identical at that position. In alignments, the identity or degree of identical residues at the same positions of two amino acid sequences is often expressed as a percentage. The identity between two amino acid sequences is a direct function of the number of matched or identical positions; for example, if half the positions in two sequences (e.g., five positions in a ten-amino acid-long polymer) are identical, then the two sequences are 50% identical; if 90% of the positions (e.g., nine out of ten) are matched or identical, then the two amino acid sequences are 90% identical.

[0129] As used in this article, the term "immune response" is defined as a cellular response to an antigen that occurs when lymphocytes recognize an antigen molecule as a foreign substance and induce the formation of antibodies and / or activation of lymphocytes to remove the antigen.

[0130] The term “immunosuppression” is used in this article to refer to a reduction in the overall immune response.

[0131] "Separated" means altered or removed from its natural state. For example, nucleic acids or peptides that are naturally present in living organisms are not "separated," but the same nucleic acid or peptide that is partially or completely separated from its natural coexisting substance is "separated." Separated nucleic acids or proteins can exist in a substantially purified form or can exist in unnatural environments, such as, for example, host cells.

[0132] As used in this article, "lentivirus" refers to a genus within the family Retroviridae. Among retroviruses, lentiviruses are the only ones capable of infecting non-dividing cells; they can deliver significant amounts of genetic information into the host cell's DNA, making them one of the most efficient gene delivery vectors. HIV, SIV, and FIV are all examples of lentiviruses. Lentiviral vectors provide a means to achieve significant levels of in vivo gene transfer.

[0133] As used herein, the term "modified" refers to an altered state or structure of the molecules or cells of the present invention. Molecules can be modified in a variety of ways, including chemically, structurally, and functionally. Cells can be modified by introducing nucleic acids.

[0134] As used herein, the term "modulation" means mediating a detectable increase or decrease in the level of response in a subject compared to the level of response in a subject where no treatment or compound is present, and / or compared to the level of response in a otherwise identical but untreated subject. The term encompasses disrupting and / or influencing natural signals or responses, thereby mediating a beneficial therapeutic response in a subject (preferably, a human).

[0135] In the context of this invention, the following abbreviations for common nucleic acid bases are used: "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.

[0136] The term "oligonucleotide" usually refers to short polynucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, C, G), this also includes RNA sequences in which "U" replaces "T" (i.e., A, U, C, G).

[0137] Unless otherwise specified, "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate translations of each other and encode the same amino acid sequence. A nucleotide sequence encoding a protein or RNA phrase may also contain introns, provided that the nucleotide sequence encoding that protein may contain one or more introns in some translations.

[0138] Parenteral administration of the immunogen composition includes techniques such as subcutaneous (sc), intravenous (iv), intramuscular (im), intraventricular, intracranial, or intrasternal injection or infusion. In some embodiments, the immunogen composition disclosed herein can be delivered to the CNS via intraventricular administration (e.g., using an Ommaya catheter).

[0139] As used herein, the term "polynucleotide" is defined as a nucleotide chain. Furthermore, nucleic acids are polymers of nucleotides. Therefore, as used herein, nucleic acids and polynucleotides are interchangeable. Those skilled in the art have general knowledge that nucleic acids are polynucleotides that can be hydrolyzed into monomeric "nucleotides." Monomeric nucleotides can be hydrolyzed into nucleosides. As used herein, polynucleotides include, but are not limited to, all nucleic acid sequences obtained by any means available in the art—non-limitingly including recombinant means, i.e., cloning nucleic acid sequences from recombinant libraries or cell genomes using common cloning techniques and PCR, and by synthetic means.

[0140] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably and refer to compounds consisting of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can comprise a protein or peptide sequence. A polypeptide includes any peptide or protein containing two or more amino acids linked together by peptide bonds. As used herein, the term refers to both short chains (also commonly referred to in the art as, for example, peptides, oligopeptides, and oligomers) and longer chains (commonly referred to in the art as proteins, which come in many types). “Polypeptide” includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, etc. Polypeptides include native peptides, recombinant peptides, synthetic peptides, or combinations thereof.

[0141] As used herein, the term "specifically binding" for antibodies refers to an antibody that recognizes a specific antigen but substantially does not recognize or bind to other molecules in a sample. For example, an antibody that specifically binds to an antigen from one species also binds to that antigen from one or more species. However, such cross-species reactivity does not itself change the antibody class to specific. In another instance, an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. However, such cross-reactivity does not itself change the antibody class to specific. In some cases, the terms "specific binding" or "specifically binding" can be used with respect to the interaction of an antibody, protein, or peptide with a second chemical substance, meaning that the interaction depends on the presence of a specific structure on that chemical substance (e.g., an antigenic determinant or epitope); for example, an antibody recognizes and binds to a specific protein structure, rather than generally recognizing and binding to proteins. If the antibody is specific to epitope "A", the presence of a molecule containing epitope A (or free, unlabeled A) in a reaction containing labeled "A" and the antibody will reduce the amount of labeled A bound to the antibody.

[0142] The term "stimulus" refers to a primary response induced by the binding of a stimulating molecule (e.g., the TCR / CD3 complex) to its associated ligand, thereby mediating a signal transduction event—such as, but not limited to, signal transduction via the TCR / CD3 complex. Stimuli can mediate altered expression of certain molecules, such as downregulation of TGF-β and / or reorganization of the cytoskeleton.

[0143] "Stimulating molecule," as used in this article, refers to a molecule on T cells that specifically binds to an associated stimulant ligand present on antigen-presenting cells.

[0144] As used herein, “stimulatory ligand” refers to a ligand that, when present on antigen-presenting cells (e.g., aAPCs, dendritic cells, B cells, etc.), can specifically bind to associated binding partners on T cells (referred to herein as “stimulatory molecules”), thereby mediating the primary response of T cells, including but not limited to activation, initiation of an immune response, and proliferation. Stimulatory ligands are well known in the art and encompass, in particular, MHC class I molecules loaded with peptides, anti-CD3 antibodies, hyperagonist anti-CD28 antibodies, and hyperagonist anti-CD2 antibodies.

[0145] The term "object" is intended to include a living organism (e.g., a mammal) in which an immune response can be elicited. As used herein, "object" or "patient" can be a human or a non-human mammal. Non-human mammals include, for example, livestock and pets such as sheep, cattle, pigs, dogs, cats, and rodents. Preferably, the object is a human.

[0146] "Target site" or "target sequence" refers to a nucleic acid sequence that defines the portion of the nucleic acid in which a binding molecule can specifically bind under conditions sufficient to allow binding to occur. In some embodiments, the target sequence refers to a genomic nucleic acid sequence that defines the portion of the nucleic acid in which a binding molecule can specifically bind under conditions sufficient to allow binding to occur.

[0147] As used herein, the term "T cell receptor" or "TCR" refers to a complex of membrane proteins that participate in T cell activation in response to antigen presentation. The TCR is responsible for recognizing antigens that bind to the major histocompatibility complex molecule. The TCR consists of heterodimers of α and β chains, but in some cells, it consists of γ and δ (γ / δ) chains. The TCR can exist in both α / β and γ / δ forms, which are structurally similar but differ in anatomical location and function. Each chain consists of two extracellular domains: a variable domain and a constant domain. In some embodiments, the TCR can be modified on any cell containing the TCR, including, for example, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, and γδ T cells.

[0148] As used in this article, the term "therapeutic" refers to treatment and / or prevention. Therapeutic effects are achieved through the suppression, relief, or eradication of the disease state.

[0149] A "graft" refers to a biocompatible lattice or donor tissue, organ, or cell to be transplanted. Examples of grafts include, but are not limited to, skin cells or tissue, bone marrow, and solid organs such as the heart, pancreas, kidneys, lungs, and liver. A graft can also refer to any material to be given to the host. For example, a graft can refer to nucleic acids or proteins.

[0150] As used herein, the terms “transfected,” “transformed,” or “transduced” refer to the process by which exogenous nucleic acids are transferred or introduced into host cells. “Transfected,” “transformed,” or “transduced” cells are cells that have been transfected, transformed, or transduced with exogenous nucleic acids. Cells include primary target cells and their progeny.

[0151] "Treating" a disease, as used in this article, means reducing the frequency or severity of at least one sign or symptom of a disease or disorder experienced by the subject.

[0152] A "vector" is a composition of substances containing isolated nucleic acids that can be used to deliver those isolated nucleic acids into cells. Numerous vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "vector" includes autonomously replicating plasmids or viruses. The term should also be interpreted as including non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as, for example, polylysine compounds, liposomes, etc. Examples of viral vectors include, but are not limited to, Sendai virus vectors, adenovirus vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, etc.

[0153] Scope: Throughout this disclosure, various aspects of the invention may be presented in a scope format. It should be understood that the scope format description is for convenience and brevity only and should not be construed as a rigid limitation on the scope of the invention. Therefore, the scope description should be considered as having specifically disclosed all possible sub-ranges and individual numerical values ​​within that range. For example, a scope description such as 1 to 6 should be considered as having specifically disclosed sub-ranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., and individual numbers within that range, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the width of the scope.

[0154] B. Chimeric antigen receptor This invention provides a chimeric antigen receptor (CAR) capable of binding to IL13Rα2 and / or epidermal growth factor receptor (EGFR) or its isotype. The CAR of this invention binds to dominant-negative TGF. Type II receptor (DN-TGF) The CAR is used in conjunction with IL13Rα2. In some embodiments, the CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain capable of binding IL13Rα2. In some embodiments, the CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain capable of binding EGFR or its isotype. Compositions and methods for modifying immune cells or their precursors—such as modified T cells (containing the CAR)—are also provided. Thus, in some embodiments, the immune cells have been genetically modified to express the CAR. Nucleic acid encoding the CAR, a vector encoding the nucleic acid, and modified cells (e.g., modified T cells) containing the CAR, the vector, or the nucleic acid are also provided.

[0155] The target CAR of the present invention comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain capable of binding IL13Rα2 and / or epidermal growth factor receptor (EGFR). The target CAR of the present invention may optionally include a hinge domain. Therefore, the target CAR of the present invention comprises an antigen-binding domain, a hinge domain, a transmembrane domain, and an intracellular domain capable of binding IL13Rα2 and / or epidermal growth factor receptor (EGFR).

[0156] The antigen-binding domain can be operatively linked to other domains of the CAR, such as a transmembrane domain or an intracellular domain, both of which are described elsewhere herein, for expression in cells. In one embodiment, a first nucleic acid sequence encoding the antigen-binding domain is operatively linked to a second nucleic acid sequence encoding the transmembrane domain, and further operatively linked to a third nucleic acid sequence encoding the intracellular domain.

[0157] The antigen-binding domain described herein can be combined with any transmembrane domain described herein, any intracellular or cytoplasmic domain described herein, or any other domain described herein that can be included in the CAR of this invention. The CAR of this invention may also include the hinge domain described herein. The CAR of this invention may also include the spacer domain as described herein. In some embodiments, each of the antigen-binding domain, transmembrane domain, and intracellular domain is separated by a linker.

[0158] In some embodiments, the CAR can bind human IL13Rα2. In some embodiments, the CAR can bind canine IL13Rα2. In some embodiments, the CAR can bind both canine and human IL13Rα2.

[0159] In one embodiment, the CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain capable of binding to human IL13Rα2, wherein the antigen-binding domain comprises a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence TKYGVH (SEQ ID NO: 1), HCDR2 comprises the amino acid sequence GVKWAGGSTDYNSALMS (SEQ ID NO: 3), and HCDR3 comprises the amino acid sequence DHRDAMDY (SEQ ID NO: 4); and / or a light chain variable region comprising three light chain complementarity-determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASLSVSSTYLH (SEQ ID NO: 5), LCDR2 comprises the amino acid sequence STSNLAS (SEQ ID NO: 6), and LCDR3 comprises the amino acid sequence HQYHRSPLT (SEQ ID NO: 7).

[0160] In another embodiment, the CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain capable of binding IL13Rα2, wherein the antigen-binding domain comprises: a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence SRNGMS (SEQ ID NO: 12), HCDR2 comprises the amino acid sequence TVSSGGSYIYYADSVKG (SEQ ID NO: 13), and HCDR3 comprises the amino acid sequence QGTTALATRFFDV (SEQ ID NO: 15); and a light chain variable region comprising three light chain complementarity-determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence KASQDVGTAVA (SEQ ID NO: 16), LCDR2 comprises the amino acid sequence SASYRST (SEQ ID NO: 17), and LCDR3 comprises the amino acid sequence QHHYSAPWT (SEQ ID NO: 18).

[0161] Tolerable variations of the CAR sequence will be known to those skilled in the art. For example, in some embodiments, the CAR comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with any amino acid sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 12, 13, 14, 15, 16, 17, or 18.

[0162] In some embodiments, the CAR capable of binding IL13Rα2 comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen-binding domain comprises: a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 8; and / or a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 9.

[0163] In some embodiments, the CAR capable of binding IL13Rα2 comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen-binding domain comprises: a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 19; and a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 20.

[0164] In some embodiments, the CAR capable of binding IL13Rα2 comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen-binding domain comprises an scFv, the scFv comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 10, 11, 21, or 22.

[0165] In some embodiments, the CAR capable of binding IL13Rα2 comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 23 or SEQ ID NO: 24 or SEQ ID NO: 42 or SEQ ID NO: 43 or SEQ ID NO: 52 or SEQ ID NO: 53 or SEQ ID NO: 62 or SEQ ID NO: 63 or SEQ ID NO: 75.

[0166] In some implementations, CAR can bind to GBM stem cells.

[0167] In another embodiment, the CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain capable of binding to an epidermal growth factor receptor (EGFR) or an isotype thereof, wherein the antigen-binding domain comprises: a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence GYSITSDFAWN (SEQ ID NO: 25), HCDR2 comprises the amino acid sequence GYISYSGNTRYNPSLK (SEQ ID NO: 26), and HCDR3 comprises the amino acid sequence VTAGRGFPYW (SEQ ID NO: 27); and a light chain variable region comprising three light chain complementarity-determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence HSSQDINSNIG (SEQ ID NO: 28), LCDR2 comprises the amino acid sequence HGTNLDD (SEQ ID NO: 29), and LCDR3 comprises the amino acid sequence VQYAQFPWT (SEQ ID NO: 30).

[0168] In another embodiment, the CAR capable of binding EGFR or its isotype comprises an antigen-binding domain, the antigen-binding structure comprising a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 31; and / or a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 32.

[0169] In another embodiment, the CAR capable of binding EGFR or its isotype comprises an antigen-binding domain, the antigen-binding structure comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 33 or 71.

[0170] In another embodiment, the CAR capable of binding EGFR or its isotype comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 35 or 75.

[0171] Antigen-binding domain The antigen-binding domain of a CAR is an extracellular region of the CAR used to bind specific target antigens, including proteins, carbohydrates, and glycolipids. In some embodiments, the antigen-binding domain can bind IL13Rα2. In some embodiments, the antigen-binding domain can bind human IL13Rα2. In some embodiments, the antigen-binding domain can bind canine IL13Rα2. In some embodiments, the antigen-binding domain can bind both human and canine IL13Rα2. In some embodiments, the antigen-binding domain can bind EGFR or its isotype. In some embodiments, the antigen-binding domain can bind an EGFR isotype selected from wild-type EGFR (wtEGFR), mutant EGFR, and EGFR... A289V EGFR A289D EGFR A289T EGFR A289T EGFR R108K EGFR R108G EGFR G598V EGFR D126Y EGFR C628F EGFR R108K / A289V EGFR R108K / D126Y EGFR A289V / G598V EGFR A289V / C628F and EGFR variant II, or any combination thereof.

[0172] In some embodiments, the antigen-binding domain includes a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 8. In some embodiments, the antigen-binding domain includes a light chain variable region comprising the amino acid sequence of SEQ ID NO: 9. In some embodiments, the antigen-binding domain includes a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 19. In some embodiments, the antigen-binding domain includes a light chain variable region comprising the amino acid sequence of SEQ ID NO: 20.

[0173] In some embodiments, the antigen-binding domain comprises: a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1, HCDR2 comprises the amino acid sequence of SEQ ID NO: 3, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 4; and a light chain variable region comprising three light chain complementarity-determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 5, LCDR2 comprises the amino acid sequence of SEQ ID NO: 6, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 7.

[0174] In some embodiments, the antigen-binding domain includes a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 12, HCDR2 comprises the amino acid sequence of SEQ ID NO: 13, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 14; and a light chain variable region comprising three light chain complementarity-determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 16, LCDR2 comprises the amino acid sequence of SEQ ID NO: 17, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 18.

[0175] In some embodiments, the antigen-binding domain includes a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 12, HCDR2 comprises the amino acid sequence of SEQ ID NO: 13, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 15; and a light chain variable region comprising three light chain complementarity-determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 16, LCDR2 comprises the amino acid sequence of SEQ ID NO: 17, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 18.

[0176] In some embodiments, the antigen-binding domain is selected from full-length antibodies or their antigen-binding fragments, Fab, single-chain variable region fragments (scFv), or single-domain antibodies. In some embodiments, the antigen-binding domain comprises an scFv capable of binding IL13Rα2. In some embodiments, the antigen-binding domain comprises the amino acid sequence of SEQ ID NO: 10. In some embodiments, the antigen-binding domain comprises the amino acid sequence of SEQ ID NO: 11. In some embodiments, the antigen-binding domain comprises the amino acid sequence of SEQ ID NO: 21. In some embodiments, the antigen-binding domain comprises the amino acid sequence of SEQ ID NO: 22.

[0177] In some embodiments, the antigen-binding domain is selected from full-length antibodies or their antigen-binding fragments, Fab, single-chain variable region fragments (scFv), or single-domain antibodies. In some embodiments, the antigen-binding domain includes an scFv capable of binding IL13Rα2.

[0178] Tolerable variations in the antigen-binding domain sequence will be known to those skilled in the art. For example, in some embodiments, the antigen-binding domain comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with any of the amino acid sequences shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11.

[0179] Permissible variations in the antigen-binding domain sequence will be known to those skilled in the art. For example, in some embodiments, the antigen-binding domain comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 97%, at least 98%, or at least 99% sequence identity with any of the amino acid sequences shown in SEQ ID NO: 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22.

[0180] The antigen-binding domain may include any domain that binds to an antigen and may include, but is not limited to, monoclonal antibodies, polyclonal antibodies, synthetic antibodies, human antibodies, humanized antibodies, non-human antibodies, and any fragments thereof. In some embodiments, the antigen-binding domain may partially include a mammalian antibody or a fragment thereof. The choice of the antigen-binding domain may depend on the type and number of antigens present on the surface of the target cell.

[0181] In some embodiments, the antigen-binding domain is selected from antibodies, antigen-binding fragments (Fab), and single-chain variable region fragments (scFv). In some embodiments, the IL13Rα2 binding domain of the present invention is selected from IL13Rα2-specific antibodies, IL13Rα2-specific Fab, and IL13Rα2-specific scFv. In one embodiment, the IL13Rα2 binding domain is an IL13Rα2-specific antibody. In one embodiment, the IL13Rα2 binding domain is an IL13Rα2-specific Fab. In one embodiment, the IL13Rα2 binding domain is an IL13Rα2-specific scFv.

[0182] As used herein, the term "single-chain variable region fragment" or "scFv" is a fusion protein of the variable regions of the heavy chain (VH) and light chain (VL) of an immunoglobulin (e.g., mouse or human) that covalently links to form a VH:VL heterodimer. The heavy chain (VH) and light chain (VL) are either directly coupled or coupled via a linker encoding a peptide that links the N-terminus of the VH to the C-terminus of the VL, or vice versa. In some embodiments, the antigen-binding domain (e.g., the IL13Rα2 binding domain) comprises an scFv with a VH–linker–VL configuration from the N-terminus to the C-terminus. In some embodiments, the antigen-binding domain comprises an scFv with a VL–linker–VH configuration from the N-terminus to the C-terminus. Those skilled in the art will be able to select a suitable configuration for use in this invention.

[0183] Linkers are typically enriched with glycine for flexibility and with serine or threonine for solubility. Linkers can connect heavy chain variable regions and light chain variable regions of extracellular antigen-binding domains. Non-limiting examples of linkers are disclosed in Shen et al., Anal. Chem. 80(6):1910-1917 (2008) and WO 2014 / 087010 (the contents of which are hereby incorporated herein by reference in their entirety). Various linker sequences are known in the art, and non-limitingly include glycine-serine (GS) linkers such as (GS)n, (GSGGS)n (SEQ ID NO: 86), (GGGS)n (SEQ ID NO: 87), and (GGGGS)n (SEQ ID NO: 88), where n represents an integer at least 1. Exemplary linker sequences may comprise amino acid sequences, and non-limitingly include GGSG (SEQ ID NO: 89), GGSGG (SEQ ID NO: 90), GGSG (SEQ ID NO: 91), GGSGG (SEQ ID NO: 92), GGGSG (SEQ ID NO: 93), GSSSG (SEQ ID NO: 94), GGGGS (SEQ ID NO: 95), GGGGSGGGGGGSGGG (SEQ ID NO: 68), etc. Those skilled in the art will be able to select suitable linker sequences for use in this invention. In one embodiment, the antigen-binding domain of the present invention comprises a heavy chain variable region (VH) and a light chain variable region (VL), wherein VH and VL are separated by a linker sequence having the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO: 68), which can be encoded by the nucleic acid sequence ggtggcggtggctcgggcggtggtgggtcgggtggcggcggatct (SEQ ID NO: 96).

[0184] Despite the removal of the constant region and the introduction of linkers, scFv proteins retain the specificity of the original immunoglobulins. As described by Huston et al. (Proc. Nat. Acad. Sci. USA, 85:5879-5883, 1988), single-chain Fv polypeptide antibodies can be expressed from nucleic acids containing sequences encoding VH and VL. See also U.S. Patent Nos. 5,091,513, 5,132,405, and 4,956,778; and U.S. Patent Publications Nos. 20050196754 and 20050196754. Antagonistic scFvs with inhibitory activity have been described (see, for example, Zhao et al., Hyrbidoma (Larchmt) 2008 27(6):455-51; Peter et al., J Cachexia Sarcopenia Muscle 2012 August 12; Shieh et al., J Imunol2009 183(4):2277-85; Giomarelli et al., Thromb Haemost 2007 97(6):955-63; Fife et al., J Clin Invst 2006 116(8):2252-61; Brocks et al., Immunotechnology 1997 3(3):173-84; Moosmayer et al., Ther Immunol 1995 2(10:31-40)). Agitatoric scFvs with stimulatory activation have been described (see, for example, Peter et al., J Bioi Chem 2003 25278(38):36740-7; Xie et al., Nat Biotech 1997 15(8):768-71; Ledbetter et al., Crit Rev Immunol 1997 17(5-6):427-55; Ho et al., BioChim Biophys Acta 2003 1638(3):257-66).

[0185] As used herein, “Fab” refers to a fragment of an antibody structure that binds to an antigen but is monovalent and does not have an Fc region. For example, an antibody digested by papain produces two Fab fragments and one Fc fragment (e.g., the heavy (H) chain constant region; the Fc region that does not bind to an antigen).

[0186] As used herein, “F(ab′)2” refers to an antibody fragment produced by digesting a whole IgG antibody with pepsin, wherein the fragment has two antigen-binding (ab′) (bivalent) regions, each of which contains two separate amino acid chains. The portion of the H chain and the light (L) chain linked by S-S bonds are used to bind the antigen, and the remaining H chain portion is linked together. An F(ab′)2 fragment can be divided into two separate Fab′ fragments.

[0187] In some embodiments, the antigen-binding domain may be derived from the same species in which the CAR is ultimately used. For example, when used in humans, the antigen-binding domain of the CAR may comprise a human antibody or a fragment thereof. In some embodiments, the antigen-binding domain may be derived from a different species in which the CAR is ultimately used. For example, when used in humans, the antigen-binding domain of the CAR may comprise a mouse antibody or a fragment thereof.

[0188] In some embodiments, the CAR of this disclosure may have affinity for one or more target antigens on one or more target cells. In some embodiments, the CAR may have affinity for one or more target antigens on target cells. In these embodiments, the CAR is a bispecific CAR or a multispecific CAR. In some embodiments, the CAR includes one or more target-specific binding domains that confer affinity for one or more target antigens. In some embodiments, the CAR includes one or more target-specific binding domains that confer affinity for the same target antigen. For example, a CAR containing one or more target-specific binding domains with affinity for the same target antigen may bind to different epitopes of the target antigen. When multiple target-specific binding domains are present in the CAR, the binding domains may be arranged in tandem and may be separated by linker peptides. For example, in a CAR containing two target-specific binding domains, the binding domains are covalently linked to each other on a single polypeptide chain via oligomeric or multimeric linkers, Fc hinge regions, or membrane hinge regions.

[0189] Transmembrane domain The CAR of the present invention may include a transmembrane domain connecting the antigen-binding domain of the CAR to the intracellular domain of the CAR. The transmembrane domain of the target CAR is a region capable of crossing the plasma membrane of a cell (e.g., an immune cell or its precursor). The transmembrane domain is used for insertion into the cell membrane (e.g., a eukaryotic cell membrane). In some embodiments, the transmembrane domain is inserted between the antigen-binding domain and the intracellular domain of the CAR.

[0190] In some embodiments, the transmembrane domain is naturally associated with one or more of the domains in the CAR. In some embodiments, the transmembrane domain may be selectively modified or modified by substitution of one or more amino acids to prevent such a domain from binding to the transmembrane domains of the same or different surface membrane proteins, thereby minimizing interactions with other members of the receptor complex.

[0191] The transmembrane domain can be derived from a natural or synthetic source. In the case of a natural source, the domain can originate from any membrane-binding or transmembrane protein, such as a type I transmembrane protein. In the case of a synthetic source, the transmembrane domain can be any artificial sequence that facilitates the insertion of the CAR into the cell membrane, such as an artificial hydrophobic sequence. Specific examples of transmembrane domains used in this invention include, without limitation, transmembrane domains derived from (i.e., comprising at least one or more of) the following transmembrane regions: α, β, or ζ chains of T cell receptors; CD28, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, or transmembrane domains derived from suicidal immunoglobulin-like receptors (KIRs). In one embodiment, the transmembrane domain comprises a transmembrane domain of CD8. In one embodiment, the transmembrane domain of CD8 is a transmembrane domain of CD8α.

[0192] In some embodiments, the transmembrane domain may be synthetic, in which case it will primarily consist of hydrophobic residues such as leucine and valine. Preferably, a triplet of phenylalanine, tryptophan, and valine is found at each end of the synthetic transmembrane domain.

[0193] The transmembrane domains described herein can be combined with any antigen-binding domains described herein, any intracellular domains described herein, or any other domains described herein that may be included in the target CAR.

[0194] In some embodiments, the transmembrane domain further includes a hinge region. The CAR of the present invention may also include a hinge region. The hinge region of a CAR is a hydrophilic region located between the antigen-binding domain and the transmembrane domain. In some embodiments, this domain facilitates appropriate protein folding with respect to the CAR. The hinge region is an optional component of the CAR. The hinge region may include domains selected from: the Fc fragment of an antibody, the hinge region of an antibody, the CH2 region of an antibody, the CH3 region of an antibody, an artificial hinge sequence, or a combination thereof. Examples of hinge regions, without limitation, include the CD8a hinge, an artificial hinge consisting of a polypeptide of up to three glycine residues (Gly), and the CH1 and CH3 domains of IgG (such as human IgG4).

[0195] In some embodiments, the target CAR of this disclosure includes a hinge region connecting an antigen-binding domain to a transmembrane domain, which in turn connects to an intracellular domain. The hinge region preferably supports the antigen-binding domain in recognizing and binding to target antigens on target cells (see, for example, Hudecek et al., Cancer Immunol. Res. (2015)3(2): 125-135). In some embodiments, the hinge region is a flexible domain, thus allowing the antigen-binding domain to have a specific structure and density for optimally recognizing target antigens on cells (e.g., tumor cells) (Hudecek et al., see above). The flexibility of the hinge region allows it to adopt a variety of different conformations.

[0196] In some embodiments, the hinge region is an immunoglobulin heavy chain hinge region. In some embodiments, the hinge region is a receptor-derived hinge region polypeptide (e.g., a CD8-derived hinge region).

[0197] The length of the hinge region can be from 4 amino acids to about 50 amino acids, for example, from about 4 aa to about 10 aa, from about 10 aa to about 15 aa, from about 15 aa to about 20 aa, from about 20 aa to about 25 aa, from about 25 aa to about 30 aa, from about 30 aa to about 40 aa, or from about 40 aa to about 50 aa. In some embodiments, the length of the hinge region can be greater than 5 aa, greater than 10 aa, greater than 15 aa, greater than 20 aa, greater than 25 aa, greater than 30 aa, greater than 35 aa, greater than 40 aa, greater than 45 aa, greater than 50 aa, greater than 55 aa, or more.

[0198] Suitable hinge regions can be easily selected and can have any number of suitable lengths, such as 1 amino acid (e.g., Gly) to 20 amino acids, 2 amino acids to 15 amino acids, 3 amino acids to 12 amino acids, including 4 amino acids to 10 amino acids, 5 amino acids to 9 amino acids, 6 amino acids to 8 amino acids, or 7 amino acids to 8 amino acids, and can be 1, 2, 3, 4, 5, 6, or 7 amino acids. Suitable hinge region lengths can be greater than 20 amino acids (e.g., 30, 40, 50, 60, or more amino acids).

[0199] For example, the hinge region includes glycine polymers (G). n Glycine-serine polymers (including, for example, (GS)) n (GSGGS) n (SEQ ID NO: 86) and (GGGS) n (SEQ ID NO: 87), where n is an integer of at least 1), glycine-alanine polymers, alanine-serine polymers, and other flexible linkers known in the art. Glycine polymers and glycine-serine polymers can be used; both Gly and Ser are relatively unstructured and therefore can act as neutral tethers between these components. Glycine polymers can be used; glycine achieves significantly more φ-ψ (phi-psi) space than homogeneous alanine and is much less restricted than residues with longer side chains (see, for example, Scheraga, Rev. Computational. Chem. (1992) 2: 73-142). The exemplary hinge region may contain an amino acid sequence, including but not limited to GGSG (SEQ ID NO: 89), GGSGG (SEQ ID NO: 90), GGSG (SEQ ID NO: 91), GGSGG (SEQ ID NO: 92), GGGSG (SEQ ID NO: 93), GSSSG (SEQ ID NO: 94), etc.

[0200] In some embodiments, the hinge region is the immunoglobulin heavy chain hinge region. The amino acid sequence of the immunoglobulin hinge region is known in the art; see, for example, Tan et al., Proc. Natl. Acad. Sci. USA (1990) 87(1):162-166; and Huck et al., Nucleic Acids Res. (1986) 14(4): 1779-1789. As a non-limiting example, the immunoglobulin hinge region may include one of the following amino acid sequences: DKTHT (SEQ ID NO: 74); CPCC (SEQ ID NO: 98); CPEPKSCDTPPPCPR (SEQ ID NO: 99) (see, for example, Glaser et al., J. Biol. Chem. (2005) 280:41494-41503); ELKTPLGDTTHT (SEQ ID NO: 100); KSCDKTHTCP (SEQ ID NO: 101); KCCVDCP (SEQ ID NO: 102); KYGPPCP (SEQ ID NO: 103); EPKSCDKTHTCPPCP (SEQ ID NO: 104) (human IgG1 hinge); ERKCCVECPPCP (SEQ ID NO: 105) (human IgG2 hinge); ELKTPLGDTTHTCPRCP (SEQ ID NO: 106) (human IgG3 hinge); SPNMVPHAHHAQ (SEQ ID NO: 74); IDNO: 107) (human IgG4 hinge); etc.

[0201] The hinge region may contain the amino acid sequence of the hinge region of human IgG1, IgG2, IgG3, or IgG4. In one embodiment, the hinge region may contain one or more amino acid substitutions and / or insertions and / or deletions compared to the wild-type (naturally occurring) hinge region. For example, His229 of the human IgG1 hinge may be substituted with Tyr, such that the hinge region contains the sequence EPKSCDKTYTCPPCP (SEQ ID NO: 104); see, for example, Yan et al., J. Biol. Chem. (2012) 287:5891-5897. In one embodiment, the hinge region may contain an amino acid sequence derived from human CD8, or a variant thereof.

[0202] Intracellular domains The CAR of the present invention further comprises an intracellular domain. In some embodiments, the intracellular domain comprises a co-stimulatory signal transduction domain and an intracellular signal transduction domain. The intracellular domain of the CAR is responsible for the activation of at least one of the effector functions of the cell expressing the CAR (e.g., an immune cell). The intracellular domain transduces effector function signals and directs the cell (e.g., an immune cell) to perform its specific function, such as damaging and / or destroying target cells.

[0203] Examples of intracellular domains used in this invention include, but are not limited to, cytoplasmic portions of surface receptors, co-stimulatory molecules and any molecules that act in unison to initiate signal transduction in T cells, as well as any derivatives or variants of these elements and any synthetic sequences having the same functional capability.

[0204] Examples of intracellular domains include, without limitation, the ζ chain of the T cell receptor complex or any homologue thereof, such as the η chain, FcsRIγ and β chains, MB1 (Iga) chain, B29 (Ig) chain, human CD3 ζ chain, CD3 polypeptides (Δ, δ, and ε), syk family tyrosine kinases (Syk, ZAP 70, etc.), src family tyrosine kinases (Lck, Fyn, Lyn, etc.), and other molecules involved in T cell transduction, such as CD2, CD5, and CD28. In one embodiment, the intracellular signaling domain may be the human CD3 ζ chain, FcyRIII, FcsRI, the cytoplasmic tail region of the Fc receptor, a cytoplasmic receptor carrying an immune receptor tyrosine activation motif (ITAM), and combinations thereof.

[0205] In some embodiments, the intracellular signaling domain of the CAR includes any portion of one or more co-stimulatory molecules, such as at least one signaling domain from CD2, CD3, CD8, CD27, CD28, ICOS, 4-1BB, PD-1, any derivative or variant thereof, any synthetic sequence having the same functional capability, and any combination thereof. The intracellular domain comprises a co-stimulatory domain selected from proteins of the TNFR superfamily, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS, NKG2C, and B7-H3 (CD276) or variants thereof, or an intracellular domain derived from a suicide immunoglobulin-like receptor (KIR). In some implementations, the intracellular domain includes a 4-1BB co-stimulatory domain.

[0206] Other examples of intracellular domains include fragments or domains from one or more molecules or receptors, including but not limited to TCR, CD3ζ, CD3γ, CD3δ, CD3ε, CD86, common FcRγ, FcRβ (FcεRIb), CD79a, CD79b, and Fcγ. RIIa, DAP10, DAP12, T cell receptor (TCR), CD8, CD27, CD28, 4-1BB (CD137), OX9, OX40, CD30, CD40, PD-1, ICOS, KIR family proteins, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, ligands that specifically bind to CD83, CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD127, CD160, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7R α, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CDlib, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA- 1. ITGB7, TNFR2, TRANCE / RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (tactile), CEACAM1, CRT AM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, other costimulatory molecules described herein, any derivatives, variants or fragments thereof, any synthetic sequence of costimulatory molecules with the same functional capacity, and any combination thereof.

[0207] Other examples of intracellular domains include, without limitation, intracellular signaling domains of various other immune signaling receptors of several types, including, but not limited to, first-, second-, and third-generation T-cell signaling proteins, including CD3, B7 family co-stimulatory, and tumor necrosis factor receptor (TNFR) superfamily receptors (see, for example, Park and Brentjens, J. Clin. Oncol. (2015) 33(6): 651-653). In addition, intracellular signal transduction domains may include those used by NK cells and NKT cells (see, for example, Hermanson and Kaufman, Front. Immunol. (2015) 6: 195), such as the signal transduction domain of NKp30 (B7-H6) (see, for example, Zhang et al., J. Immunol. (2012) 189(5): 2290-2299), and the signal transduction domains of DAP 12 (see, for example, Topfer et al., J. Immunol. (2015) 194(7): 3201-3212), NKG2D, NKp44, NKp46, DAP10, and CD3z.

[0208] In some embodiments, the intracellular domain comprises an intracellular signaling domain selected from: the human CD3ζ chain (CD3ζ), FcγRIII, FcsRI, the cytoplasmic tail region of the Fc receptor, a cytoplasmic receptor carrying an immune receptor tyrosine-based activation motif (ITAM), TCRζ, FcRγ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d, or variations thereof. In some embodiments, the intracellular domain comprises an intracellular structure of CD3ζ.

[0209] The intracellular domains of the target CARs of the present invention include any desired signaling domains that provide differentiated and detectable signals in response to CAR activation (i.e., activation by an antigen and a dimerizing agent), such as increased production of one or more cytokines by the cell; changes in target gene transcription; changes in protein activity; changes in cell behavior, such as cell death; cell proliferation; cell differentiation; cell survival; regulation of cell signaling responses; etc. In some embodiments, the intracellular domains contain at least one (e.g., one, two, three, four, five, six, etc.) ITAM motifs as described below. In some embodiments, the intracellular domains contain a DAP10 / CD28 type signaling chain. In some embodiments, the intracellular domains are not covalently linked to the membrane-bound CAR, but instead diffuse in the cytoplasm.

[0210] The intracellular domain of the target CAR suitable for this invention comprises an intracellular signaling polypeptide containing an immune receptor tyrosine activation motif (ITAM). In some embodiments, the ITAM motif is repeated twice in the intracellular domain, wherein a first instance and a second instance of the ITAM motif are separated from each other by 6 to 8 amino acids. In one embodiment, the intracellular domain of the target CAR contains three ITAM motifs.

[0211] In some embodiments, the intracellular domains include human immunoglobulin receptors containing immune receptor tyrosine activation motifs (ITAMs), such as, but not limited to, signaling domains of FcγRI, FcγRIIA, FcγRIIC, FcγRIIIA, and FcRL5 (see, for example, Gillis et al., Front. Immunol. (2014) 5:254).

[0212] Suitable intracellular domains can be the ITAM-motif-containing portion of a polypeptide. For example, a suitable intracellular domain can be an ITAM-motif-containing domain from any protein containing an ITAM motif. Therefore, a suitable intracellular domain does not need to contain the entire sequence of the protein from which it originates. Examples of suitable ITAM-motif-containing polypeptides include, but are not limited to: DAP12, FCER1G (Fc ε receptor I γ chain), CD3D (CD3 δ), CD3E (CD3 ε), CD3G (CD3 γ), CD3Z (CD3 ζ), and CD79A (antigen receptor complex-associated protein α chain).

[0213] In one embodiment, the intracellular domain is derived from DAP12 (also known as TYROBP; TYRO protein tyrosine kinase-binding protein; KARAP; PLOSL; DNAX-activating protein 12; KAR-associated protein; TYRO protein tyrosine kinase-binding protein; cytotoxic-activating receptor-associated protein; cytotoxic-activating receptor-associated protein; etc.). In one embodiment, the intracellular domain is derived from FCER1G (also known as FCRG; Fc ε receptor I γ chain; Fc receptor γ chain; fc-ε RI-γ; fcRγ; fceRl γ; high-affinity immunoglobulin ε receptor subunit γ; immunoglobulin E receptor, high-affinity γ chain; etc.). In one embodiment, the intracellular domain is derived from the T-cell surface glycoprotein CD3 δ chain (also known as CD3D; CD3-Δ; T3D; CD3 antigen, δ subunit; CD3δ; CD3d antigen, δ polypeptide (TiT3 complex); OKT3, δ chain; T-cell receptor T3 δ chain; T-cell surface glycoprotein CD3 δ chain; etc.). In one embodiment, the intracellular domain is derived from the T-cell surface glycoprotein CD3 ε chain (also known as CD3e, T-cell surface antigen T3 / Leu-4 ε chain, T-cell surface glycoprotein CD3 ε chain, AI504783, CD3, CD3ε, T3e, etc.). In one embodiment, the intracellular domain is derived from the T-cell surface glycoprotein CD3 γ chain (also known as CD3G, T-cell receptor T3 γ chain, CD3-Γ, T3G, γ polypeptide (TiT3 complex) etc.). In one embodiment, the intracellular domain is derived from the CD3ζ chain of the T-cell surface glycoprotein (also known as CD3Z, T-cell receptor T3ζ chain, CD247, CD3-Z, CD3H, CD3Q, T3Z, TCRZ, etc.). In one embodiment, the intracellular domain is derived from CD79A (also known as the B-cell antigen receptor complex-associated protein α chain; CD79a antigen (immunoglobulin-associated α); MB-1 membrane glycoprotein; ig-α; membrane-bound immunoglobulin-associated protein; surface IgM-associated protein; etc.). In one embodiment, the intracellular domain suitable for the FN3 CAR of this disclosure includes the DAP10 / CD28 signaling chain. In one embodiment, the intracellular domain suitable for the FN3 CAR of this disclosure comprises the ZAP70 polypeptide. In some embodiments, the intracellular domains include cytoplasmic signaling domains of TCR ζ, FcR γ, FcR β, CD3 γ, CD3 δ, CD3 ε, CD5, CD22, CD79a, CD79b, or CD66d. In one embodiment, the intracellular domains in the CAR include the cytoplasmic signaling domain of human CD3 ζ.

[0214] While the entire intracellular domain can often be used, in many cases it is not necessary to use the entire strand. Regarding the use of a truncated portion of the intracellular domain, such a truncated portion can be used in place of the complete strand, provided that it transduces the functional signal of the effector. The intracellular domain contains sufficient content to transduce... Effector Function Arbitrarily truncated portions of the intracellular domains of a signal.

[0215] The intracellular domains described herein can be combined with any antigen-binding domains described herein, any transmembrane domains described herein, or any other domains described herein that can be included in a CAR.

[0216] Table 1: Sequences used in this invention C. Tandem and parallel bispecific CARs This article also provides tandem CARs, cells containing tandem CARs (e.g., T cells), amino acid sequences containing tandem CARs, and nucleic acids encoding tandem CARs. A tandem CAR comprises two antigen-binding domains separated by a linker, connected to a transmembrane domain and an intracellular domain (e.g., 4-1BB and / or CD3ζ). In one aspect, a tandem CAR comprises a first antigen-binding domain (e.g., a first scFv) separated by a linker from a second antigen-binding domain (e.g., a second scFv), followed by a transmembrane domain and an intracellular domain (e.g., 4-1BB and / or CD3ζ). The first and second antigen-binding domains can bind two different antigens. For example, an exemplary tandem CAR comprises a first antigen-binding domain containing an scFv capable of binding IL13Rα2, and a second antigen-binding domain containing an scFv capable of binding EGFR.

[0217] The linker in the tandem CAR connecting the first and second antigen-binding domains can be of various sizes, such as any number of amino acids in length. For example, the linker length can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids. In some embodiments, the tandem CAR comprises a linker of 5 amino acids in length. In some embodiments, the tandem CAR comprises the amino acid sequence of SEQ ID NO: 77 and may be encoded by the nucleotide sequence of SEQ ID NO: 76. In some embodiments, the tandem CAR comprises a linker of 10 amino acids in length. In some embodiments, the tandem CAR comprises the amino acid sequence of SEQ ID NO: 79 and may be encoded by the nucleotide sequence of SEQ ID NO: 78. In some embodiments, the tandem CAR comprises a linker of 15 amino acids in length. In some embodiments, the tandem CAR comprises the amino acid sequence of SEQ ID NO: 81 and may be encoded by the nucleotide sequence of SEQ ID NO: 80.

[0218] This document also provides parallel CARs, cells containing parallel CARs (e.g., T cells), amino acid sequences containing parallel CARs, and nucleic acids encoding parallel CARs. A parallel CAR comprises two separate CARs linked by a cleavable linker (e.g., a 2A linker). For example, an exemplary parallel CAR comprises a first antigen-binding domain (e.g., scFv) linked to a first transmembrane domain and a first intracellular domain, a cleavable linker (e.g., a 2A linker), and a second antigen-binding domain (e.g., scFv) linked to a second transmembrane domain and a second intracellular domain. When the nucleic acid is expressed in a cell, the linker (e.g., the 2A linker) is cleaved, and the two separate CARs are expressed on the cell surface. In some embodiments, the parallel CAR comprises a first CAR capable of binding IL13Rα2 and a second CAR capable of binding EGFR.

[0219] D. Nucleic Acids and Expression Vectors This disclosure provides a first CAR encoding IL13Rα2a, a second CAR encoding EGFR or its homotype, and a dominant-negative TGF-β. Type II receptor (DN-TGF) The nucleic acid of this disclosure may contain any one or more polynucleotide sequences encoding the CAR disclosed herein.

[0220] In one embodiment, the nucleic acid of this disclosure comprises a first polynucleotide sequence encoding a first chimeric antigen receptor (CAR), the first chimeric antigen receptor comprising a first antigen-binding domain, a transmembrane domain, and an intracellular domain that binds to human IL13Rα2; a second polynucleotide sequence encoding a second CAR, the second CAR comprising a second antigen-binding domain, a transmembrane domain, and an intracellular domain that binds to epidermal growth factor receptor (EGFR) or an isotype thereof; and encoding a dominant-negative TGF-β. Type II receptor (DN-TGF) The third polynucleotide sequence of RII.

[0221] In some embodiments, the nucleic acid of this disclosure comprises a first polynucleotide sequence encoding a CAR capable of binding to IL13Rα2 and a dominant-negative TGF-β2 sequence. Type II receptor (DN-TGF) The second polynucleotide sequence of the CAR. In some embodiments, the CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen-binding domain comprises: a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence TKYGVH (SEQ ID NO: 1), HCDR2 comprises the amino acid sequence GVKWAGGSTDYNSALMS (SEQ ID NO: 3), and HCDR3 comprises the amino acid sequence DHRDAMDY (SEQ ID NO: 4); and / or a light chain variable region comprising three light chain complementarity-determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASLSVSSTYLH (SEQ ID NO: 5), LCDR2 comprises the amino acid sequence STSNLAS (SEQ ID NO: 6), and LCDR3 comprises the amino acid sequence HQYHRSPLT (SEQ ID NO: 7).

[0222] In some implementations, the nucleic acid encodes CAR and dominant-negative TGF. Type II receptor (DN-TGF) RII), wherein the antigen-binding domain comprises a heavy chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 44 and / or a light chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 48.

[0223] In some implementations, the nucleic acid encodes CAR and dominant-negative TGF. Type II receptor (DN-TGF) RII), wherein the antigen-binding domain of the CAR is a single-stranded variable region fragment (scFv) encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 64 or 69.

[0224] A nucleic acid is also provided, which contains a chimeric antigen receptor (CAR) encoding an IL13Rα2-binding gene and a dominant-negative TGF-β2. The polynucleotide sequence of the type II receptor (DN-TGFβRII), wherein the CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen-binding domain comprises: a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence SRNGMS (SEQ ID NO: 12), HCDR2 comprises the amino acid sequence TVSSGGSYIYYADSVKG (SEQ ID NO: 13), and HCDR3 comprises the amino acid sequence QGTTALATRFFDV (SEQ ID NO: 15); and a light chain variable region comprising three light chain complementarity-determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence KASQDVGTAVA (SEQ ID NO: 16), LCDR2 comprises the amino acid sequence SASYRST (SEQ ID NO: 17), and LCDR3 comprises the amino acid sequence QHHYSAPWT (SEQ ID NO: 18).

[0225] In some implementations, the nucleic acid encodes CAR and dominant-negative TGF. Type II receptor (DN-TGF) RII), wherein the antigen-binding domain of the CAR comprises a heavy chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 54; and / or a light chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 58.

[0226] In some implementations, the nucleic acid encodes CAR and dominant-negative TGF. Type II receptor (DN-TGF) RII), wherein the antigen-binding domain of the CAR is a single-stranded variable region fragment (scFv) encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 65 or 66.

[0227] In another aspect, this disclosure provides a nucleic acid comprising a CAR encoding an IL13Rα2-binding gene and a dominant-negative TGF-β2. Type II receptor (DN-TGF) The CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen-binding domain comprises: a heavy chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 44; and a light chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 48.

[0228] In another aspect, this disclosure provides a nucleic acid comprising a CAR encoding a CAR capable of binding to IL13Rα2 and a dominant-negative TGFβ type II receptor (DN-TGF). The CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen-binding domain comprises: a heavy chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 54; and a light chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 58.

[0229] In another aspect, the present invention provides a nucleic acid comprising a first polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 62, or SEQ ID NO: 63, and encoding DN-TGF. The second polynucleotide sequence of RII.

[0230] In some implementations, DN-TGF RII contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2.

[0231] A nucleic acid is also provided, comprising a first polynucleotide sequence encoding a CAR capable of binding to epidermal growth factor receptor (EGFR) or an isotype thereof, and a sequence encoding a dominant-negative TGF. Type II receptor (DN-TGF) The second polynucleotide sequence of RII).

[0232] In some implementations, the nucleic acid encodes CAR and dominant-negative TGF. Type II receptor (DN-TGF) (RII), wherein the antigen-binding domain of the CAR includes a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 31; and / or a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 32.

[0233] In some implementations, the nucleic acid encodes CAR and dominant-negative TGF. Type II receptor (DN-TGF) RII), wherein the antigen-binding domain is scFv, and the scFv contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 33 or 71.

[0234] In some implementations, the nucleic acid encodes CAR and dominant-negative TGF. Type II receptor (DN-TGF) RII), wherein the CAR contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 35 or 75.

[0235] In some implementations, DN-TGF RII contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2.

[0236] Also provided is a nucleic acid comprising a first polynucleotide sequence encoding a first CAR capable of binding to IL13Rα2, a second polynucleotide sequence encoding a second CAR capable of binding to epidermal growth factor receptor (EGFR) or its isotype, and encoding a dominant-negative TGF. Type II receptor (DN-TGF) The third polynucleotide sequence of the RII, wherein the first and second CARs each contain an antigen-binding domain, a transmembrane domain and an intracellular domain.

[0237] In some embodiments, the antigen-binding domain of the first CAR includes a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence TKYGVH (SEQ ID NO: 1), HCDR2 contains the amino acid sequence GVKWAGGSTDYNSALMS (SEQ ID NO: 3), and HCDR3 contains the amino acid sequence DHRDAMDY (SEQ ID NO: 4); and a light chain variable region comprising three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence TASLSVSSTYLH (SEQ ID NO: 5), LCDR2 contains the amino acid sequence STSNLAS (SEQ ID NO: 6), and LCDR3 contains the amino acid sequence HQYHRSPLT (SEQ ID NO: 7).

[0238] In some embodiments, the antigen-binding domain of the first CAR includes a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence SRNGMS (SEQ ID NO: 12), HCDR2 contains the amino acid sequence TVSSGGSYIYYADSVKG (SEQ ID NO: 13), and HCDR3 contains the amino acid sequence QGTTALATRFFDV (SEQ ID NO: 15); and a light chain variable region comprising three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence KASQDVGTAVA (SEQ ID NO: 16), LCDR2 contains the amino acid sequence SASYRST (SEQ ID NO: 17), and LCDR3 contains the amino acid sequence QHHYSAPWT (SEQ ID NO: 18).

[0239] In some embodiments, the antigen-binding domain of the first CAR includes a heavy chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 44; and / or a light chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 48.

[0240] In some embodiments, the antigen-binding domain of the first CAR includes a heavy chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 54; and / or a light chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 58.

[0241] In some embodiments, the antigen-binding domain of the first CAR is a single-stranded variable region fragment (scFv) encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 138, SEQ ID NO: 64, SEQ ID NO: 65, or SEQ ID NO: 66.

[0242] In some embodiments, the first polynucleotide sequence comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 52 or SEQ ID NO: 53, SEQ ID NO: 62 or SEQ ID NO: 63.

[0243] In some embodiments, the antigen-binding domain of the second CAR includes a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence GYSITSDFAWN (SEQ ID NO: 25), HCDR2 contains the amino acid sequence GYISYSGNTRYNPSLK (SEQ ID NO: 26), and HCDR3 contains the amino acid sequence VTAGRGFPYW (SEQ ID NO: 27); and a light chain variable region comprising three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence HSSQDINSNIG (SEQ ID NO: 28), LCDR2 contains the amino acid sequence HGINLDD (SEQ ID NO: 143) or HGTNLDD (SEQ ID NO: 29), and LCDR3 contains the amino acid sequence VQYAQFPWT (SEQ ID NO: 30).

[0244] In some embodiments, the antigen-binding domain of the second CAR includes a heavy chain variable region and / or a light chain variable region, wherein the heavy chain variable region contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 95%, 96%, 97%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 31, and the light chain variable region contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 32. In some embodiments, the antigen-binding domain of the second CAR includes a heavy chain variable region and / or a light chain variable region, wherein the heavy chain variable region contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 95%, 96%, 97%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 8, and the light chain variable region contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 9. In some embodiments, the antigen-binding domain of the second CAR includes a heavy chain variable region and / or a light chain variable region, wherein the heavy chain variable region contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 95%, 96%, 97%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 19, and the light chain variable region contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 20.

[0245] In some embodiments, the antigen-binding domain of the second CAR is a single-stranded variable region fragment (scFv) encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 70 or SEQ ID NO: 71. In some embodiments, the antigen-binding domain of the second CAR is a single-stranded variable region fragment (scFv) comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 64.

[0246] In some embodiments, the second polynucleotide sequence comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 34. In some embodiments, the second polynucleotide sequence encodes an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 35 or SEQ ID NO: 75.

[0247] Also provided is a nucleic acid comprising a first polynucleotide sequence encoding a first CAR capable of binding to IL13Rα2, a second polynucleotide sequence encoding a CAR capable of binding to epidermal growth factor receptor (EGFR) or an isotype thereof, and a dominant-negative TGF-β2. Type II receptor (DN-TGF) The third polynucleotide sequence of the first CAR (RII), wherein the first CAR contains a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence TKYGVH (SEQ ID NO: 1) or SRNGMS (SEQ ID NO: 12), HCDR2 contains the amino acid sequence GVKWAGGSTDYNSALMS (SEQ ID NO: 3) or TVSSGGSYIYYADSVKG (SEQ ID NO: 13), and HCDR3 contains the amino acid sequence DHRDAMDY (SEQ ID NO: 4) or QGTTALATRFFDV (SEQ ID NO: 15); and a light chain variable region comprising three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence TASLSVSSTYLH (SEQ ID NO: 5) or KASQDVGTAVA (SEQ ID NO: 16), and LCDR2 contains the amino acid sequence STSNLAS (SEQ ID NO: 6) or SASYRST (SEQ ID NO: 15). 17), and LCDR3 contains the amino acid sequence HQYHRSPLT (SEQ ID NO: 7) or QHHYSAPWT (SEQ ID NO: 18); and the second CAR contains a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence GYSITSDFAWN (SEQ ID NO: 25), HCDR2 contains the amino acid sequence GYISYSGNTRYNPSLK (SEQ ID NO: 26), and HCDR3 contains the amino acid sequence VTAGRGFPYW (SEQ ID NO: 27); and a light chain variable region comprising three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence HSSQDINSNIG (SEQ ID NO: 28), LCDR2 contains the amino acid sequence HGINLDD (SEQ ID NO: 143) or HGTNLDD (SEQ ID NO: 29), and LCDR3 contains the amino acid sequence VQYAQFPWT (SEQ ID NO: 30).

[0248] Also provided is a nucleic acid comprising a first polynucleotide sequence encoding a first CAR capable of binding IL13Rα2, a second polynucleotide sequence encoding a second CAR capable of binding epidermal growth factor receptor (EGFR) or its isotype, and encoding a dominant-negative TGF. Type II receptor (DN-TGF) The third polynucleotide sequence of the first CAR (RII), wherein the first CAR comprises a heavy chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 44 or 54; and a light chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 48 or 58; and the second CAR comprises a heavy chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 73; and a light chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 74.

[0249] Also provided is a nucleic acid comprising a first polynucleotide sequence encoding a first CAR capable of binding to IL13Rα2, a second polynucleotide sequence encoding a second CAR capable of binding to epidermal growth factor receptor (EGFR) or its isotype, and encoding a dominant-negative TGF. Type II receptor (DN-TGF) The third polynucleotide sequence of the first CAR (RII), wherein the first CAR comprises a single-stranded variable region fragment (scFv) encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 69, 64, 65, or 66; and the second CAR comprises a single-stranded variable region fragment (scFv) encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 70.

[0250] Also provided is a nucleic acid comprising a first polynucleotide sequence encoding a first CAR capable of binding IL13Rα2, a second polynucleotide sequence encoding a second CAR capable of binding epidermal growth factor receptor (EGFR) or its isotype, and encoding a dominant-negative TGF. Type II receptor (DN-TGF) The third polynucleotide sequence of SEQ ID NO: 34, wherein the first polynucleotide sequence comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 52 or 53 or 62 or 63; and the second polynucleotide sequence comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 34.

[0251] In some embodiments, the nucleic acids of this disclosure are provided for, for example, the production of CARs as described herein in mammalian cells. In some embodiments, the nucleic acids of this disclosure provide the amplification of nucleic acids encoding CARs.

[0252] In some embodiments, the nucleic acid of this disclosure comprises a first polynucleotide sequence and a second polynucleotide sequence. In some embodiments, the nucleic acid of this disclosure comprises a first polynucleotide sequence, a second polynucleotide sequence, and a third polynucleotide sequence. The first and second polynucleotide sequences can be separated by a linker, and / or the second and third polynucleotide sequences can be separated by a linker. The linker used in this disclosure allows multiple proteins to be encoded by the same nucleic acid sequence (e.g., a polycistronic or bicistronic sequence), which is translated into a polyprotein that dissociates into individual protein components. For example, a linker used in the nucleic acid of this disclosure comprising an IL13Rα2 CAR coding sequence and an EGFR CAR coding sequence allows IL13Rα2CAR and EGFR CAR to be translated into a polyprotein that dissociates into individual CARs. In some embodiments, the nucleic acid comprises a 5' to 3' first polynucleotide sequence, a linker, and a second polynucleotide sequence. In some embodiments, the nucleic acid comprises a 5' to 3' second polynucleotide sequence, a linker, and a first polynucleotide sequence. In some embodiments, the nucleic acid comprises a 5' to 3' first polynucleotide sequence, a linker, a second polynucleotide sequence, a linker, and a third polynucleotide sequence.

[0253] In some embodiments, the linker contains a nucleic acid sequence encoding an internal ribosome entry site (IRES). As used herein, "internal ribosome entry site" or "IRES" refers to an element that facilitates direct entry of an internal ribosome into a start codon (such as ATG) of a protein-coding region, thereby inducing cap-independent translation of the gene. Various internal ribosome entry sites are known to those skilled in the art and include, without limitation, IRES derived from viral or cellular mRNA sources, such as immunoglobulin heavy chain binding protein (BiP); vascular endothelial growth factor (VEGF); fibroblast growth factor 2; insulin-like growth factor; translation initiation factor eIF4G; yeast transcription factors TFIID and HAP4; and IRES derived from, for example, cardiogenic viruses, rhinoviruses, foot-and-mouth disease viruses, HCV, Friendmurine leukemia virus (FrMLV), and Moloney murine leukemia virus (MoMLV). Those skilled in the art will be able to select a suitable IRES for use in this invention.

[0254] In some embodiments, the linker comprises a nucleic acid sequence encoding a self-cleaving peptide. As used herein, a "self-cleaving peptide" or "2A peptide" refers to an oligopeptide that allows multiple proteins to be encoded as a multiprotein, which dissociates into component proteins post-transcriptionally. The use of the term "self-cleaving" is not intended to imply a proteolytic cleavage reaction. Various self-cleaving peptides or 2A peptides are known to those skilled in the art and are not limited to those found in members of the Picornaviridae virus family, such as foot-and-mouth disease virus (FMDV), ERAVO, TaV, and PTV-1; and cardiogenic viruses such as Theilovirus and encephalocarditis virus. 2A peptides derived from FMDV, ERAVO, PTV-1, and TaV are referred to herein as "F2A," "E2A," "P2A," and "T2A," respectively. Those skilled in the art will be able to select suitable self-cleaving peptides for use in this invention.

[0255] In some embodiments, the linker further comprises a nucleic acid sequence encoding a furin cleavage site. Frin is a ubiquitously expressed protease located in the trans-Golgi apparatus and processed prior to the secretion of a protein precursor. Frin cleaves at the COOH-terminus of its common recognition sequence. Various furin common recognition sequences (or “furin cleavage sites”) are known to those skilled in the art and include, without limitation, Arg-X1-Lys-Arg or Arg-X1-Arg-Arg, X2-Arg-X1-X3-Arg (SEQ ID NO: 108), and Arg-X1-X1-Arg, such as Arg-Gln-Lys-Arg (SEQ ID NO: 109), where X1 is any naturally occurring amino acid, X2 is Lys or Arg, and X3 is Lys or Arg. Those skilled in the art will be able to select a suitable furin cleavage site for use in this invention.

[0256] In some embodiments, the linker comprises a nucleic acid sequence encoding a combination of a furin cleavage site and a 2A peptide. Examples, without limitation, include: linkers comprising nucleic acid sequences encoding furin and F2A, linkers comprising nucleic acid sequences encoding furin and E2A, linkers comprising nucleic acid sequences encoding furin and P2A, and linkers comprising nucleic acid sequences encoding furin and T2A. Those skilled in the art will be able to select suitable combinations for use in this invention. In such embodiments, the linker may further comprise a spacer region sequence between the furin and the 2A peptide. Various spacer region sequences are known in the art and, without limitation, include glycine-serine (GS) spacers, such as (GS)n, (GSGGS)n (SEQ ID NO: 86), and (GGGS)n (SEQ ID NO: 87), where n represents an integer at least 1. Exemplary spacer sequences may comprise amino acid sequences, including, but not limited to, GGSG (SEQ ID NO: 89), GGSGG (SEQ ID NO: 90), GGSG (SEQ ID NO: 91), GGSGG (SEQ ID NO: 92), GGGSG (SEQ ID NO: 93), GSSSG (SEQ ID NO: 94), etc. Those skilled in the art will be able to select suitable spacer sequences for use in this invention.

[0257] In some embodiments, the nucleic acids of this disclosure can be operatively linked to transcriptional control elements, such as promoters and enhancers. Suitable promoter and enhancer elements are known to those skilled in the art.

[0258] In some implementations, the nucleic acid encoding the exogenous CAR is operatively linked to a promoter. In some implementations, the promoter is the phosphoglycerate kinase-1 (PGK) promoter.

[0259] For expression in bacterial cells, suitable promoters include, but are not limited to, lacI, lacZ, T3, T7, gpt, λP, and trc. For expression in eukaryotic cells, suitable promoters include, but are not limited to, light chain and / or heavy chain immunoglobulin gene promoter elements and enhancer elements; cytomegalovirus immediate early promoters; herpes simplex virus thymidine kinase promoters; early and late SV40 promoters; promoters present in long terminal repeat sequences from retroviruses; mouse metallothionein-I promoters; and various tissue-specific promoters known in the art. Suitable reversible promoters (including reversibly inducible promoters) are known in the art. Such reversible promoters can be isolated from and derived from a variety of organisms, such as eukaryotes and prokaryotes. Modification of reversible promoters derived from a first organism for use in a second organism (e.g., first prokaryote and second eukaryote, first eukaryote and second prokaryote, etc.) is well known in the art. Such reversible promoters and systems based on such reversible promoters also include other control proteins, including but not limited to alcohol-regulated promoters (e.g., alcohol dehydrogenase I (alcA) gene promoter, promoters responsive to alcohol transactivation protein (A1cR), etc.), tetracycline-regulated promoters (e.g., promoter systems including Tet Activators, TetON, TetOFF, etc.), steroid-regulated promoters (e.g., rat glucocorticoid receptor promoter system, human estrogen receptor promoter system, retinoid promoter system, thyroid promoter system, ecdysone promoter system, mifepristone promoter system, etc.), metal-regulated promoters (e.g., metallothionein promoter system, etc.), pathogenesis-related regulatory promoters (e.g., salicylic acid-regulated promoters, ethylene-regulated promoters, benzothiadiazole-regulated promoters, etc.), and temperature-regulated promoters (e.g., heat shock-inducible promoters). promoters (e.g., HSP-70, HSP-90, soybean heat shock promoters, etc.), photoregulated promoters, synthetic inducible promoters, etc.

[0260] In some implementations, the promoter is a CD8 cell-specific promoter, a CD4 cell-specific promoter, a neutrophil-specific promoter, or an NK cell-specific promoter. For example, the CD4 gene promoter can be used; see, for example, Salmon et al., Proc. Natl. Acad. Sci. USA (1993) 90:7739; and Marodon et al. (2003) Blood 101:3416. As another example, the CD8 gene promoter can be used. NK cell-specific expression can be achieved by using the NcrI (p46) promoter; see, for example, Eckelhart et al., Blood (2011) 117:1565.

[0261] For expression in yeast cells, suitable promoters are constitutive promoters, such as the ADH1 promoter, PGK1 promoter, ENO promoter, PYK1 promoter, etc.; or regulated promoters, such as the GAL1 promoter, GAL10 promoter, ADH2 promoter, PHOS promoter, CUP1 promoter, GALT promoter, MET25 promoter, MET3 promoter, CYC1 promoter, HIS3 promoter, ADH1 promoter, PGK promoter, GAPDH promoter, ADC1 promoter, TRP1 promoter, URA3 promoter, LEU2 promoter, ENO promoter, TP1 promoter, and AOX1 (e.g., for Pichia pastoris). The selection of suitable vectors and promoters is entirely within the skill of a person skilled in the art. Suitable promoters for prokaryotic host cells include, but are not limited to, the phage T7 RNA polymerase promoter; the trp promoter; the lac operon promoter; heterozygous promoters, such as the lac / tac heterozygous promoter, the tac / trc heterozygous promoter, the trp / lac promoter, the T7 / lac promoter; the trc promoter; the tac promoter, etc.; the araBAD promoter; and in vivo regulatory promoters, such as the ssaG promoter or related promoters (see, for example, U.S. Patent Publication No. 20040131637), the pagC promoter (Pulkkinen and Miller, J. Bacteriol. (1991) 173(1):86-93; Alpuche-Aranda et al., Proc. Natl. Acad. Sci. USA (1992) 89(21): 10079-83), and the nirB promoter (Harborne et al. Mol. Micro. (1992)). 6:2805-2813, etc. (see, for example, Dunstan et al., Infect. Immun. (1999) 67:5133-5141; McKelvie et al., Vaccine (2004) 22:3243-3255; and Chatfield et al., Biotechnol. (1992) 10:888-892); σ70 promoters, for example, common σ70 promoters (see, for example, GenBank accession numbers AX798980, AX798961, and AX798183); stationary promoters, for example, dps promoters, spv promoters, etc.; promoters derived from pathogenicity island SPI-2 (see, for example, WO96 / 17951); actA promoters (see, for example, Shetron-Rama et al., Infect. Immun.).(2002) 70:1087-1096); rpsM promoter (see, e.g., Valdivia and Falkow Mol. Microbiol. (1996). 22:367); tet promoter (see, e.g., Hillen, W. and Wissmann, A. (1989) In Saenger, W. and Heinemann, U. (eds), Topics in Molecular and Structural Biology, Protein--Nucleic Acid Interaction. Macmillan, London, UK, Vol. 10, pp. 143-162); SP6 promoter (see, e.g., Melton et al., Nucl. Acids Res. (1984) 12:7035); etc. Suitable strong promoters for prokaryotes (such as Escherichia coli) include, but are not limited to, Trc, Tac, T5, T7, and PΛ. Non-limiting examples of operons used for bacterial host cells include the lactose promoter operon (where the LacI repressor changes conformation upon contact with lactose, thus preventing the Lad repressor from binding to the operon), the tryptophan promoter operon (where the TrpR repressor has a conformation that binds to the operon when complexed with tryptophan; and a conformation that does not bind to the operon in the absence of tryptophan), and the tac promoter operon (see, for example, deBoer et al., Proc. Natl. Acad. Sci. USA (1983) 80:21-25).

[0262] Other examples of suitable promoters include the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strongly constitutive promoter sequence capable of driving high-level expression of any polynucleotide sequence operatively linked to it. Other constitutive promoter sequences may also be used, including but not limited to the simian virus 40 (SV40) early promoter, the mouse mammary tumor virus (MMTV) or human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, the MoMuLV promoter, the avian leukosis virus promoter, the Epstein-Barr virus immediate early promoter, the Rous sarcoma virus promoter, the EF-1α promoter, and human gene promoters, such as, but not limited to, the actin promoter, the myoglobin promoter, the hemoglobin promoter, and the creatine kinase promoter. Furthermore, the invention is not limited to the use of constitutive promoters. Inducible promoters are also considered as part of this invention. The use of inducible promoters provides a molecular switch capable of enabling or disabling the expression of a polynucleotide sequence operably linked to the inducible promoter (when such expression is desired). Examples of inducible promoters include, but are not limited to, metallothionine promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters. In some embodiments, the invention provides a polynucleotide sequence encoding a CAR (e.g., a bispecific CAR, a tandem CAR, a parallel CAR, etc.) comprising an inducible promoter. In some embodiments, the inducible promoter promotes the expression of the operably linked sequence (e.g., a CAR) upon T cell activation. T cells (e.g., CAR T cells) can be modified with this promoter to express designed RNA or amino acids.

[0263] In some embodiments, a locus or construct or transgene containing a suitable promoter is irreversibly switched by induction of an induction system. Suitable systems for inducing irreversible switching are well known in the art; for example, irreversible switching can be induced using Cre-lox-mediated recombination (see, for example, Fuhrmann-Benzakein, et al., Proc. Natl. Acad. Sci. USA (2000) 28:e99, the disclosure of which is incorporated herein by reference). Any suitable combination of recombinases, endonucleases, ligases, recombination sites, etc., known in the art can be used to generate an irreversibly switched promoter. The methods, mechanisms, and requirements for performing site-specific recombination described in other parts of this article are well known in the art and can be used to generate irreversibly switched promoters, see, for example, Grindley et al., Annual Review of Biochemistry (2006) 567-605; and Tropp, Molecular Biology (2012) (Jones & Bartlett Publishers, Sudbury, Mass.) (the disclosure of which is incorporated herein by reference).

[0264] In some embodiments, the nucleic acid of this disclosure further comprises a nucleic acid sequence encoding a CAR-inducible expression cassette. In one embodiment, the CAR-inducible expression cassette is used to generate a transgenic polypeptide product released upon CAR signaling. See, for example, Chmielewski and Abken, Expert Opin. Biol. Ther. (2015) 15(8): 1145-1154; and Abken, Immunotherapy (2015) 7(5): 535-544. In some embodiments, the nucleic acid of this disclosure further comprises a nucleic acid sequence encoding a cytokine operatively linked to a T-cell activation response promoter. In some embodiments, the cytokine operatively linked to the T-cell activation response promoter is present on a separate nucleic acid sequence. In one embodiment, the cytokine is IL-12.

[0265] The nucleic acids disclosed herein may be present in expression vectors and / or cloning vectors. Expression vectors may contain selectable markers, replication origins, and other features that provide for the replication and / or maintenance of the vector. Suitable expression vectors include, for example, plasmids, viral vectors, etc. Many suitable vectors and promoters are known to those skilled in the art; many are commercially available for generating recombinant constructs of the target. The following vectors are provided by way of example and should not be construed as limiting in any way: bacterial: pBs, phagescript, PsiX174, pBluescript SK, pBs KS, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene, La Jolla, Calif., USA); pTrc99A, pKK223-3, pKK233-3, pDR540, and pRIT5 (Pharmacia, Uppsala, Sweden). Eukaryotic: pWLneo, pSV2cat, pOG44, PXR1, pSG (Stratagene), pSVK3, pBPV, pMSG, and pSVL (Pharmacia).

[0266] Expression vectors typically have convenient restriction sites near the promoter sequence to allow for the insertion of nucleic acid sequences encoding heterologous proteins. Operable selectable markers may be present in the expression host. Suitable expression vectors include, but are not limited to, viral vectors (e.g., based on viral vectors such as vaccinia virus; poliovirus; adenovirus (see, for example, Li et al., Invest. Opthalmol. Vis. Sci. (1994) 35: 2543-2549; Borras et al., Gene Ther. (1999) 6: 515-524; Li and Davidson, Proc. Natl. Acad. Sci. USA (1995) 92: 7700-7704; Sakamoto et al., H. Gene Ther. (1999) 5: 1088-1097; WO 94 / 12649, WO 93 / 03769; WO 93 / 19191; WO 94 / 28938; WO 95 / 11984 and WO 95 / 00655); adeno-associated virus (see, for example, Ali et al., Hum. Gene Ther. (1998) 9: 81-86, Flannery et al., Proc. Natl. Acad. Sci. USA (1997) 94: 6916-6921; Bennett et al., Invest. Opthalmol. Vis. Sci. (1997) 38: 2857-2863; Jomary et al., Gene Ther. (1997) 4:683-690, Rolling et al., Hum. Gene Ther. (1999) 10: 641-648; Ali et al., Hum. Mol. Genet. (1996) 5: 591-594; Srivastava in WO 93 / 09239, Samulski et al., J. Vir. (1989) 63: 3822-3828; Mendelson et al., Virol. (1988) 166: 154-165; and Flotte et al., Proc. Natl. Acad. Sci. USA (1993) 90: 10613-10617); SV40; herpes simplex virus; human immunodeficiency virus (see, for example, Miyoshi et al., Proc. Natl. Acad. Sci. USA (1997) 94: 10319-23; Takahashi et al., J. Virol.(1999) 73: 7812-7816); retroviral vectors (e.g., murine leukosis virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus); etc.

[0267] Other suitable expression vectors include, for example, but not limited to, lentiviral vectors, gamma retroviral vectors, foamy virus vectors, adeno-associated virus vectors, adenovirus vectors, poxvirus vectors, herpesvirus vectors, engineered hybrid viral vectors, transposon-mediated vectors, etc. Viral vector technology is well known in the art and is described, for example, in Sambrook et al., 2012, *Molecular Cloning: A Laboratory Manual*, Volumes 1–4, Cold Spring Harbor Press, NY, and other virology and molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses.

[0268] In general, a suitable vector contains a replication initiation site that is functional in at least one organism, a promoter sequence, a convenient restriction endonuclease site, and one or more optional markers (e.g., WO 01 / 96584; WO 01 / 29058; and U.S. Patent No. 6,326,193).

[0269] In some embodiments, expression vectors (e.g., lentiviral vectors) can be used to introduce CARs into immune cells or their precursors (e.g., T cells). Therefore, the expression vectors (e.g., lentiviral vectors) of the present invention may contain nucleic acids encoding CARs. In some embodiments, the expression vectors (e.g., lentiviral vectors) will contain other elements that will assist in the functional expression of the CAR encoded therein. In some embodiments, the expression vectors containing nucleic acids encoding CARs further contain a mammalian promoter. In one embodiment, the vector further contains an elongation factor-1-α promoter (EF-1α promoter). The use of the EF-1α promoter can improve the efficiency of downstream transgene expression (e.g., nucleic acid sequences encoding CARs). Physiological promoters (e.g., EF-1α promoters) are unlikely to induce integration-mediated genotoxicity and may disable the ability of retroviral vectors to transform stem cells. Other physiological promoters suitable for vectors (e.g., lentiviral vectors) are known to those skilled in the art and can be incorporated into the vectors of the present invention. In some embodiments, the vectors (e.g., lentiviral vectors) further contain non-essential cis-acting sequences that can provide improved titers and gene expression. A non-restrictive example of a non-essential cis-acting sequence is the central polypurine tract and central termination sequence (cPPT / CTS), which are important for efficient reverse transcription and nuclear importation. Other non-essential cis-acting sequences are known to those skilled in the art and can be incorporated into the vectors of the present invention (e.g., lentiviral vectors). In some embodiments, the vector further comprises post-transcriptional regulatory elements. Post-transcriptional regulatory elements can enhance RNA transcription, enhance transgene expression, and stabilize RNA transcripts. An example of a post-transcriptional regulatory element is the marmot hepatitis virus post-transcriptional regulatory element (WPRE). Therefore, in some embodiments, the vectors of the present invention further comprise WPRE sequences. Various post-transcriptional regulatory elements are known to those skilled in the art and can be incorporated into the vectors of the present invention (e.g., lentiviral vectors). The vectors of the present invention may further comprise other elements, such as rev response elements (RREs) for RNA transport, packaging sequences, and 5' and 3' long terminal repeats (LTRs). The term "long terminal repeat" or "LTR" refers to a domain containing the U3, R, and U5 regions located at the ends of retroviral DNA. LTRs generally provide the functions required for retroviral gene expression (e.g., initiation, startup, and polyadenylation of gene transcripts) and viral replication. In one embodiment, the vector of the present invention (e.g., a lentiviral vector) contains a 3' U3-deficient LTR. Therefore, the vector of the present invention (e.g., a lentiviral vector) may contain any combination of the elements described herein to enhance the efficiency of functional expression of transgenes.For example, the vector of the present invention (e.g., a lentiviral vector) may contain, in addition to the nucleic acid encoding CAR, a WPRE sequence, a cPPT sequence, an RRE sequence, a 5'LTR, and a 3' U3-deleted LTR'.

[0270] The vector of this invention can be a self-inactivating vector. As used herein, the term "self-inactivating vector" refers to a vector in which the 3' LTR enhancing promoter region (U3 region) has been modified (e.g., by deletion or substitution). Self-inactivating vectors prevent viral transcription beyond the first round of viral replication. Therefore, self-inactivating vectors can infect and then integrate into the host genome (e.g., a mammalian genome) in only one pass and cannot be further removed. Thus, self-inactivating vectors significantly reduce the risk of generating replicating viruses.

[0271] In some embodiments, the nucleic acid of the present invention may be RNA, for example, in vitro synthesized RNA. Methods for synthesizing RNA in vitro are known to those skilled in the art; any known method may be used to synthesize RNA comprising a sequence encoding the CAR disclosed herein. Methods for introducing RNA into host cells are known to those skilled in the art. See, for example, Zhao et al., Cancer Res. (2010) 15: 9053. The introduction of RNA comprising a nucleotide sequence encoding the CAR disclosed herein into host cells may be performed in vitro, ex vivo, or in vivo. For example, host cells (e.g., NK cells, cytotoxic T lymphocytes, etc.) may be electroporated in vitro or ex vivo using RNA comprising a nucleotide sequence encoding the CAR disclosed herein.

[0272] To assess the expression of the peptide or a portion thereof, the expression vector to be introduced into cells may also contain a selectable marker gene or a reporter gene, or both, to facilitate the identification and selection of expressing cells from a cell population seeking transfection or infection via a viral vector. In some embodiments, the selectable marker may be carried on a separate DNA fragment and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in host cells. Useful selectable markers include, without limitation, antibiotic resistance genes.

[0273] Reporter genes are used to identify potentially transfected cells and to evaluate the functionality of regulatory sequences. Generally, a reporter gene is a gene encoding a polypeptide that is not present in or expressed by a recipient organism or tissue, and the expression of this polypeptide is indicated by some easily detectable property (e.g., enzyme activity). The expression of the reporter gene is assessed at an appropriate time after DNA is introduced into the recipient cells. Suitable reporter genes may, without limitation, include genes encoding luciferase, β-galactosidase, chloramphenicol acetyltransferase, secretory alkaline phosphatase, or green fluorescent protein genes (e.g., Ui-Tei et al., 2000 FEBS Letters 479: 79-82).

[0274] E. Modified immune cells This invention provides modified immune cells or their precursors (e.g., T cells) comprising a chimeric antigen receptor (CAR) capable of binding IL13Rα2 (e.g., human IL13Rα2), a CAR capable of binding epidermal growth factor receptor (EGFR) or a subtype thereof, and dominant-negative TGF. Type II receptor (DN-TGFβRII). This invention also includes modified immune cells or their precursors, comprising any nucleic acid disclosed herein or any vector disclosed herein.

[0275] One aspect of the invention includes modified immune cells or their precursor cells, comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding epidermal growth factor receptor (EGFR) or its isotype, and dominant-negative TGF. Type II receptor (DN-TGF) RII). The first CAR contains a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs). HCDR1 contains the amino acid sequence TKYGVH (SEQ ID NO: 1) or SRNGMS (SEQ ID NO: 12), HCDR2 contains the amino acid sequence GVKWAGGSTDYNSALMS (SEQ ID NO: 3) or TVSSGGSYIYYADSVKG (SEQ ID NO: 13), and HCDR3 contains the amino acid sequence DHRDAMDY (SEQ ID NO: 4) or QGTTALATRFFDV (SEQ ID NO: 15). The first CAR also contains a light chain variable region comprising three light chain complementarity-determining regions (LCDRs). LCDR1 contains the amino acid sequence TASLSVSSTYLH (SEQ ID NO: 5) or KASQDVGTAVA (SEQ ID NO: 16), LCDR2 contains the amino acid sequence STSNLAS (SEQ ID NO: 6) or SASYRST (SEQ ID NO: 17), and LCDR3 contains the amino acid sequence HQYHRSPLT (SEQ ID NO: 7) or QHHYSAPWT (SEQ ID NO: 18). The second CAR contains a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs). HCDR1 contains the amino acid sequence GYSITSDFAWN (SEQ ID NO: 25), HCDR2 contains the amino acid sequence GYISYSGNTRYNPSLK (SEQ ID NO: 26), and HCDR3 contains the amino acid sequence VTAGRGFPYW (SEQ ID NO: 27). The second CAR also contains a light chain variable region comprising three light chain complementarity-determining regions (LCDRs). LCDR1 contains the amino acid sequence HSSQDINSNIG (SEQ ID NO: 28), LCDR2 contains the amino acid sequence HGINLDD (SEQ ID NO: 143) or HGTNLDD (SEQ ID NO: 29), and LCDR3 contains the amino acid sequence VQYAQFPWT (SEQ ID NO: 30).

[0276] Another aspect of the invention includes modified immune cells or their precursor cells, comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding epidermal growth factor receptor (EGFR) or its isotype, and dominant-negative TGF. Type II receptor (DN-TGF) (RII), wherein the first CAR comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 8 or 19, and the light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 9 or 20. The second CAR comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 31 or SEQ ID NO: 31, SEQ ID NO: 19, or SEQ ID NO: 8, and the light chain variable region comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 32, SEQ ID NO: 9, or SEQ ID NO: 20.

[0277] Modified immune cells or their precursor cells are also provided, comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and dominant-negative TGF. Type II receptor (DN-TGF) RII), wherein the first CAR comprises a single-stranded variable region fragment (scFv) containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 21, or SEQ ID NO: 22; and the second CAR comprises a single-stranded variable region fragment (scFv) containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 33 or SEQ ID NO: 71.

[0278] Modified immune cells or their precursor cells are also provided, comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and dominant-negative TGF. Type II receptor (DN-TGF) RII), wherein the first CAR contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 23 or 24; and the second CAR contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 35 or 75.

[0279] In some implementations, the second CAR can bind to an EGFR isotype selected from wild-type EGFR (wtEGFR), mutant EGFR, and EGFR. A289V EGFR A289D EGFR A289T EGFR A289T EGFR R108K EGFR R108G EGFR G598V EGFR D126Y EGFR C628F EGFR R108K / A289V EGFR R108K / D126Y EGFR A289V / G598V EGFR A289V / C628F and EGFR variant II, or any combination thereof.

[0280] In some embodiments, the cells are modified T cells. In some embodiments, the cells are autologous cells. In some embodiments, the cells are autologous cells obtained from a human subject.

[0281] F. Sources of immune cells In some embodiments, a source of immune cells (e.g., T cells) is obtained from the subject for in vitro manipulation. The source of immune cells for in vitro manipulation may also include, for example, autologous or allogeneic donor blood, umbilical cord blood, or bone marrow. For example, the source of immune cells may be a subject to be treated with the modified immune cells of the present invention, such as the subject's blood, umbilical cord blood, or bone marrow. Non-limiting examples of subjects include humans, dogs, cats, mice, rats, and their transgenic species. Preferably, the subject is a human.

[0282] Immune cells can be obtained from a variety of sources, including blood, peripheral blood mononuclear cells, bone marrow, lymph node tissue, spleen tissue, umbilical cord, lymph, or lymphoid organs. Immune cells are cells of the immune system, such as cells of innate or adaptive immunity, for example, myeloid or lymphoid cells containing lymphocytes, typically T cells and / or NK cells. Other exemplary cells include stem cells, such as pluripotent stem cells and multipotent stem cells, including induced pluripotent stem cells (iPSCs). In some respects, these cells are human cells. For the subject of treatment, these cells can be allogeneic and / or autologous. These cells are generally primary cells, such as those isolated directly from the subject and / or isolated from the subject and frozen.

[0283] In some embodiments, the immune cells are T cells, such as CD8+ T cells (e.g., CD8+ naive T cells, central memory T cells, or effector memory T cells), CD4+ T cells, natural killer T cells (NKT cells), regulatory T cells (Tregs), stem cell memory T cells, lymphoid progenitor cells, hematopoietic stem cells, natural killer cells (NK cells), or dendritic cells. In some embodiments, the cells are monocytes or granulocytes, such as myeloid cells, macrophages, neutrophils, dendritic cells, mast cells, eosinophils, and / or basophils. In one implementation, the target cell is an induced pluripotent stem cell (iPS) or a cell derived from an iPS, such as an iPS cell generated from an object, manipulated to alter (e.g., induce mutations in one or more target genes) or manipulate the expression of one or more target genes, and differentiates into, for example, T cells, such as CD8+ T cells (e.g., CD8+ naive T cells, central memory T cells, or effector memory T cells), CD4+ T cells, stem cell memory T cells, lymphoid progenitor cells, or hematopoietic stem cells.

[0284] In some embodiments, the cells include one or more T cell subsets or other cell types, such as the entire T cell population, CD4+ cells, CD8+ cells, and their subsets, as defined by function, activation state, maturity, differentiation potential, expansion, recycling, localization, and / or persistence, antigen specificity, antigen receptor type, presence in a particular organ or compartment, marker or cytokine secretion profile, and / or degree of differentiation. Among the subtypes and subsets of T cells and / or CD4+ T cells and / or CD8+ T cells are naive T cells (TN), effector T cells (TEFF), memory T cells and their subtypes, such as stem cell memory T cells (TSCM), central memory T cells (TCM), effector memory T cells (TEM), or terminally differentiated effector memory T cells, tumor-infiltrating lymphocytes (TIL), immature T cells, mature T cells, helper T cells, cytotoxic T cells, mucosa-associated inertial T cells (MAIT), naturally occurring and adaptive regulatory T cells (Treg), and helper T cells, such as TH1 cells, TH2 cells, TH3 cells, TH17 cells, TH9 cells, TH22 cells, follicular helper T cells, α / β T cells, and δ / γ T cells. In some embodiments, any number of T cell lines available in the art may be used.

[0285] In some embodiments, the method includes isolating immune cells from a subject, preparing, processing, culturing, and / or engineering them. In some embodiments, the preparation of engineered cells includes one or more culturing and / or preparation steps. The cells used for engineering may be isolated from a sample (such as a biological sample, e.g., a biological sample obtained from or derived from the subject). In some embodiments, the subject from which cells are isolated is a subject suffering from a disease or condition or requiring or to receive cell therapy. In some embodiments, the subject is a person requiring a specific therapeutic intervention (such as adoptive cell therapy in which cells are isolated, processed, and / or engineered). Therefore, the cells in some embodiments are primary cells, e.g., primary human cells. Samples include tissues, fluids, and other samples taken directly from the subject, as well as samples obtained from one or more processing steps, such as isolation, centrifugation, genetic engineering (e.g., transduction with a viral vector), washing, and / or incubation. Biological samples may be samples obtained directly from a biological source or processed samples. Biological samples include, but are not limited to, bodily fluids such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine and sweat, tissue and organ samples, including processed samples derived therefrom.

[0286] In some aspects, the sample from which the cells are derived or isolated is a blood sample or a blood-derived sample, or a product of apheresis or leukocyte extraction, or derived from apheresis or leukocyte extraction. Exemplary samples include whole blood, peripheral blood mononuclear cells (PBMCs), leukocytes, bone marrow, thymus, tissue biopsy, tumors, leukemia, lymphoma, lymph nodes, intestinal-associated lymphoid tissue, mucosa-associated lymphoid tissue, spleen, other lymphoid tissues, liver, lungs, stomach, intestine, colon, kidney, pancreas, breast, bone, prostate, cervix, testes, ovaries, tonsils, or other organs, and / or cells derived therefrom. In the context of cell therapy (e.g., adoptive cell therapy), samples include those from autologous and allogeneic sources.

[0287] In some embodiments, the cells are derived from cell lines, such as T cell lines. In some embodiments, the cells are derived from xenogeneic sources, such as mice, rats, non-human primates, and pigs. In some embodiments, cell isolation includes one or more preparation steps and / or affinity-based cell isolation steps. In some instances, cells are washed, centrifuged, and / or incubated in the presence of one or more reagents to, for example, remove unwanted components, enrich desired components, lyse, or remove cells sensitive to a particular reagent. In some instances, cells are isolated based on one or more properties, such as density, adhesion properties, size, sensitivity, and / or resistance to a particular component.

[0288] In some instances, cells are obtained from the subject's circulating blood, for example, through apheresis or leukocyte extraction. In some aspects, the sample contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, erythrocytes, and / or platelets, and in some aspects, cells other than erythrocytes and platelets. In some embodiments, the blood cells collected from the subject are washed, thereby removing, for example, the plasma fraction and placing the cells in a suitable buffer or medium for subsequent processing steps. In some embodiments, the cells are washed with phosphate-buffered saline (PBS). In some aspects, the washing step is performed by tangential flow filtration (TFF) according to the manufacturer's instructions. In some embodiments, the cells are resuspended in a variety of biocompatible buffers after washing. In some embodiments, components of the blood cell sample are removed and the cells are directly resuspended in a culture medium. In some embodiments, the method includes density-based cell separation methods, such as preparing leukocytes from peripheral blood by lysing erythrocytes and centrifuging via Percoll or Ficoll gradient.

[0289] In one implementation, immune cells from an individual's circulating blood are obtained via apheresis or leukocyte extraction. Apheresis products typically contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, erythrocytes, and platelets. Cells collected via apheresis can be washed to remove the plasma fraction and placed in a suitable buffer or medium, such as phosphate-buffered saline (PBS), or a wash solution that is calcium-deficient and may be magnesium-deficient or may lack numerous (if not all) divalent cations for subsequent processing steps. After washing, the cells can be resuspended in various biocompatible buffers, such as, for example, calcium- and magnesium-free PBS. Alternatively, unwanted components of the apheresis sample can be removed, and the cells can be directly resuspended in a culture medium.

[0290] In some embodiments, the separation method includes separating different cell types based on the expression or presence of one or more specific molecules, such as surface markers (e.g., surface proteins), intracellular markers, or nucleic acids in the cells. In some embodiments, any known separation method based on these markers can be used. In some embodiments, the separation is based on affinity or immunoaffinity. For example, in some aspects, the separation includes the separation of cells and cell populations based on the expression level of one or more markers or one or more markers (typically cell surface markers), for example, by incubation with an antibody or binding chaperone that specifically binds to such a marker, followed by a generally washing step and separation of cells bound to the antibody or binding chaperone from cells not bound to the antibody or binding chaperone.

[0291] This separation step can be based on positive selection, where cells that have bound the reagent are retained for further use; and / or on negative selection, where cells that have not bound the antibody or chaperone are retained. In some instances, both portions are retained for further use. In some aspects, negative selection is particularly useful when there are no antibodies available to specifically identify cell types in a heterologous population, making separation based on a marker expressed by cells other than the desired population optimal. Separation does not need to result in 100% enrichment or depletion of a specific cell population or cells expressing a specific marker. For example, positive selection or enrichment for a specific cell type (such as cells expressing a marker) means increasing the number or percentage of such cells, but does not necessarily result in the complete absence of cells not expressing that marker. Similarly, negative selection, depletion, or exhaustion of a specific cell type (such as cells expressing a marker) means reducing the number or percentage of such cells, but does not necessarily result in the complete removal of all such cells.

[0292] In some instances, multiple rounds of separation steps are performed, where a fraction of one step undergoes a positive or negative selection process followed by another separation step, such as subsequent positive or negative selection. In some instances, a single separation step can simultaneously deplete cells expressing multiple markers, such as by incubating cells with multiple antibodies or binding partners, each antibody or binding partner being specific for the marker targeted by negative selection. Similarly, multiple cell types can be positively selected simultaneously by incubating cells with multiple antibodies or binding partners expressed on multiple cell types.

[0293] In some implementations, one or more T cells in the population are positive for one or more specific markers (such as surface markers). + ) or high-level expression (markers) 高 Cells that are negative for one or more markers (markers) - ) or relatively low levels of expression (markers) 低 The cells are enriched or depleted. For example, in some aspects, specific subsets of T cells, such as cells that are positive for or highly express one or more surface markers, such as CD28+, CD62L+, CCR7+, CD27+, CD127+, CD4+, CD8+, CD45RA+, and / or CD45RO+ T cells, are isolated by positive or negative selection techniques. In some cases, such markers are absent or expressed at relatively low levels in some T cell populations (such as non-memory cells), but present or expressed at relatively high levels in some other T cell populations (such as memory cells). In one embodiment, cells (such as CD8+ cells or T cells, e.g., CD3+ cells) are enriched (i.e., positive selection) and / or depleted (e.g., negative selection) of cells that are positive for or highly express CD45RO, CCR7, CD28, CD27, CD44, CD127, and / or CD62L. In some implementations, cells are enriched or depleted against those positive for or with high surface levels of CD122, CD95, CD25, CD27, and / or IL7-Ra (CD127). In some instances, CD8+ T cells are enriched against cells that are positive for CD45RO (or negative for CD45RA) and positive for CD62L. For example, CD3+, CD28+ T cells can be positively selected using CD3 / CD28 conjugated magnetic beads (e.g., DYNABEADS® M-450 CD3 / CD28 T Cell Expander).

[0294] In some embodiments, T cells are isolated from PBMC samples by negative selection of markers (such as CD14) expressed on non-T cells (such as B cells, monocytes, or other leukocytes). In some aspects, a CD4+ or CD8+ selection step is used to isolate CD4+ helper T cells and CD8+ cytotoxic T cells. Such CD4+ and CD8+ populations can be further subdivided into subpopulations by positive or negative selection of markers expressed or expressed to relatively high levels on one or more naive, memory, and / or effector T cell subsets. In some embodiments, CD8+ cells are further enriched or depleted against naive, central memory, effector memory, and / or central memory stem cells, for example, by positive or negative selection based on surface antigens associated with the respective subpopulations. In some embodiments, central memory T (TCM) cells are enriched to improve efficacy, thereby enhancing long-term survival, expansion, and / or transplantation after administration, which is particularly robust in some respects in such subpopulations. In some implementations, combining TCM-enriched CD8+ T cells with CD4+ T cells further enhances efficacy.

[0295] In some embodiments, memory T cells are present in the CD62L+ and CD62L- subsets of CD8+ peripheral blood lymphocytes. PBMCs can be enriched or depleted for the CD62L-CD8+ and / or CD62L+CD8+ subsets, such as using anti-CD8 antibodies and anti-CD62L antibodies. In some embodiments, the CD4+ T cell population and CD8+ T cell subsets are, for example, subsets enriched for central memory T (TCM) cells. In some embodiments, enrichment of central memory T (TCM) cells is based on positive or high surface expression of CD45RO, CD62L, CCR7, CD28, CD3, and / or CD127; in some aspects, it is based on negative selection of cells expressing or highly expressing CD45RA and / or granzyme B. In some aspects, isolation of the CD8+ population enriched for TCM cells is performed by depleting cells expressing CD4, CD14, and CD45RA and by positive selection or enrichment of cells expressing CD62L. On one hand, enrichment of central memory T (TCM) cells begins with the negative fraction of cells selected based on CD4 expression, which undergoes negative selection based on CD14 and CD45RA expression, and positive selection based on CD62L. In some aspects, these selections are performed simultaneously, while in others, they are performed sequentially in any order. In some aspects, the same CD4 expression-based selection step used to prepare a CD8+ cell population or subset is also used to generate a CD4+ cell population or subset, such that both the positive and negative fractions separated from the CD4-based selection are preserved, and optionally used in subsequent steps of the method after one or more other positive or negative selection steps.

[0296] CD4+ T helper cells are classified into naive cells, central memory cells, and effector cells by identifying cell populations possessing cell surface antigens. CD4+ lymphocytes can be obtained using standard methods. In some embodiments, naive CD4+ T lymphocytes are CD45RO-, CD45RA+, CD62L+, and CD4+ T cells. In some embodiments, central memory CD4+ cells are CD62L+ and CD45RO+. In some embodiments, effector CD4+ cells are CD62L- and CD45RO. In one instance, to enrich CD4+ cells by negative selection, a monoclonal antibody mixture typically contains antibodies against CD14, CD20, CD11b, CD16, HLA-DR, and CD8. In some embodiments, the antibody or binding chaperone is bound to a solid carrier or matrix, such as magnetic beads or paramagnetic beads, to allow for the separation of cells for positive and / or negative selection.

[0297] In some embodiments, cells are incubated and / or cultured prior to or in connection with genetic engineering. The incubation step may include culture, cultivation, stimulation, activation, and / or proliferation. In some embodiments, the composition or cells are incubated in the presence of stimulating conditions or stimulants. Such conditions include those designed to induce cell proliferation, expansion, activation, and / or survival in a population to mimic antigen exposure, and / or to prime cells for genetic engineering (such as for the introduction of recombinant antigen receptors). These conditions may include one or more of the following: specific culture media, temperature, oxygen content, carbon dioxide content, time, reagents such as nutrients, amino acids, antibiotics, ions, and / or stimulating factors (such as cytokines, chemokines, antigens, binding chaperones, fusion proteins, recombinant soluble receptors), and any other reagents designed to activate cells. In some embodiments, the stimulating conditions or reagents include one or more reagents, such as ligands, capable of activating the intracellular signaling domains of the TCR complex. In some aspects, this reagent turns on or initiates the TCR / CD3 intracellular signaling cascade in T cells. Such reagents may include antibodies, such as antibodies specific to TCR components and / or co-stimulatory receptors, for example, anti-CD3, anti-CD28, and / or one or more cytokines bound to a solid carrier (such as beads). Optionally, the scaling-up method may further include the step of adding anti-CD3 and / or anti-CD28 antibodies to the culture medium (e.g., at a concentration of at least about 0.5 ng / mL). In some embodiments, the stimulant includes IL-2 and / or IL-15, for example, an IL-2 concentration of at least about 10 units / mL.

[0298] In another embodiment, T cells are separated from peripheral blood by lysing red blood cells and exhausting monocytes, for example by PERCOLL™ gradient centrifugation. Optionally, T cells can be separated from the umbilical cord. In any case, specific T cell subsets can be further separated using positive or negative selection techniques.

[0299] The umbilical cord blood mononuclear cells isolated in this way can be depleted of cells expressing certain antigens, including but not limited to CD34, CD8, CD14, CD19, and CD56. Depletion of these cells can be achieved using isolated antibodies, biological samples containing antibodies (such as ascites), antibodies bound to a physical carrier, and cell-binding antibodies.

[0300] Enriching T cell populations by negative selection can be achieved using a combination of antibodies targeting surface markers specific to cells selected negatively. A preferred method is cell sorting and / or selection using negative magnetic immunoadhesion or flow cytometry with a mixture of monoclonal antibodies targeting cell surface markers present on negatively selected cells. For example, to enrich CD4 by negative selection... + Cellular monoclonal antibody mixtures typically contain antibodies against CD14, CD20, CD11b, CD16, HLA-DR, and CD8.

[0301] To separate a desired cell population via positive or negative selection, the cell concentration and surface area (e.g., particles, such as beads) can be varied. In some embodiments, it is desirable to significantly reduce the volume of beads and cells mixed together (i.e., increase the cell concentration) to ensure maximum contact between cells and beads. For example, in one embodiment, a concentration of 2 billion cells / ml is used. In another embodiment, a concentration of 1 billion cells / ml is used. In other embodiments, a concentration greater than 100 million cells / ml is used. In other embodiments, cell concentrations of 10 million, 15 million, 20 million, 25 million, 30 million, 35 million, 40 million, 45 million, or 50 million cells / ml are used. In yet another embodiment, cell concentrations of 75 million, 80 million, 85 million, 90 million, 95 million, or 100 million cells / ml are used. In other embodiments, a concentration of 125 million or 150 million cells / ml can be used. Using high concentrations can lead to increased cell yield, cell activation, and cell expansion.

[0302] T cells can also be frozen after a washing step, without the need for monocyte removal. While not wishing to be bound by theory, freezing and subsequent thawing provide a more homogeneous product by removing granulocytes from the cell population and, to some extent, monocytes. After a washing step to remove plasma and platelets, the cells can be suspended in a freezing solution. While numerous freezing solutions and parameters are known in the art and will be useful in this context, in a non-limiting example, one method involves using PBS containing 20% ​​DMSO and 8% human serum albumin, or other suitable cell freezing media. The cells are then frozen to -80°C at a rate of 1°C per minute and stored in the vapor phase of a liquid nitrogen tank. Other methods of controlled freezing can be used, as well as uncontrolled freezing at -20°C or immediately in liquid nitrogen.

[0303] In one embodiment, T cells comprise a population of cells such as peripheral blood mononuclear cells, umbilical cord blood cells, purified T cell populations, and T cell lines. In another embodiment, peripheral blood mononuclear cells comprise a population of T cells. In yet another embodiment, purified T cells comprise a population of T cells.

[0304] In some embodiments, T regulatory cells (Tregs) can be isolated from a sample. The sample may include, but is not limited to, cord blood or peripheral blood. In some embodiments, Tregs are isolated by flow cytometry sorting. Prior to isolation, the sample can be enriched for Tregs by any means known in the art. The isolated Tregs can be cryopreserved and / or expanded before use. Methods for isolating Tregs are described in U.S. Patent Nos. 7,754,482, 8,722,400, and 9,555,105 and U.S. Patent Application No. 13 / 639,927 (the contents of which are incorporated herein by reference in their entirety).

[0305] G. Treatment methods The modified immune cells (e.g., T cells) described herein can be included in compositions for immunotherapy. These compositions may comprise a pharmaceutical composition and also a pharmaceutically acceptable carrier. A therapeutically effective amount of the pharmaceutical composition containing modified T cells can be administered.

[0306] In one aspect, the invention includes a method for treating a disease or condition of a subject, the method comprising administering an effective amount of the modified T cells of the invention to the subject in need. In another aspect, the invention includes a method for treating a disease or condition of a subject, the method comprising administering a pharmaceutical composition comprising an effective amount of the modified T cells of the invention to the subject in need. In yet another aspect, the invention includes a method for adoptive cell transfer therapy, the method comprising administering an effective amount of the modified T cells of the invention to the subject in need.

[0307] Methods of administering immune cells for adoptive cell therapy are known and can be used in combination with the provided methods and compositions. For example, adoptive T-cell therapy methods are described in U.S. Patent Application Publication No. 2003 / 0170238 to Gruenberg et al.; U.S. Patent No. 4,690,915 to Rosenberg; Rosenberg (2011) Nat Rev ClinOncol. 8(10):577-85. See, for example, Themeli et al. (2013) NatBiotechnol. 31(10): 928-933; Tsukahara et al. (2013) Biochem Biophys ResCommun 438(1): 84-9; Davila et al. (2013) PLoS ONE 8(4): e61338. In some embodiments, cell therapy, such as adoptive T-cell therapy, is performed via autologous transfer, wherein cells are isolated from and / or otherwise prepared from the subject receiving the cell therapy, or derived from a sample originating from such a subject. Thus, in some aspects, the cells are derived from the subject (e.g., a patient requiring treatment), and the cells are applied to the same subject after isolation and processing.

[0308] In some embodiments, cell therapy (e.g., adoptive T-cell therapy) is administered via allogeneic transfer, wherein cells are isolated from and / or otherwise prepared from a subject other than the recipient or eventual recipient of the cell therapy (e.g., a first subject). In such embodiments, the cells are then administered to a different subject of the same species, e.g., a second subject. In some embodiments, the first and second subjects are genetically identical. In some embodiments, the first and second subjects are genetically similar. In some embodiments, the second subject expresses the same HLA class or supertype as the first subject.

[0309] In some embodiments, the subject has been treated with a therapeutic agent targeting a disease or condition (e.g., tumor) prior to the administration of the cells or a cell-containing composition. In some aspects, the subject is refractory to or unresponsive to other therapeutic agents. In some embodiments, the subject has a persistent or relapsed disease, for example, following treatment with other therapeutic interventions—including chemotherapy, radiation, and / or hematopoietic stem cell transplantation (HSCT), such as allogeneic HSCT. In some embodiments, the administration is still effective in treating the subject despite the subject's resistance to other therapies.

[0310] In some embodiments, the subject responds to other therapeutic agents, and treatment with those agents reduces the disease burden. In some aspects, the subject initially responds to a therapeutic agent but exhibits a relapse of the disease or condition over time. In some embodiments, the subject does not relapse. In some such embodiments, the subject is identified as being at risk of relapse, such as being at high risk of relapse, and therefore the cells are administered prophylactically to, for example, reduce the likelihood of relapse or prevent relapse. In some aspects, the subject has not previously received treatment with other therapeutic agents.

[0311] In some embodiments, the subject has a persistent or recurrent disease following treatment with other therapeutic interventions—including chemotherapy, radiation, and / or hematopoietic stem cell transplantation (HSCT), such as allogeneic HSCT. In some embodiments, the treatment is still effective even though the subject has developed resistance to other therapies.

[0312] The modified immune cells of this invention can be administered to animals, preferably mammals, and even more preferably humans, to treat cancer. Furthermore, the cells of this invention can be used to treat any cancer-related condition, particularly a cell-mediated immune response against one or more tumor cells, where treatment or ablation of the disease is desired. Types of cancer to be treated with the modified cells or pharmaceutical compositions of this invention include carcinoma, germ cell tumors, and sarcomas, and certain leukemias or lymphomas, benign and malignant tumors, and malignant tumors such as sarcomas, carcinomas, and melanomas. Other exemplary cancers include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, thyroid cancer, etc. Cancer can be a non-solid tumor (such as a hematologic malignancy) or a solid tumor. Adult tumors / cancers and childhood tumors / cancers are also included. In one embodiment, the cancer is a solid tumor or a hematologic malignancy. In one embodiment, the cancer is carcinoma. In one embodiment, the cancer is a sarcoma. In one embodiment, the cancer is leukemia. In one embodiment, the cancer is a solid tumor.

[0313] Solid tumors are abnormal masses of tissue that do not typically contain cysts or fluid-filled areas. Solid tumors can be benign or malignant. Different types of solid tumors are named after the cell types that form them (such as sarcoma, carcinoma, and lymphoma). Examples of solid tumors (such as sarcoma and carcinoma) include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma and other sarcomas, synovoma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, malignant lymphoma, pancreatic cancer, breast cancer, lung cancer, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, medullary carcinoma, bronchial carcinoma, renal cell carcinoma, hepatocellular carcinoma, etc. Cholangiocarcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumors, seminoma, bladder cancer, melanoma, and CNS tumors (such as gliomas (e.g., brainstem gliomas and mixed gliomas), glioblastomas (also known as glioblastoma multiforme), astrocytomas, CNS lymphomas, germ cell tumors, medulloblastomas, schwannomas, craniopharyngiomas, ependymomas, pineal tumors, hemangioblastomas, acoustic neuromas, oligodendrogliomas, meningiomas, neurocytomas, retinoblastomas, and brain metastases). In some embodiments, the cancer is an astrocytoma. In some embodiments, the cancer is a high-grade astrocytoma.

[0314] Cancers that are amenable to the treatments performed using the methods disclosed herein include, but are not limited to, esophageal cancer, hepatocellular carcinoma, basal cell carcinoma (a form of skin cancer), squamous cell carcinoma (various tissues), bladder cancer (including transitional cell carcinoma (a malignant tumor of the bladder)), bronchial cancer, colon cancer, colorectal cancer, gastric cancer, lung cancer (including small cell lung cancer and non-small cell lung cancer), adrenocortical carcinoma, thyroid cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, adenocarcinoma, sweat gland cancer, sebaceous gland cancer, papillary carcinoma, papillary adenocarcinoma, cystic adenocarcinoma, medullary carcinoma, renal cell carcinoma, ductal carcinoma in situ or bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, uterine cancer, testicular cancer, osteoblastic carcinoma, epithelial carcinoma, and nasopharyngeal carcinoma.

[0315] Sarcomas for which treatments can be performed in accordance with the methods disclosed herein include, but are not limited to, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, chordoma, osteosarcoma, osteosarcoma, angiosarcoma, endothelial sarcoma, lymphangiosarcoma, lymphangioendothelial sarcoma, synovial sarcoma, mesothelioma, Ewing's sarcoma, leiomyosarcoma, rhabdomyosarcoma and other soft tissue sarcomas.

[0316] In some exemplary embodiments, the modified immune cells of the present invention are used to treat myeloma or conditions associated with myeloma. Examples of myeloma or conditions associated with myeloma include, but are not limited to, light chain myeloma, non-secreting myeloma, monoclonal gamopathy of undertermined significance (MGUS), plasmacytoma (e.g., solitary, multiple solitary, extramedullary plasmacytoma), amyloidosis, and multiple myeloma. In one embodiment, the method of this disclosure is used to treat multiple myeloma. In one embodiment, the method of this disclosure is used to treat refractory myeloma. In one embodiment, the method of this disclosure is used to treat relapsed myeloma.

[0317] In some exemplary embodiments, the modified immune cells of the present invention are used to treat melanoma or melanoma-related conditions. Examples of melanoma or related conditions include, but are not limited to, superficial extended melanoma, nodular melanoma, malignant nevus, acral lentigines melanoma, amelanotic malignant melanoma, or cutaneous melanoma (e.g., skin, eye, vulva, vagina, rectal melanoma). In one embodiment, the method of the present disclosure is used to treat cutaneous melanoma. In one embodiment, the method of the present disclosure is used to treat refractory melanoma. In one embodiment, the method of the present disclosure is used to treat recurrent melanoma.

[0318] In other exemplary embodiments, the modified immune cells of the present invention are used to treat sarcomas or sarcoma-related conditions. Examples of sarcomas or related conditions include, but are not limited to, angiosarcoma, chondrosarcoma, Ewing's sarcoma, fibrosarcoma, gastrointestinal stromal tumor, leiomyosarcoma, liposarcoma, malignant peripheral nerve sheath tumor, osteosarcoma, pleomorphic sarcoma, rhabdomyosarcoma, and synovial sarcoma. In one embodiment, the method of the present disclosure is used to treat synovial sarcoma. In one embodiment, the method of the present disclosure is used to treat liposarcomas, such as myxoid / round cell liposarcoma, differentiated / dedifferentiated liposarcoma, and pleomorphic liposarcoma. In one embodiment, the method of the present disclosure is used to treat myxoid / round cell liposarcoma. In one embodiment, the method of the present disclosure is used to treat refractory sarcomas. In one embodiment, the method of the present disclosure is used to treat recurrent sarcomas.

[0319] For the subjects undergoing the therapy, the cells of the present invention to be applied can be autologous.

[0320] The application of the cells of the present invention can be carried out in any convenient manner known to those skilled in the art. The cells of the present invention can be administered to the subject via nebulization, injection, ingestion, infusion, implantation, or transplantation. The compositions described herein can be administered to the patient via artery, subcutaneous, intradermal, intratumorally, intratranodally, intramedullary, intramuscular, intravenous (iv), or intraperitoneal injection. In other cases, the cells of the present invention can be injected directly into the site of inflammation, local disease site, lymph nodes, organs, tumors, etc., of the subject.

[0321] In some embodiments, cells are administered at a desired dose, which in some aspects includes a desired dose or cell number or cell type (one or more) and / or a desired ratio of cell types. Thus, in some embodiments, the cell dose is based on the total number of cells (or the number per kg of body weight) and a desired ratio of a single population or subtype, such as the ratio of CD4+ to CD8+. In some embodiments, the cell dose is based on the desired total number of cells (or the number per kg of body weight) in a single population or single cell type. In some embodiments, the dose is based on a combination of characteristics such as the desired total number of cells in a single population, the desired ratio, and the desired total number of cells.

[0322] In some implementations, cell populations or cell subtypes (such as CD8) are administered within or within permissible variations of the desired dose of total cells (e.g., the desired dose of T cells). + T cells and CD4 + T cells). In some aspects, the desired dose is the desired number of cells or the desired number of cells per unit body weight of the subject to which the cells are administered, for example, cells / kg. In some aspects, the desired dose is equal to or greater than the minimum number of cells or the minimum number of cells per unit body weight. In some aspects, in the total cells administered at the desired dose, individual populations or subtypes are expressed at the desired output ratio (e.g., CD4+). + With CD8 + The ratio of the output to the desired output (e.g., within a certain permissible difference or error) exists.

[0323] In some embodiments, cells are administered within or within permissible differences in the desired dose (e.g., the desired dose of CD4+ cells and / or the desired dose of CD8+ cells) of one or more individual cell populations or cell subtypes. In some aspects, the desired dose is the desired number of cells of that subtype or population, or the desired number of such cells per unit body weight of the subject to which the cells are administered, e.g., cells / kg. In some aspects, the desired dose is equal to or greater than the minimum number of cells of that population or subtype, or equal to or greater than the minimum number of cells of that population or subtype per unit body weight. Therefore, in some embodiments, the dose is based on a desired fixed dose and a desired ratio of total cells, and / or on a desired fixed dose of one or more (e.g., each) of individual subtypes or subpopulations. Therefore, in some embodiments, the dose is based on a desired fixed dose or minimum dose of T cells and CD4+ cells. + With CD8 + The desired ratio of cells, and / or based on CD4 + and / or CD8 + The desired fixed dose or minimum dose for the cells.

[0324] In some implementations, these cells, or individual populations of cell subtypes, are applied to the object in the range of approximately 1 million to approximately 100 billion cells, such as, for example, 1 million to approximately 50 billion cells (e.g., approximately 5 million cells, approximately 25 million cells, approximately 500 million cells, approximately 1 billion cells, approximately 5 billion cells, approximately 20 billion cells, approximately 30 billion cells, approximately 40 billion cells, or any two of the values ​​defined above), such as approximately 10 million to approximately 100 billion cells (e.g., approximately 20 million cells, approximately 30 million cells, approximately 40 million cells, approximately 60 million cells). The number of cells, approximately 70 million cells, approximately 80 million cells, approximately 90 million cells, approximately 10 billion cells, approximately 25 billion cells, approximately 50 billion cells, approximately 75 billion cells, approximately 90 billion cells, or any two of the values ​​defined above), and in some cases approximately 100 million cells to approximately 50 billion cells (e.g., approximately 120 million cells, approximately 250 million cells, approximately 350 million cells, approximately 450 million cells, approximately 650 million cells, approximately 800 million cells, approximately 900 million cells, approximately 3 billion cells, approximately 30 billion cells, approximately 45 billion cells) or any value within these ranges.

[0325] In some implementations, the dose of total cells and / or the dose of individual cell subpopulations are in the range of 1 × 10⁻⁶. 5 One cell / kg to approximately 1×1011 Between cells / kg, 10 4 , and equal to or approximately 10 11 Cells / kg body weight, such as in 10 5 With 10 6 Between cells per kg body weight, for example, equal to or approximately 1 × 10⁻⁶. 5 Cells / kg body weight, 1.5 × 10 5 Cells / kg body weight, 2 × 10 5 Cells / kg body weight or 1 × 10 6 Cells / kg body weight. For example, in some embodiments, cells are applied within or at a certain error range of: equal to or about 10 4 and equal to or approximately 10 9 Between 10 T cells / kg body weight, such as in the range of 10 5 With 10 6 Between 1 T cell / kg body weight, for example, equal to or approximately 1 × 10 5 T cells / kg body weight, 1.5 × 10 5 T cells / kg body weight, 2 × 10 5 T cells / kg body weight or 1 × 10 6 T cells / kg body weight. In other exemplary embodiments, a suitable dose range for the modified cells used in the methods of this disclosure is not limited to about 1 × 10⁻⁶ cells / kg body weight. 5 One cell / kg to approximately 1×10 6 cells / kg, approximately 1×10 6 One cell / kg to approximately 1×10 7 cells / kg, approximately 1×10 7 Approximately 1 × 10⁶ cells / kg 8 cells / kg, approximately 1×10 8 Approximately 1 × 10⁶ cells / kg 9 cells / kg, approximately 1×10 9 Approximately 1 × 10⁶ cells / kg 10 cells / kg, approximately 1×10 10 Approximately 1 × 10⁶ cells / kg 11 Cells / kg. In an exemplary embodiment, a suitable dose for the method of this disclosure is about 1 × 10⁻⁶ cells / kg. 8 Cells / kg. In an exemplary embodiment, a suitable dose for the method of this disclosure is about 1 × 10⁻⁶ cells / kg. 7 Cells / kg. In other embodiments, a suitable dose is about 1 × 10⁻⁶ cells / kg. 7 The total number of cells is approximately 5 × 10⁶. 7Total cells. In some embodiments, a suitable dose is about 1 × 10⁶ cells. 8 The total number of cells is approximately 5 × 10⁶. 8 Total cells. In some embodiments, a suitable dose is about 1.4 × 10⁶ cells. 7 Total cells approximately 1.1 × 10⁻⁶ 9 Total cells. In an exemplary embodiment, a suitable dose for the method of this disclosure is about 7 × 10⁶ cells. 9 Total cells.

[0326] In some implementations, cells are applied within or at an error range of: 10 4 and equal to or approximately 10 9 CD4 + and / or CD8 + Between cells / kg body weight, such as in 10 5 With 10 6 CD4 + and / or CD8 + Between cells / kg body weight, for example, equal to or approximately 1 × 10 5 CD4 + and / or CD8 + Cells / kg, 1.5 × 10 5 CD4 + and / or CD8 + Cells / kg body weight, 2 × 10 5 CD4 + and / or CD8 + Cells / kg body weight, or 1 × 10 6 CD4 + and / or CD8 + Cells / kg body weight. In some embodiments, cells are applied within or within one of the following error ranges: greater than, and / or at least about 1 × 10⁻⁶. 6 Approximately 2.5 × 10 6 Approximately 5 × 10 6 Approximately 7.5 × 10 6 Or approximately 9 × 10 6 CD4 + Cells, and / or at least about 1 × 10 6 Approximately 2.5 × 10 6 Approximately 5 × 10 6 Approximately 7.5 × 10 6 Or approximately 9 × 10 6 10 CD8+ cells, and / or at least about 1 × 10 6 Approximately 2.5 × 10 6Approximately 5 × 10 6 Approximately 7.5 × 10 6 Or approximately 9 × 10 6 T cells. In some embodiments, cells are administered within or at a certain error range: at approximately 10 8 With 10 12 Between 10 T cells or approximately 10 10 With 10 11 Between T cells, in approximately 10 8 With 10 12 CD4 + Between cells or about 10 10 With 10 11 CD4 + Between cells and / or in about 10 8 With 10 12 CD8 + Between cells or about 10 10 With 10 11 CD8 + Between cells.

[0327] In some implementations, cells are administered within or within an acceptable range of a desired output ratio from multiple cell populations or subtypes (such as CD4+ and CD8+ cells or subtypes). In some aspects, the desired ratio can be a specific ratio or a range of ratios; for example, in some implementations, the desired ratio (e.g., CD4+, CD8 ... + Cells and CD8 + The cell ratio is between 5:1 and 5:1 (or greater than 1:5 and less than 5:1), or between 1:3 and 3:1 (or greater than 1:3 and less than 3:1), or between 2:1 and 1:5 (or greater than 1:5 and less than 2:1), such as 5:1, 4.5:1, 4:1, 3.5:1, 3:1, 2.5:1, 2... :1, 1.9:1, 1.8:1, 1.7:1, 1.6:1, 1.5:1, 1.4:1, 1.3:1, 1.2:1, 1.1:1, 1:1, 1:1.1, 1:1.2, 1:1.3, 1:1.4, 1:1.5, 1:1.6, 1:1.7, 1:1.8, 1:1.9, 1:2, 1:2.5, 1:3, 1:3.5, 1:4, 1:4.5, or 1:5). In some respects, the permissible difference is within approximately 1%, approximately 2%, approximately 3%, approximately 4%, approximately 5%, approximately 10%, approximately 15%, approximately 20%, approximately 25%, approximately 30%, approximately 35%, approximately 40%, approximately 45%, or approximately 50% of the desired ratio, including any value between these ranges.

[0328] In some embodiments, the modified cells are administered to the recipient in a single or multiple doses. In some embodiments, the modified cells are administered in multiple doses, for example, once a week or every 7 days, once every 2 weeks or every 14 days, once every 3 weeks or every 21 days, once every 4 weeks or every 28 days. In an exemplary embodiment, a single dose of the modified cells is administered to the recipient. In an exemplary embodiment, a single dose of the modified cells is administered to the recipient via rapid intravenous infusion.

[0329] For the prevention or treatment of a disease, the appropriate dosage may depend on the type of disease to be treated, the type of cell or recombinant receptor, the severity and course of the disease, whether the cell is being administered for preventative or therapeutic purposes, prior therapy, the subject's clinical history and response to the cell, and the judgment of the attending physician. In some embodiments, the composition and cells are appropriately administered to the subject once or through a series of treatments.

[0330] In some embodiments, cells are administered as part of a combination therapy, such as simultaneously with or sequentially in any order with other therapeutic interventions (e.g., antibodies or modified cells or receptors, or agents such as cytotoxic agents or therapeutic agents). In some embodiments, cells are administered simultaneously or sequentially with one or more other therapeutic agents, or in combination with another therapeutic intervention. In some settings, cells are co-administered with another therapy at sufficiently close temporal proximity, such that the cell population enhances the effect of one or more other therapeutic agents, or vice versa. In some embodiments, cells are administered prior to one or more other therapeutic agents. In some embodiments, cells are administered after one or more other therapeutic agents. In some embodiments, one or more other agents include cytokines, such as IL-2, thereby enhancing persistence, for example. In some embodiments, the method includes the administration of a chemotherapeutic agent.

[0331] In some embodiments, the modified cells of the present invention (e.g., modified cells containing CARs) may be administered to a subject in combination with an inhibitor of an immune checkpoint. Examples of immune checkpoints include, but are not limited to, CTLA-4, PD-1, and TIM-3. Antibodies may be used to inhibit immune checkpoints (e.g., anti-PD1, anti-CTLA-4, or anti-TIM-3 antibodies). For example, the modified cells may be administered in combination with an antibody or antibody fragment targeting, for example, PD-1 (programmed death 1 protein). Examples of anti-PD-1 antibodies include, but are not limited to, pembrolizumab (KEYTRUDA®, formerly lambolizumab, also known as MK-3475) and nivolumab (BMS-936558, MDX-1106, ONO-4538, OPDIVA®) or antigen-binding fragments thereof. In some embodiments, the modified cells may be administered in combination with an anti-PD-L1 antibody or antigen-binding fragment thereof. Examples of anti-PD-L1 antibodies include, but are not limited to, BMS-936559, MPDL3280A (TECENTRIQ®, atezolizumab), and MEDI4736 (Durvalumab, Imfinzi). In some embodiments, the modified cells may be administered in combination with an anti-CTLA-4 antibody or its antigen-binding fragment. Examples of anti-CTLA-4 antibodies include, but are not limited to, ipilimumab (trade name Yervoy). Other types of immune checkpoint modulators may also be used, including, but not limited to, small molecules, siRNA, miRNA, and CRISPR systems. Immune checkpoint modulators may be administered before, after, or simultaneously with the modified cells containing the CAR. In some embodiments, combination therapy containing immune checkpoint modulators may enhance the therapeutic efficacy of therapies containing the modified cells of the present invention.

[0332] Following cell administration, in some embodiments, the bioactivity of the modified cell population is measured, for example, by any of a variety of known methods. Evaluation parameters include the specific binding of the modified or native T cells or other immune cells to the antigen in vivo (e.g., by imaging) or in vitro (e.g., by ELISA or flow cytometry). In some embodiments, the ability of the modified cells to destroy target cells can be measured using any suitable method known in the art, such as, for example, Kochenderfer. et al ., J. Immunotherapy, 32(7): 689-702 (2009), and Herman et alThe cytotoxicity assay described in J. Immunological Methods, 285(1): 25-40 (2004). In some embodiments, cellular bioactivity is measured by determining the expression and / or secretion of one or more cytokines such as CD107a, IFNγ, IL-2, and TNF. In some aspects, bioactivity is measured by assessing clinical outcomes such as a reduction in tumor burden or load.

[0333] In some implementations, the subject is provided with secondary treatment. Secondary treatment includes, but is not limited to, chemotherapy, radiation therapy, surgery, and medication.

[0334] In some embodiments, conditioning therapy may be administered to the subject prior to CAR T-cell therapy. In some embodiments, conditioning therapy includes administering an effective amount of cyclophosphamide to the subject. In some embodiments, conditioning therapy includes administering an effective amount of fludarabine to the subject. In a preferred embodiment, conditioning therapy includes administering an effective amount of a combination of cyclophosphamide and fludarabine to the subject. Administering conditioning therapy prior to CAR T-cell therapy can enhance the efficacy of CAR T-cell therapy. A method of conditioning a patient for T-cell therapy is described in U.S. Patent No. 9,855,298 (which is incorporated herein by reference in its entirety).

[0335] In some embodiments, the specific dosage regimens of this disclosure include a lymphocyte depletion (lymphocyte clearance) step prior to the administration of modified T cells. In an exemplary embodiment, the lymphocyte depletion step includes the administration of cyclophosphamide and / or fludarabine.

[0336] In some embodiments, the lymphocyte depletion step includes using approximately 200 mg / m² of lymphocytes. 2 / day and approximately 2000 mg / m 2 / day (e.g., 200 mg / m²) 2 / day, 300 mg / m 2 / day or 500 mg / m 2 Cyclophosphamide is administered at a dose of approximately 300 mg / m² (per day). In an exemplary embodiment, the dose of cyclophosphamide is approximately 300 mg / m². 2 / day. In some implementations, the lymphocyte depletion step includes using approximately 20 mg / m². 2 / day and approximately 900 mg / m 2 / day (e.g., 20 mg / m²) 2 / day, 25 mg / m 2 / day, 30 mg / m2 / day or 60 mg / m 2 Fludarabine is administered at a dose of approximately 30 mg / m² (per day). In an exemplary embodiment, the dose of fludarabine is approximately 30 mg / m². 2 / sky.

[0337] In some embodiments, the lymphocyte depletion step includes administering a dose of approximately 200 mg / m². 2 / day and approximately 2000mg / m 2 / day (e.g., 200 mg / m²) 2 / day, 300 mg / m 2 / day or 500 mg / m 2 Cyclophosphamide (per day), and at a dose of approximately 20 mg / m². 2 / day and approximately 900 mg / m 2 / day (e.g., 20 mg / m²) 2 / day, 25 mg / m 2 / day, 30 mg / m 2 / day or 60mg / m 2 Fludarabine (per day). In an exemplary embodiment, the lymphocyte depletion step includes administering a dose of approximately 300 mg / m². 2 Cyclophosphamide per day and a dose of approximately 30 mg / m² 2 / day of fludarabine.

[0338] In an exemplary embodiment, cyclophosphamide was administered at a dose of 300 mg / m². 2 / day, for three consecutive days, with fludarabine administered at 30 mg / m². 2 / day, lasting for three days.

[0339] Compared to T-cell infusion on day 0 (e.g., CAR-T, TCR-T, modified T cells, etc.), lymphocyte depletion chemotherapy can be administered on days -6 to -4 (with a -1 day window, i.e., administered on days -7 to -5).

[0340] In an exemplary embodiment, for subjects with cancer, the subjects received an intravenous infusion containing 300 mg / m² of modified T cells 3 days prior to administration. 2 Cyclophosphamide-based lymphocyte depletion chemotherapy. In an exemplary embodiment, for subjects with cancer, the subjects receive an intravenous infusion containing 300 mg / m² of cyclophosphamide 3 days prior to administration of modified T cells. 2 Cyclophosphamide-induced lymphocyte depletion chemotherapy.

[0341] In an exemplary embodiment, for a subject suffering from cancer, the subject receives a dose containing approximately 20 mg / m². 2 / day and approximately 900 mg / m 2 / day (e.g., 20 mg / m²) 2 / day, 25 mg / m 2 / day, 30 mg / m 2 / day or 60 mg / m 2 Lymphocyte depletion chemotherapy with fludarabine (30 mg / m² / day). In an exemplary embodiment, for a subject with cancer, the subject receives chemotherapy containing 30 mg / m² / day. 2 Lymphocyte depletion chemotherapy with fludarabine lasted for 3 days.

[0342] In an exemplary embodiment, for a subject suffering from cancer, the subject receives a dose comprising approximately 200 mg / m². 2 / day and approximately 2000 mg / m 2 / day (e.g., 200 mg / m²) 2 / day, 300 mg / m 2 / day or 500 mg / m 2 Cyclophosphamide (per day), and at a dose of approximately 20 mg / m². 2 / day and approximately 900 mg / m 2 / day (e.g., 20 mg / m²) 2 / day, 25 mg / m 2 / day, 30mg / m 2 / day or 60 mg / m 2 Lymphocyte depletion chemotherapy with fludarabine (per day). In an exemplary embodiment, for a subject suffering from cancer, the subject receives a dose comprising approximately 300 mg / m². 2 Cyclophosphamide per day at a dose of 30 mg / m² 2 Lymphocyte depletion chemotherapy with fludarabine lasted for 3 days.

[0343] The cells of the present invention can be administered at doses, routes, and frequencies determined in appropriate preclinical and clinical trials and experiments. The cell composition can be administered multiple times within these dose ranges. The administration of the cells of the present invention can be combined with other useful methods for treating the desired disease or condition, as determined by those skilled in the art.

[0344] One of the known adverse reactions following CAR T-cell infusion is the onset of immune activation, known as cytokine release syndrome (CRS). CRS is an immune activation that leads to an increase in inflammatory cytokines. CRS is a known target toxicity that can occur in relation to efficacy. Clinical and laboratory indicators range from mild CRS (signs and / or grade 2 organ toxicity) to severe CRS (sCRS; ≥ grade 3 organ toxicity, aggressive clinical interventions, and / or potentially life-threatening). Clinical features include: high fever, asthenia, fatigue, myalgia, nausea, anorexia, tachycardia / hypotension, capillary leakage, heart failure, renal impairment, hepatic failure, and disseminated intravascular coagulation. Significant increases in cytokines, including interferon-gamma, granulocyte-macrophage colony-stimulating factor, IL-10, and IL-6, have been observed after CAR T-cell infusion. One marker of CRS is an increase in cytokines including IL-6 (severely elevated), IFN-γ, TNF-α (moderate), and IL-2 (mild). Elevated levels of clinically available inflammatory markers, including ferritin and C-reactive protein (CRP), have also been observed to be associated with CRS syndrome. The occurrence of CRS is typically associated with the expansion of adoptive metastatic cells and progressive immune activation. It has been shown that the severity of CRS depends on the disease burden at the time of infusion, as patients with a higher tumor burden tend to have more CRS.

[0345] Therefore, this invention provides appropriate CRS management strategies after a diagnosis of CRS to alleviate the physiological symptoms of uncontrolled inflammation without affecting the antitumor efficacy of engineered cells (e.g., CAR T cells). CRS management strategies are known in the art. For example, systemic corticosteroids can be administered to rapidly reverse sCRS (e.g., grade 3 CRS) symptoms without affecting the initial antitumor response.

[0346] In some implementations, anti-IL-6R antibodies can be administered. An example of an anti-IL-6R antibody is tocilizumab, a monoclonal antibody approved by the U.S. Food and Drug Administration (FDA), also known as atlizumab (marketed as Actemra or RoActemra). Tocilizumab is a humanized monoclonal antibody targeting the interleukin-6 receptor (IL-6R). Administration of tocilizumab has shown near-immediate reversal of CRS.

[0347] CRS is typically managed based on the observed severity of the syndrome, and interventions are tailored accordingly. CRS management decisions may be based on clinical symptoms and signs and responses to interventions, rather than just laboratory values.

[0348] Mild to moderate cases are typically treated with symptom management, using fluid therapy, nonsteroidal anti-inflammatory drugs (NSAIDs), and antihistamines as needed to adequately relieve symptoms. More severe cases include patients with any degree of hemodynamic instability; tocilizumab is recommended if any hemodynamic instability occurs. In some implementations, first-line management of CRS may be a labeled dose of 8 mg / kg IV tocilizumab over 60 minutes (not exceeding 800 mg / dose); tocilizumab may be repeated after Q8 hours. If the response to the first dose of tocilizumab is suboptimal, an additional dose of tocilizumab may be considered. Tocilizumab can be administered alone or in combination with corticosteroid therapy. If a patient's CRS symptoms persist or progress, clinical symptom improvement is insufficient within 12–18 hours, or the response to tocilizumab is poor, a high-dose corticosteroid may be used, typically 100 mg of hydrocortisone or 1–2 mg / kg of methylprednisolone intravenously. In patients with hemodynamic instability or severe respiratory symptoms, high-dose corticosteroids may be administered early in the course of CRS. CRS management guidelines can be based on published standards (Lee et al. (2019)). Biol Blood Marrow Transplant , doi.org / 10.1016 / j.bbmt.2018.12.758; Neelapu et al. (2018) Nat Rev Clin Oncology , 15:47; Teachey et al. (2016) Cancer Discov ,6(6):664-679).

[0349] In patients receiving CAR-T therapy (Henter, 2007), features consistent with macrophage activation syndrome (MAS) or hemophagocytic lymphohistiocytosis (HLH) and clinical presentations consistent with CRS were observed. MAS appears to be an immune activation response resulting from CRS and should therefore be considered a manifestation of CRS. MAS is similar to HLH (also an immune-stimulating response). The clinical syndrome of MAS is characterized by persistent high fever, cytopenia affecting at least two of the three cell lines, and hepatosplenomegaly. It is associated with high serum ferritin, soluble interleukin-2 receptors and triglycerides, and decreased circulating natural killer (NK) activity.

[0350] Modified immune cells comprising the CAR of the present invention can be used in the treatment methods described herein. In one aspect, the present invention includes a method of treating cancer in a subject in need, comprising administering to the subject any of the modified immune cells or precursor cells disclosed herein. Another aspect of the present invention includes a method of treating cancer in a subject in need, comprising administering to the subject modified immune or precursor cells produced by any of the methods disclosed herein.

[0351] One aspect of the present invention provides a method for treating glioblastoma in a subject in need of treatment. The method includes administering an effective amount of modified T cells to the subject, the T cells comprising: a first chimeric antigen receptor (CAR) comprising a first antigen-binding domain capable of binding to IL13Rα2; a second chimeric antigen receptor (CAR) comprising a second antigen-binding domain capable of binding to epidermal growth factor receptor (EGFR) or an isotype thereof; and a dominant-negative TGF receptor. Type II receptor (DN-TGF) RII).

[0352] In some embodiments, the first CAR includes a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence TKYGVH (SEQ ID NO: 1) or SRNGMS (SEQ ID NO: 12), HCDR2 contains the amino acid sequence GVKWAGGSTDYNSALMS (SEQ ID NO: 3) or TVSSGGSYIYYADSVKG (SEQ ID NO: 13), and HCDR3 contains the amino acid sequence DHRDAMDY (SEQ ID NO: 4) or QGTTALATRFFDV (SEQ ID NO: 15); and / or a light chain variable region comprising three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence TASLSVSSTYLH (SEQ ID NO: 5) or KASQDVGTAVA (SEQ ID NO: 16), and LCDR2 contains the amino acid sequence STSNLAS (SEQ ID NO: 6) or SASYRST (SEQ ID NO: 15). 17), and LCDR3 contains the amino acid sequence HQYHRSPLT (SEQ ID NO: 7) or QHHYSAPWT (SEQ ID NO: 18).

[0353] In some embodiments, the second CAR includes a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence GYSITSDFAWN (SEQ ID NO: 25), HCDR2 contains the amino acid sequence GYISYSGNTRYNPSLK (SEQ ID NO: 26), and HCDR3 contains the amino acid sequence VTAGRGFPYW (SEQ ID NO: 27); and / or a light chain variable region comprising three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence HSSQDINSNIG (SEQ ID NO: 28), LCDR2 contains the amino acid sequence HGTNLDD (SEQ ID NO: 29), and LCDR3 contains the amino acid sequence VQYAQFPWT (SEQ ID NO: 30).

[0354] Another aspect of the invention provides a method for treating glioblastoma in a subject in need of treatment, comprising administering an effective amount of modified T cells to the subject, the modified T cells comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and DN-TGF. RII, wherein the first CAR comprises a heavy chain variable region containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 8 or 19; and / or a light chain variable region containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 9 or 20; and the second CAR comprises a heavy chain variable region containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 31; and / or a light chain variable region containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 32.

[0355] Another aspect of the invention includes a method of treating glioblastoma in a subject in need of treatment, comprising administering an effective amount of modified T cells to the subject, the modified T cells comprising: a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and DN-TGF. RII, wherein the first CAR comprises a single-stranded variable region fragment (scFv) containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 21, or SEQ ID NO: 22; and the second CAR comprises scFv containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 34, 44, or 142.

[0356] Another aspect of the invention provides a method for treating glioblastoma in a subject in need of treatment, comprising administering an effective amount of modified T cells to the subject, the modified T cells comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and DN-TGF. RII, wherein the first CAR contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 55, or SEQ ID NO: 56, and the second CAR contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 36 or 197.

[0357] In some embodiments, the second CAR includes a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 144 or SEQ ID NO: 445; and a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 146 or SEQ ID NO: 147.

[0358] In some implementations, DN-TGF RII contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2.

[0359] H. Expansion of immune cells Whether before or after cells are modified to express CAR, cell activation and proliferation can be achieved using methods described in the following literature, such as U.S. Patent Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041; and U.S. Patent Application No. 20060121005. For example, the T cells of the present invention can be expanded by contact with a surface to which a reagent stimulating CD3 / TCR complex-related signaling and a ligand stimulating co-stimulatory molecules on the T cell surface are attached. Specifically, the T cell population can be stimulated by contact with an anti-CD3 antibody or its antigen-binding fragment or an anti-CD2 antibody immobilized on the surface, or by contact with a protein kinase C activator (e.g., lichenin) bound to a calcium ionocarp. Ligands binding to helper molecules on the T cell surface are used to co-stimulate the helper molecules. For example, under conditions suitable for stimulating T cell proliferation, the T cells can be contacted with both anti-CD3 and anti-CD28 antibodies. Examples of anti-CD28 antibodies include 9.3, B-T3, and XR-CD28 (Diaclone, Besancon, France), and these can be used in this disclosure, as can other methods and reagents known in the art (see, for example, ten Berge et al., Transplant Proc. (1998) 30(8):3975-3977; Haanen et al., J. Exp. Med. (1999) 190(9): 1319-1328; and Garland et al., J. Immunol. Methods (1999) 227(1-2): 53-63).

[0360] The methods disclosed herein can amplify T cells by approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000, 100,000, 1,000,000, 10,000,000 or greater, and any and all whole or partial integers therebetween. In one embodiment, the T cell amplification ranges from approximately 20 to approximately 50 times.

[0361] After culturing, T cells can be incubated in cell culture medium in a culture device for a period of time or until the cells reach a high cell concentration of confluence or optimal passage, and then transferred to another culture device. The culture device can be any culture device commonly used for in vitro cell culture. Preferably, the confluence level is 70% or greater before transferring the cells to another culture device. More preferably, the confluence level is 90% or greater. The time period can be any time suitable for in vitro cell culture. The T cell culture medium can be replaced at any time during T cell culture. Preferably, the T cell culture medium is replaced approximately every 2 to 3 days. The T cells are then harvested from the culture device and can be used immediately or cryopreserved for use at a later time. In one embodiment, the invention includes cryopreservation of expanded T cells. The cryopreserved T cells are thawed before nucleic acids are introduced into the T cells.

[0362] In another embodiment, the method includes isolating T cells and expanding T cells. In another embodiment, the invention further includes cryopreserving T cells prior to expansion. In yet another embodiment, the cryopreserved T cells are thawed for electroporation using RNA encoding chimeric membrane proteins.

[0363] Another process for in vitro cell expansion is described in U.S. Patent No. 5,199,942 (incorporated herein by reference). Expansion as described in U.S. Patent No. 5,199,942 may be an optional approach or an addition to other expansion methods described herein. In short, in vitro culture and expansion of T cells involves the addition of cell growth factors, such as those described in U.S. Patent No. 5,199,942, or other factors, such as flt3-L, IL-1, IL-3, and c-kit ligands. In one embodiment, expanding T cells includes culturing T cells with a factor selected from flt3-L, IL-1, IL-3, and c-kit ligands.

[0364] The culture steps described herein (in contact with the reagents described herein or after electroporation) can be very short, for example, less than 24 hours, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 hours. Further culture steps described herein (in contact with the reagents described herein) can be longer, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more days.

[0365] Various terms are used to describe cells in a culture. A cell culture generally refers to cells taken from a living organism and grown under controlled conditions. A primary cell culture is a culture taken directly from cells, tissues, or organs of an organism and prior to the first passage culture. When cells are placed in a growth medium under conditions that promote cell growth and / or division, the cells in the culture are expanded, resulting in a larger cell population. When cells are expanded in a culture, the cell proliferation rate is usually measured by the amount of time required for the cell number to double (also known as the doubling time).

[0366] Each round of passage culture is called a passage. When cells are passaged, they are said to have been passaged. A particular cell population or cell line is sometimes referred to by the number of passages it has been passaged or characterized by the number of passages it has been passaged. For example, a cell population that has been passaged ten times may be referred to as a P10 culture. The primary culture, that is, the first culture after cells are isolated from a tissue, is designated as P0. After the first passage culture, the cells are described as secondary cultures (P1 or passage 1). After the second passage culture, the cells become tertiary cultures (P2 or passage 2), and so on. Those skilled in the art will understand that there are numerous population multiplications during the passage cycle; therefore, the number of population multiplications in a culture is greater than the number of passages. The expansion of cells (i.e., the number of population multiplications) in the cycle between passages depends on numerous factors, including but not limited to seeding density, substrate, culture medium, and time between passages.

[0367] In one embodiment, cells can be cultured for several hours (about 3 hours) to about 14 days or any integer in hours. Suitable conditions for T cell cultures include a suitable culture medium (e.g., Minimal Essential Media, RPMI Media 1640, or X-vivo 15, (Lonza)) that may contain factors essential for proliferation and survival, including serum (e.g., fetal bovine serum or human serum), interleukin-2 (IL-2), insulin, IFN-γ, IL-4, IL-7, GM-CSF, IL-10, IL-12, IL-15, TGF-β, and TNF-α, or any other cell growth additives known to those skilled in the art. Other cell growth additives include, but are not limited to, surfactants, plasma products, and reducing agents such as N-acetylcysteine ​​and 2-mercaptoethanol. The culture medium may contain RPMI 1640, AIM-V, DMEM, MEM, α-MEM, F-12, X-Vivo 15, and X-Vivo 20, Optimizer, with added amino acids, sodium pyruvate, and vitamins, serum-free or supplemented with appropriate amounts of serum (or plasma) or defined groups of hormones, and / or sufficient amounts of cytokines (one or more) for T cell growth and expansion. Antibiotics, such as penicillin and streptomycin, are included only in the experimental culture and not in the cell culture to be injected with the target cells. Target cells are maintained under conditions necessary for growth, such as appropriate temperature (e.g., 37°C) and atmospheric conditions (e.g., air plus 5% CO2).

[0368] The culture medium used to culture T cells may contain reagents that can co-stimulate T cells. For example, the reagent that can stimulate CD3 is an antibody against CD3, and the reagent that can stimulate CD28 is an antibody against CD28. Cells isolated by the methods disclosed herein can be expanded by approximately 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold, 900-fold, 1000-fold, 2000-fold, 3000-fold, 4000-fold, 5000-fold, 6000-fold, 7000-fold, 8000-fold, 9000-fold, 10,000-fold, 100,000-fold, 10,000,000-fold, or more. In one embodiment, the T cell expansion ranges from about 20-fold to about 50-fold or more. In one embodiment, human T regulatory cells are expanded via KT64.86 artificial antigen-presenting cells (aAPCs) coated with anti-CD3 antibody. Methods for expanding and activating T cells can be found in U.S. Patent Nos. 7,754,482, 8,722,400, and 9,555,105, the contents of which are incorporated herein by reference in their entirety.

[0369] In one embodiment, the method for expanding T cells may further include isolating the expanded T cells for further application. In another embodiment, the expansion method may further include subsequently electroporating the expanded T cells and then culturing them. The subsequent electroporation may involve introducing a nucleic acid encoding a reagent (such as T cells expanded by nucleic acid transduction, T cells transfected, or T cells expanded by electroporation) into the expanded T cell population, wherein the reagent further stimulates the T cells. The reagent may stimulate the T cells, such as by stimulating further expansion, effector function, or another T cell function.

[0370] I. Methods for producing genetically modified immune cells This disclosure provides methods for generating or generating modified immune cells or precursors (e.g., T cells) of the present invention for use in tumor immunotherapy, such as adoptive immunotherapy.

[0371] In some embodiments, CARs (one or more) are introduced into cells via expression vectors. This document provides expression vectors comprising nucleic acid sequences encoding the CARs of the present invention. Suitable expression vectors include lentiviral vectors, gamma retroviral vectors, foam virus vectors, adeno-associated virus (AAV) vectors, adenovirus vectors, engineered hybrid viruses, naked DNA, and vectors including, but not limited to, transposon-mediated vectors such as Sleeping Beauty virus, swine influenza virus (Piggybak), and integrases such as Phi31. Some other suitable expression vectors include herpes simplex virus (HSV) and retroviral expression vectors.

[0372] In some embodiments, the nucleic acid encoding the CAR is introduced into cells via viral transduction. In some embodiments, viral transduction involves contacting immune cells or precursor cells with a viral vector containing the nucleic acid encoding the CAR. In some embodiments, the viral vector is an adeno-associated virus (AAV) vector. In some embodiments, the AAV vector contains 5' ITR and 3' ITR derived from AAV6. In some embodiments, the AAV vector contains a marmot hepatitis virus post-transcriptional regulatory element (WPRE). In some embodiments, the AAV vector contains a polyadenylate (polyA) sequence. In some embodiments, the polyA sequence is a bovine growth hormone (BGH) polyA sequence.

[0373] Adenoviral expression vectors are based on adenoviruses, which have a low ability to integrate into genomic DNA but a high efficiency in transfecting host cells. An adenoviral expression vector contains an adenoviral sequence sufficient to: (a) support packaging of the expression vector and (b) ultimately express a CAR in host cells. In some embodiments, the adenoviral genome is a 36 kb linear double-stranded DNA in which a foreign DNA sequence (e.g., a nucleic acid encoding a CAR) can be inserted to replace the bulky adenoviral DNA, thereby preparing the expression vector of the present invention (see, for example, Danthinne and Imperiale, Gene Therapy (2000) 7(20): 1707-1714).

[0374] Another expression vector is based on adeno-associated virus (AAV), which utilizes an adenovirus coupling system. This AAV expression vector integrates into the host genome at a high frequency. It can infect non-dividing cells, thus making it suitable for delivering genes into mammalian cells, for example, in tissue culture or in vivo. AAV vectors have a broad range of infective hosts. Details regarding the development and use of AAV vectors are described in U.S. Patent Nos. 5,139,941 and 4,797,368.

[0375] Retroviral expression vectors can integrate into the host genome, delivering large amounts of exogenous genetic material, infecting a wide range of species and cell types, and being packaged in specialized cell lines. Retroviral vectors are constructed by inserting nucleic acids (e.g., those encoding CARs) at certain locations in the viral genome to produce viruses with replication defects. While retroviral vectors can infect multiple cell types, CAR integration and stable expression require host cell division.

[0376] Lentiviral vectors are derived from lentiviruses, a complex retrovirus that contains, in addition to the common retrovirus genes gag, pol, and env, other genes with regulatory or structural functions (see, for example, U.S. Patent Nos. 6,013,516 and 5,994,136). Some examples of lentiviruses include human immunodeficiency virus (HIV-1, HIV-2) and simian immunodeficiency virus (SIV). Lentiviral vectors are produced by deleting multiple HIV virulence-attenuating genes, such as env, vif, vpr, vpu, and nef, to make the vector biologically safe. Lentiviral vectors can infect non-dividing cells and can be used for in vivo and in vitro gene transfer and expression, for example, the in vivo and in vitro gene transfer and expression of nucleic acids encoding CARs (see, for example, U.S. Patent No. 5,994,136).

[0377] Expression vectors containing the nucleic acids disclosed herein can be introduced into host cells by any means known to those skilled in the art. If desired, the expression vector may contain a viral sequence for transfection. Alternatively, the expression vector may also be introduced by fusion, electroporation, biotechnology, transfection, lipid transfection, etc. Prior to the introduction of the expression vector, host cells may be grown and amplified in a culture, and then appropriately treated to introduce and integrate the vector. The host cells are then amplified and can be screened by markers present in the vector. Various markers that can be used are known in the art and may include hprt, neomycin resistance, thymidine kinase, hygromycin resistance, etc. As used herein, the terms “cell,” “cell line,” and “cell culture” are used interchangeably. In some embodiments, the host cell is an immune cell or its precursor, such as a T cell, NK cell, or NKT cell.

[0378] The present invention also provides genetically engineered cells comprising and stably expressing the CAR disclosed herein. In some embodiments, the genetically engineered cells are genetically engineered T lymphocytes (T cells), naive T cells (TN), memory T cells (e.g., central memory T cells (TCM), effector memory cells (TEM)), natural killer cells (NK cells), and macrophages capable of producing treatment-related progeny. In some embodiments, the genetically engineered cells are autologous cells. In some embodiments, the modified cells are resistant to T cell exhaustion.

[0379] Modified cells (e.g., those containing CARs) can be generated by stably transfecting host cells with an expression vector containing nucleic acids of this disclosure. Other methods for generating modified cells of this disclosure include, but are not limited to, chemical transformation (e.g., using calcium phosphate, dendritic polymers, liposomes, and / or cationic polymers), non-chemical transformation (e.g., electroporation, optical transformation, gene electrotransfer, and / or hydrodynamic delivery), and / or particle-based methods (e.g., puncture, using a gene gun, and / or magnetic infection). Transfected cells expressing CARs of this disclosure can be expanded in vitro.

[0380] Physical methods for introducing expression vectors into host cells include calcium phosphate precipitation, liposome infection, particle bombardment, microinjection, and electroporation. Methods for producing cells containing vectors and / or exogenous nucleic acids are well known in the art. See, for example, Sambrook et al. (2001), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York. Chemical methods for introducing expression vectors into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

[0381] Suitable lipids are available from commercial sources. For example, dimyristyl phosphatidylcholine (“DMPC”) is available from Sigma, St. Louis, MO; dicetyl phosphate (“DCP”) is available from K&K Laboratories (Plainview, NY); cholesterol (“Choi”) is available from Calbiochem-Behring; dimyristyl phosphatidylglycerol (“DMPG”) and other lipids are available from Avanti Polar Lipids, Inc. (Birmingham, AL). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at approximately -20°C. Chloroform can be used as the sole solvent because it is more volatile than methanol. “Liposome” is a general term encompassing various monolayer and multilayer lipid carriers formed by the generation of closed lipid bilayers or aggregates. Liposomes can be characterized as vesicle structures with a phospholipid bilayer membrane and an internal aqueous medium. Multilayer liposomes have multiple lipid layers separated by an aqueous medium. When phospholipids are suspended in excess aqueous solution, they spontaneously form. The lipid components undergo rearrangement before forming a closed structure, trapping water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5: 505-10). Compositions with structures in solution different from normal vesicle structures are also considered. For example, lipids may have a micellar structure or simply exist as heterogeneous aggregates of lipid molecules. Lipofectamine-nucleic acid complexes are also considered.

[0382] Regardless of the method used to introduce exogenous nucleic acids into host cells or otherwise expose cells to the inhibitors of this invention, various assays can be performed to confirm the presence of nucleic acids in the host cells. Such assays include, for example, molecular biological assays well known to those skilled in the art, such as Southern and Northern blotting, RT-PCR, and PCR; and biochemical assays, such as detecting the presence or absence of specific peptides, for example, by immunological means (ELISA and Western blotting) or by assays described herein to identify reagents falling within the scope of this invention.

[0383] In one implementation, the nucleic acid introduced into the host cell is RNA. In another implementation, the RNA is mRNA containing in vitro transcribed RNA or synthetic RNA. RNA can be produced by in vitro transcription using a template generated by polymerase chain reaction (PCR). Using appropriate primers and RNA polymerase, DNA of interest from any source can be directly converted into a template for in vitro mRNA synthesis via PCR. The source of DNA can be, for example, genomic DNA, plasmid DNA, phage DNA, cDNA, synthetic DNA sequences, or any other suitable DNA source.

[0384] PCR can be used to generate in vitro transcription templates for mRNA, which are then introduced into cells. Methods for performing PCR are well known in the art. Primers used for PCR are designed to have regions substantially complementary to the DNA region to be used as a PCR template. As used herein, “substantially complementary” is a nucleotide sequence in which most or all of the bases in the primer sequence are complementary. Under annealing conditions used for PCR, substantially complementary sequences are able to anneal or hybridize with the intended DNA target. Primers can be designed to be substantially complementary to any portion of the DNA template. For example, primers can be designed to amplify a normally transcribed portion of a gene (open reading frame) containing 5' and 3' UTRs. Primers can also be designed to amplify portions of a gene encoding a specific domain of interest. In one embodiment, primers are designed to amplify the coding region of human cDNA, containing all or part of the 5' and 3' UTRs. Primers that can be used for PCR are produced by synthetic methods well known in the art. A “forward primer” refers to a primer containing a nucleotide region substantially complementary to the nucleotides on the DNA template upstream of the DNA sequence to be amplified. “Upstream” herein refers to position 5 of the DNA sequence to be amplified relative to the coding strand. A "reverse primer" is a primer whose nucleotide region is substantially complementary to a double-stranded DNA template containing the downstream DNA sequence to be amplified. "Downstream" in this text refers to the 3' position of the DNA sequence to be amplified relative to the coding strand.

[0385] Chemical structures that improve RNA stability and / or translation efficiency may also be used. The RNA preferably has 5' and 3' UTRs. In one embodiment, the length of the 5' UTR is between 0 and 3000 nucleotides. The lengths of the 5' and 3' UTR sequences to be added to the coding region can be varied by various methods, including, but not limited to, designing PCR primers annealed to different regions of the UTR. Using this method, those skilled in the art can modify the 5' and 3' UTR lengths required to achieve optimal translation efficiency after transfection of transcribed RNA.

[0386] The 5' and 3' UTRs can be naturally occurring endogenous 5' and 3' UTRs of the target gene. Alternatively, endogenous UTR sequences of non-target genes can be added by incorporating UTR sequences into the forward and reverse primers or by making any other modifications to the template. Using endogenous UTR sequences of non-target genes can be used to improve RNA stability and / or translation efficiency. For example, it is known that AU enrichment in 3' UTR sequences reduces mRNA stability. Therefore, based on the well-known properties of UTRs in the art, 3' UTRs can be selected or designed to improve the stability of transcribed RNA.

[0387] In one embodiment, the 5' UTR may contain the Kozak sequence of an endogenous gene. Alternatively, when a 5' UTR that is not endogenous to the target gene is added by PCR as described above, a shared Kozak sequence can be redesigned by adding the 5' UTR sequence. Kozak sequences can improve the translation efficiency of some RNA transcripts, but it appears that not all RNAs require a Kozak sequence for efficient translation. The requirement for Kozak sequences in numerous mRNAs is known in the art. In other embodiments, the 5' UTR may be derived from an RNA virus whose RNA genome is stable in cells. In other embodiments, various nucleotide analogs may be used in the 3' or 5' UTR to inhibit exonuclease degradation of the mRNA.

[0388] To synthesize RNA from a DNA template without gene cloning, a transcription promoter is ligated to the DNA template upstream of the sequence to be transcribed. When the sequence serving as the RNA polymerase promoter is added to the 5' end of the forward primer, the RNA polymerase promoter is integrated into the PCR product upstream of the open reading frame to be transcribed. In one embodiment, the promoter is the T7 polymerase promoter, as described elsewhere herein. Other useful promoters include, but are not limited to, the T3 and SP6 RNA polymerase promoters. The common nucleotide sequences of the T7, T3, and SP6 promoters are known in the art.

[0389] In one implementation, the mRNA has a 5' cap and a 3' poly(A) tail, which determine ribosome binding, initiation of translation, and mRNA stability in the cell. On a circular DNA template (e.g., plasmid DNA), RNA polymerase produces a long, concave product unsuitable for expression in eukaryotic cells. Transcription of plasmid DNA linearized at the 3' UTR end results in a normal-sized mRNA, which is ineffective in eukaryotic transfection even if it is polyadenylated post-transcriptionally.

[0390] On a linear DNA template, phage T7 RNA polymerase can extend the 3' end of the transcript beyond the last base of the template (Schenborn and Mierendorf, Nuc Acids Res., 13:6223-36 (1985); Nacheva and Berzal-Herranz, Eur. J. Biochem., 270:1485-65 (2003)).

[0391] The poly(A) / T fragment of the transcribed DNA template can be generated during PCR using a reverse primer containing a poly(T) tail (such as a 100T tail, the size of which can be 50-5000T)), or after PCR by any other method, including but not limited to DNA ligation or in vitro recombination. The poly(A) tail also provides stability to the RNA and reduces its degradation. Generally, the length of the poly(A) tail is positively correlated with the stability of the transcribed RNA. In one embodiment, the length of the poly(A) tail is between 100 and 5000 adenosine.

[0392] Following in vitro transcription using a poly(A) polymerase (such as E. coli polyA polymerase (E-PAP)), the poly(A) tail of RNA can be further lengthened. In one embodiment, increasing the length of the poly(A) tail from 100 nucleotides to 300-400 nucleotides results in approximately a two-fold increase in RNA translation efficiency. Furthermore, attaching different chemical groups to the 3' end can increase mRNA stability. This attachment can include modified / artificial nucleotides, aptamers, and other compounds. For example, ATP analogs can be bound to the poly(A) tail using a poly(A) polymerase. ATP analogs can further enhance RNA stability.

[0393] The 5' cap also provides stability to the RNA molecule. In a preferred embodiment, the RNA produced by the methods disclosed herein contains a 5' cap. The 5' cap is provided using techniques known in the art and also described herein (Cougot, et al., Trends in Biochem. Sci., 29:436-444 (2001); Stepinski, et al., RNA, 7:1468-95 (2001); Elango, et al., Biochim. Biophys. Res. Commun., 330:958-966 (2005)).

[0394] In some implementations, RNA is electroporated into cells, such as RNA transcribed in vitro. Any solute suitable for cell electroporation may be included, and it may contain factors that promote cell permeability and viability, such as sugars, peptides, lipids, proteins, antioxidants, and surfactants.

[0395] In some embodiments, the nucleic acid encoding the CAR disclosed herein will be RNA, for example, in vitro synthesized RNA. Methods for synthesizing RNA in vitro are known in the art; any known method can be used to synthesize RNA containing a sequence encoding a CAR. Methods for introducing RNA into host cells are also known in the art. See, for example, Zhao et al. Cancer Res. (2010) 15: 9053. The introduction of RNA containing a nucleotide sequence encoding a CAR into host cells can be performed in vitro, ex vivo, or in vivo. For example, host cells (e.g., NK cells, cytotoxic T lymphocytes, etc.) can be electroporated in vitro or ex vivo with RNA containing a nucleotide sequence encoding a CAR.

[0396] The disclosed methods can be applied to the regulation of T cell activity in basic research and treatment, in fields such as cancer, stem cells, acute and chronic infections, and autoimmune diseases, including assessing the ability of genetically modified T cells to kill target cancer cells.

[0397] The method also provides the ability to control expression levels over a wide range by changing, for example, the promoter or the amount of input RNA, allowing for individual modulation of expression levels. Furthermore, PCR-based mRNA production technology has greatly facilitated the design of mRNAs with different structures and combinations of their domains.

[0398] One advantage of the RNA transfection method of this invention is that RNA transfection is essentially transient and vector-free. RNA transgenes can be delivered to lymphocytes and expressed in lymphocytes as a minimal expression cassette after brief in vitro cell activation, without requiring any additional viral sequences. Under these conditions, transgene integration into the host cell genome is unlikely. Cell cloning is unnecessary due to the efficiency of RNA transfection and its ability to uniformly modify the entire lymphocyte population.

[0399] Genetic modification of T cells using in vitro transcribed RNA (IVT-RNA) employed two distinct strategies, both of which have been tested in various animal models. Cells were transfected with in vitro transcribed RNA via liposome transfection or electroporation. The aim was to stabilize the IVT-RNA using various modifications to achieve prolonged expression of the transferred IVT-RNA.

[0400] Several IVT vectors are known in the literature, used in a standardized manner as templates for in vitro transcription, and have been genetically modified to produce stable RNA transcripts. The current approach used in this field is based on a plasmid vector with the following structure: a 5' RNA polymerase promoter capable of RNA transcription, followed by a target gene flanked by a 3' and / or 5' region of untranslated region (UTR), and a 3' poly(A) cassette containing 50–70 A nucleotides. Prior to in vitro transcription, the circular plasmid is linearized downstream of the poly(A) cassette using a type II restriction endonuclease (the recognition sequence corresponds to the cleavage site). Thus, the poly(A) cassette corresponds to the poly(A) sequence at the end of the transcript. Due to this process, some nucleotides remain as part of the enzyme cleavage site after linearization and extend or mask the poly(A) sequence at the 3' end. It is unclear whether this non-physiological overhang affects the amount of protein produced by this construct in cells.

[0401] On the other hand, RNA constructs are delivered into cells via electroporation. See, for example, formulations and methods for electroporating nucleic acid constructs into mammalian cells taught in US 2004 / 0014645, US 2005 / 0052630A1, US 2005 / 0070841A1, US 2004 / 0059285A1, and US 2004 / 0092907A1. The various parameters (including electric field strength) required for electroporating any known cell type are generally known in relevant research literature and in numerous patents and patent applications in this field. See, for example, US Patent Nos. 6,678,556, 7,171,264, and 7,173,116. Devices for electroporation therapeutic applications are commercially available, such as the MedPulser™ DNA Electroporation Therapy System (Inovio / Genetronics, San Diego, California), and are described in patents such as U.S. Patent Nos. 6,567,694, 6,516,223, 5,993,434, 6,181,964, 6,241,701, and 6,233,482. Electroporation can also be used for in vitro cell transfection, as described in US20070128708A1. Electroporation can also be used to deliver nucleic acids into cells in vitro. Therefore, utilizing any of the numerous available devices and electroporation systems known to those skilled in the art, electroporation-mediated application of nucleic acids (including expression constructs) into cells presents an exciting new means of delivering target RNA to target cells.

[0402] J. Pharmaceutical Compositions and Formulations The invention also provides immune cell populations, compositions containing such cells and / or rich in such cells, such as those expressing CAR comprising at least 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of a certain type of cell (such as T cells or CD8+ or CD4+ cells). These compositions are pharmaceutical compositions and formulations (formulations) for administration, such as for adoptive cell therapy. Treatment methods for administering cells and compositions to subjects, such as patients, are also provided.

[0403] Also provided are cell-containing compositions for administration, including pharmaceutical compositions and formulations, such as unit dosage form compositions, which contain a number of cells administered at a given dose or in portions thereof. Pharmaceutical compositions and formulations typically contain one or more optional pharmaceutically acceptable carriers or excipients. In some embodiments, the composition contains at least one additional therapeutic agent.

[0404] The term "pharmaceutical formulation" refers to a preparation in a form that allows the bioactivity of the active ingredient contained therein to be effective and that does not contain any additional ingredients that would cause unacceptable toxicity to the subject of administration of the formulation. "Pharmaceutically acceptable carrier" refers to a component of a pharmaceutical formulation other than the active ingredient that is non-toxic to the subject. Pharmaceutically acceptable carriers include, but are not limited to, buffers, excipients, stabilizers, or preservatives. In some aspects, the choice of carrier is partly determined by the specific cells and / or by the method of administration. Therefore, there are a variety of suitable formulations. For example, a pharmaceutical composition may contain a preservative. Suitable preservatives may include, for example, methylparaben, propylparaben, sodium benzoate, and benzalkonium chloride. In some aspects, a mixture of two or more preservatives is used. Preservatives or mixtures thereof are typically present in an amount from about 0.0001% to about 2% by weight of the total composition. Carriers are described, for example, in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980). Pharmaceutically acceptable carriers are generally non-toxic to the recipient at the doses and concentrations used and include, but are not limited to: buffers, such as phosphates, citrates, and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (such as octadecyl dimethyl benzyl ammonium chloride; hexamethyl diammonium chloride; benzalkonium chloride; benzyl chloride; phenol; butyl or benzyl alcohol; alkyl esters of p-hydroxybenzoate, such as methylparaben or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanediol); Alcohols; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents such as EDTA; sugars, such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions, such as sodium; metal complexes (e.g., zinc-protein complexes); and / or nonionic surfactants, such as polyethylene glycol (PEG).

[0405] In some aspects, a buffer is included in the composition. Suitable buffers include, for example, citric acid, sodium citrate, phosphoric acid, potassium phosphate, and various other acids and salts. In some aspects, a mixture of two or more buffers is used. Buffers or mixtures thereof are typically present in an amount from about 0.001% to about 4% by weight of the total composition. Methods for preparing administerable pharmaceutical compositions are known. Exemplary methods are described in more detail, for example, in Remington: Science and Practice of Pharmacy, Lippincott Williams & Wilkins; 21st edition (May 1, 2005).

[0406] The formulation may comprise an aqueous solution. The formulation or composition may also contain one or more active ingredients for a specific indication, disease, or condition requiring cell therapy, preferably those having activities complementary to the cells, wherein the respective activities do not adversely affect each other. Such active ingredients are suitable to be present in a combination of amounts effective for the intended purpose. Therefore, in some embodiments, the pharmaceutical composition also comprises other pharmaceutically active agents or drugs, such as chemotherapeutic agents, such as asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vincristine, and / or vinblastine. In some embodiments, the pharmaceutical composition contains an amount of cells effective in treating or preventing the disease or condition, such as a therapeutically effective amount or a preventatively effective amount. In some embodiments, therapeutic or preventative efficacy is monitored by periodically assessing the treated subject. The desired dose may be delivered by a single bolus injection of cells, by multiple bolus injections of cells, or by continuous infusion of cells.

[0407] Formulations are available for oral, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, intranasal, oral, sublingual, or suppository administration. In some embodiments, cell populations are administered parenterally. The term "parenterally" as used herein includes intravenous, intramuscular, subcutaneous, rectal, vaginal, and intraperitoneal administration. In some embodiments, cells are administered to the subject via peripheral systemic delivery, such as intravenous, intraperitoneal, or subcutaneous injection. In some embodiments, the composition is provided as a sterile liquid formulation, such as an isotonic aqueous solution, suspension, emulsion, dispersion, or viscous composition, which in some respects may be buffered to a selected pH. Liquid formulations are generally easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, liquid compositions are more convenient to administer, especially by injection, to some extent. On the other hand, viscous compositions can be formulated within a suitable viscosity range to provide a longer period of contact with a particular tissue. Liquid or viscous compositions may include a carrier, which may be a solvent or a dispersion medium containing, for example, water, brine, phosphate-buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol) and suitable mixtures thereof.

[0408] Sterile injectable solutions can be prepared by incorporating cells into a solvent, such as by mixing with a suitable carrier, diluent, or excipient (e.g., sterile water, physiological saline, glucose, dextrose, etc.). The composition may contain excipients such as wetting agents, dispersants or emulsifiers (e.g., methylcellulose), pH buffers, gelling or viscosity-enhancing additives, preservatives, flavoring agents, and / or pigments, depending on the route of administration and the desired formulation. In some respects, standard texts can be referenced to prepare suitable formulations.

[0409] Various additives can be added to enhance the stability and sterility of the composition, including antimicrobial preservatives, antioxidants, chelating agents, and buffers. Various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, and sorbic acid, can be used to ensure protection against microorganisms. Extended absorption of injectable drug forms can be achieved by using delayed-absorption agents (such as aluminum monostearate and gelatin).

[0410] Preparations intended for internal administration are typically sterile. For example, sterility can be easily achieved through filtration using a sterile filter membrane.

[0411] The contents of any articles, patents, and patent applications mentioned or cited herein, as well as all other documents and electronically available information, are incorporated herein by reference in their entirety as if each individual publication were specifically and individually indicated as incorporated herein by reference. The applicant reserves the right to actually incorporate any and all material and information from any such articles, patents, patent applications, or other physical or electronic documents into this application.

[0412] Although the invention has been described with reference to specific embodiments thereof, those skilled in the art will understand that various changes can be made and equivalents can be substituted without departing from the true spirit and scope of the invention. It will be readily apparent to those skilled in the art that other suitable modifications and alterations can be made to the methods described herein using appropriate equivalents without departing from the scope of the embodiments disclosed herein. Furthermore, numerous modifications can be made to suit specific circumstances, materials, compositions of matter, processes, or one or more process steps according to the purpose, spirit, and scope of the invention. All such modifications are intended to be within the scope of the appended claims. Certain embodiments have now been described in detail and will be more clearly understood by referring to the following examples, which are included for illustrative purposes and not intended to be limiting.

[0413] Experimental Examples The invention will now be described with reference to the following embodiments. These embodiments are provided for illustrative purposes only, and the invention is not limited to these embodiments, but covers all variations that will be apparent from the teachings provided herein.

[0414] Materials and methods Cell lines and culture: Human GSC line (5077) was derived from resected tumor tissue obtained from the University of Pennsylvania Institutional Review Board with the written informed consent of the patient (Department of Neurosurgery, Perelman School of Medicine, Philadelphia, PA). It was maintained in DMEM F12 Ham (Corning, Corning, NY) supplemented with penicillin / streptomycin, GlutaMAX-1, B27-A, epidermal growth factor, and basic fibroblast growth factor. U87MG cell line was obtained from the American Type Culture Collection (ATCC HTB-14) and cultured in MEM containing GlutaMAX-1, HEPES, pyruvate, penicillin / streptomycin (Thermo Fisher Scientific, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS). The cell line was engineered to express EGFRvIII protein, click beetle green luciferase, and green fluorescent protein through single-cell purification and expansion. The PC3 prostate cancer cell line was obtained from ATCC (CRL-1435) and cultured in D10 medium consisting of DMEM supplemented with 10% FBS, HEPES, penicillin, and streptomycin. D270 glioma cells were grown and passaged in the flanks of NSG mice. The human glioma cell line U251 was provided by Dr. Jay Dorsey (Department of Radiation Oncology, University of Pennsylvania). Routine screening of cell identity and mycoplasma contamination was performed.

[0415] Immunohistochemical staining: Immunohistochemical staining was performed on tissue sections derived from NSG mice using recombinant anti-TGFβ1 antibody (ab215715, Abcam, Waltham, Boston) and DAPI. These mice had been implanted with U87 and D270 gliomas intracranially, a process facilitated by Daniel Martinez (Pathology Core Laboratory of the Children's Hospital of Philadelphia Research Institute, PA). Tissue sections from the mouse spleen and cerebral cortex served as positive and negative controls, respectively.

[0416] Carrier builder: The 806-Hu07-mCherry CAR was assembled by combining EGFR-targeting scFv (806) and IL13Rα2-targeting scFv (Hu07), which were synthesized and ligated into a pTRPE lentiviral vector with an EF1α promoter. The construct was capped with mCherry (Twist Bioscience, San Francisco, CA). The dnTGFβRII structure was digested using AvrII and SalI enzymes and ligated into the 806-Hu07-mCherry construct at the same enzyme site, replacing the mCherry gene to produce the 806-Hu07 dnTGFβRII CAR construct. CAR dnTGFβRII-M5 was donated to Joseph A. Fraietta of the Perelman School of Medicine, University of Pennsylvania. The control CAR-CD19 was donated to the laboratory of Carl H. June of the University of Pennsylvania. Apart from the scFv component, all CARs have the same second-generation CAR structure.

[0417] Human T cell transduction and in vitro culture: Lentiviral cells were packaged into HEK 293 T cells using the split genome approach and titrated using SUPT1 cells from ATCC (CRL-1942). Normal human T cells were isolated from PBMCs at the Human Immunology Core at the University of Pennsylvania and transduced using lentiviral vectors. T cells were stimulated for 5 days with Dynabeads human T activator CD3 / CD28 (Life Technologies, Carlsbad, CA) at a bead-to-cell ratio of 3:1. Cell concentration was measured using a Coulter Multisizer (Beckman Coulter, Brea, CA) and maintained at 0.7 × 10⁻⁶ cells / year. 6 Cells were cultured at 10 cells / mL until completely static at a volume of approximately 300 fl. Cells were then cultured in R10 medium (RPMI-1640 supplemented with GlutaMAX-1, HEPES, pyruvate, penicillin / streptomycin, and 10% FBS) containing 30 IU / mL rhIL-2 (Thermo Fisher Scientific, Carlsbad, CA). CAR T cells were then cryopreserved in a mixture of 90% FBS and 10% DMSO for future use.

[0418] TGF-β ELISA: Tumor cell lines were administered at 3 × 10⁻⁶ per flask. 6 Culture at a density of 100 cells for 3 days. Collect the conditioned medium by centrifugation and store at -80°C. Medium containing 10% fetal bovine serum is expected to produce additional TGF-β1 secretion. Therefore, control medium should be used as a blank and subtracted from the sample. Treat the thawed conditioned medium with a TGF-β1 ELISA kit (R&D, DY240-05) and dilute the sample fourfold before activating the potential TGF-β1 into an immunoreactive form.

[0419] Bioluminescent cytotoxicity assay: U87vIII-CBG luciferase target cells and effector T cells were used with different effector:target ratios, with 20 ng / ml hTGF-β- 1. Co-culture with culture medium alone for 16 hours. Before measuring luminescence, 15 μg of D-luciferin (GoldBiotechnology, St. Louis, MO) was added and incubated at room temperature for 10 minutes. Luminescence was measured using a BioTek Synergy H4 hybrid multimode microplate reader. When calculating cytotoxicity results, target cells were defined as exhibiting 0% lysis alone, with maximum lysis observed upon treatment with 5% SDS solution (Thermo Fisher Scientific, Carlsbad, CA).

[0420] Proliferation assay: U87vIII cells were irradiated with 10,000 rad for 40 min. Subsequently, in 12-well plates containing 4 ml of R10 medium, 20 ng / ml human TGF-β1 or medium alone was added, followed by the addition of 0.2 × 10⁻⁶ cells. 6 One tumor cell and 1×10 6 T cells were cultured in a triplet co-culture. If the medium turned yellow around day 4 or 5, additional medium was added. On days 7, 14, and 21, 1–2 ml of supernatant was collected from each well, centrifuged, and stored at -80°C for subsequent cytokine analysis (Evetechnologies, Calgary, Canada). The T cells were then resuspended, counted using a Beckman-Coulter Multisizer 3 cell counter, and 1 × 10⁶ cells were added. 6 One T cell was transferred to a new 0.2 × 10⁻⁶ cell. 6 In the irradiated U87vIII cells, proliferation assays were performed weekly, and the remaining T cells were phenotypically and CAR expression stained.

[0421] Impedance cytotoxicity assay: 2×10 5 Target tumor cells were seeded into 96-well plates containing Axion Biosystems microelectrodes (Axion Biosystems, Atlanta, GA). Prior to the experiment, the cells were seeded at 37°C using 20... Each impedance plate was prepared by coating with g / mL laminin overnight. After coating, the wells were rinsed three times with deionized water, and then 100 g / mL laminin was used to coat each plate. L-cell culture medium was used to cover the plate. The plate was placed in an Axion Biosystems ZHT analyzer (Axion Biosystems, Atlanta, GA) to record baseline readings of background impedance in the absence of cells. After establishing the baseline, the plate was removed from the analyzer and the readings were recorded at 200 °C. L / well volume seeding 5×10 5Target cells. After seeding, the plates were placed in a cell culture hood at room temperature for 1 hour to ensure cell settling and attachment to the microelectrodes on the bottom surface. The plates were then returned to the analyzer and data collection began. Data were collected every minute for 24 hours for cell monolayer growth measurements. For cytotoxicity assessment, the instrument was paused for 24 hours and the culture medium was exchanged for medium containing 1:1 doses of effector cells or UTD control T cells, or medium only. As previously mentioned, changes in impedance were reported as the resistive component of the complex impedance. All data for “medium only” were corrected using AxIS Z software (Axion Biosystems, Atlanta, GA) to eliminate small changes in impedance over time and then normalized to the impedance at the time effector cells were added. % cell lysis (cytolysis) was calculated using untreated controls and fully lysed controls to determine the percentage of target cell lysis, as shown below: Flow cytometry: Analysis was performed using a 5-laser LSR Tortessa flow cytometer. Cells were first stained with live / dead viability staining agent in PBS (Thermo Fisher Scientific, Carlsbad, CA). Then, they were stained with appropriate antibodies for 30 minutes in FACS buffer (PBS containing 0.5% BSA) at 4°C. CAR expression was detected using biotinylated protein L (GenScript) antibody and streptavidin-conjugated PE (BD Biosciences). PE anti-human TGF-β receptor II antibody (399703) was used to detect dnTGFβRII expression on CARs. The phosphorylation-SMAD2 / 3 capacity of CAR T cells was detected using BD Phosflow antibody (562586). CD69-FITC (clone FN50, BioLegend) and CD25-PerCP / Cyanine5.5 (clone BC96, BioLegend) were used to detect T cell activation.

[0422] Co-culture assay: In the co-culture experiment, transduced or UTD T cells (2 × 10⁶ cells per well in 100 μL R10 medium) were cultured. 5 (100 cells) and target cells (2 × 10⁶ cells per well in 100 L R10 medium) 5T cells were cultured in 96-well round-bottom tissue culture plates at 37°C and 5% CO2 for 16 or 20 hours. In the PD-1 marker staining assay, live / dead viability staining (ThermoFisher Scientific, Carlsbad, CA) was used, followed by human CD3 (clone OKT3, BioLegend, San Diego, CA) staining to differentiate transduced or UTD T cells. PD-1 expression was detected using BV711-conjugated anti-human PD-1 (clone EH12.2H7, BioLegend, San Diego, CA). In the T cell phenotype assay, transduced or UTD T cells (5 × 10⁶ cells per well in 500 μL R10 medium) were cultured in 48-well flat-bottom tissue culture plates. 5 (100 cells) and target cells (2.5 × 10⁶ cells per well in 500 μL R10 medium) 5 Co-culture with T cells (units). Target cells were irradiated with 10,000 rad before co-culturing with T cells. On days 2 and 4, 2.5 × 10⁶ cells were added to each well. 5 Target cells were irradiated. After 5 days of co-culture, 500 μL of supernatant was removed from each well, gently resuspended, and 250 μL of cells were transferred to a 96-well circular plate for staining. Human T cells were distinguished by live / dead viability staining (Thermo Fisher Scientific, Carlsbad, CA) followed by staining with human CD3 and CD8 (clones OKT3 and SK1, BioLegend, San Diego, CA). T cell phenotype was detected using BV711-conjugated anti-human CD45RA (clone HI100, BioLegend, San Diego, CA) and APC-conjugated anti-human CCR7 (clone G043H7, BioLegend, San Diego, CA). Staining was appropriately controlled with allotype antibodies. Cells were washed twice with PBS (FACS buffer) containing 2% fetal bovine serum before and after each staining. Fluorescence was assessed using a BD LSR Fortessa flow cytometer, and data were analyzed using FlowJo software.

[0423] Mouse model: All mouse experiments were conducted according to protocols approved by the Institutional Animal Care and Use Committee (IACUC). In the isotopic tumor model, 5 × 10⁻⁶ mice were used. 5 Intracranial implantation of 5 × 10 U87MG-CBG-GFP cells or [other cells] 5D270MG-CBG-GFP cells were subcutaneously implanted into 6- to 8-week-old NSG mice. Intracranial surgical implantation was performed using a stereotactic surgical setup, with tumor cells implanted 2 mm to the right and 2 mm anterior to the zygomatic point, and 2 mm into the brain. In the subcutaneous model, NSG mice were subcutaneously injected with 5 × 10⁵ D270MG-CBG-GFP cells in 100 µL PBS on day 0. 5 D270 tumors were implanted. Tumor progression was assessed by luminescence emission on the Xenogen IVIS spectrum following intraperitoneal injection of D-fluorescein (GoldBiotechnology, St. Louis, MO) as directed by the manufacturer. During the experiment, the length and width of the subcutaneous tumors were measured using calipers. The tumor size was calculated as the tumor area by multiplying the two dimensions. 7–8 days post-tumor implantation, T cells containing a total volume of 100 µL of PBS were injected intravenously via the tail vein. Survival was tracked over time until the predetermined IACUC-approved endpoint was reached.

[0424] Statistical analysis: Data are expressed as mean ± SEM. TCGA RNA-seq data were analyzed using the Kruskal-Wallis test. Proliferation assays were analyzed using unpaired t-tests. Impedance and cell lysis assays were analyzed using ordinary one-way ANOVA with Tukey's test to compare differences between groups. Flow cytometry was analyzed using two-way ANOVA with Tukey's test to compare differences between groups. Survival curves were analyzed using the Kaplan-Meier (log-rank) test. For in vivo tumor studies, linear regression was used to test for significant differences between experimental groups. Survival rates were plotted using Kaplan-Meier curves based on time to the experimental endpoint. All statistical analyses were performed using Prism software version 9 (GraphPad, LaJolla, CA).

[0425] Example 1: Armored bicistronic CAR T cells with dominant-negative TGF-β receptor II reduce Antigenic heterogeneity and suppressive immune microenvironment in glioblastoma Clinical trials of CAR T-cell therapy in glioblastoma (GBM) have identified several key challenges to efficacy, including the inherent heterogeneous genomic landscape and immunosuppressive tumor microenvironment (TME) found in GBM. Previous studies have shown that monovalent CAR T-cell therapy targeting EGFR variant III (EGFRvIII) reduces the target-positive tumor cell population, but tumor recurrence is caused by target-negative tumor cells, highlighting the limitations of monotarget approaches in heterogeneous tumors (O'Rourke et al., (2017). Sci Transl Med 9. 10.1126 / scitranslmed.aaa0984). Regarding the highly immunosuppressive TME in GBM, transforming growth factor-β (TGFβ) is present in the GBM TME and serves as a major driver of the suppression of anti-GBM responses in clinical samples. TGFβ is consistently highly expressed in GBM tumor cell lines and patient tumor tissues ( Figure 2A-2D ).

[0426] Two independent parallel scFv constructs targeting IL13Rα2 and EGFRvIII and truncated dominant-negative (dn) TGF were used. Designing trivalent constructs (CART-EGFR-IL3Rα2-dnTGFβ) using receptor II ( Figure 1 , Figures 3A-3B This trivalent construct was designed to explore potential additive effects in in vitro and in vivo GBM model systems to limit tumor escape and overcome immunosuppressive GBM-TME. The CART-EGFR-IL13Rα2-dnTGFb construct broadened the targeted tumor cell repertoire, blocked TGFβ signaling (Figure 3), and acted as a sink for free TGFβ in GBM-TME to overcome TGFβ. Its inhibitory function.

[0427] In vitro, the trimodal CAR T construct (i.e., the trivalent construct (CART-EGFF-IL13Rα2-dnTGFβ)) exhibited enhanced proliferation response compared to the CART-EGFR-IL13Rα2 construct. Figure 7 In co-culture assays, this construct resulted in decreased PD-1 expression compared to the bicistronic CAR T construct. Figure 5 ) and increased effect phenotype ( Figure 9A -D), indicating a low proportion of depleted T cells. Trimodal CAR T cells blocked the inhibitory pSmad2 / 3 signaling pathway, leading to unhindered activation ( Figures 6A-6B ) and uninhibited proliferative response, although there was no significant enhancement of tumor-killing activity in short-term co-culture ( Figures 4A-4BIn immunodeficient mouse models, compared with mice using dnTGF-deficient mice... Compared to mice treated with bicistronic CART-EGFR-IL13Rα2 cells of receptor II, the trimodal CART cells safely and effectively eradicated tumor cells, and the mice had a longer median survival.

[0428] Overcoming adaptive changes in local TME and addressing antigenic heterogeneity are necessary to improve the clinical efficacy of CAR T-directed strategies. Current work demonstrates that bicistronic CAR constructs with truncated TGF... Receptor II works effectively. Combining dominant-negative TGFβRII with CAR-EGFR-IL13Rα2 offers several benefits, including CAR T cell suppression and immunosuppressive TGF. The signal also showed reduced PD-1 expression. Figure 5 ), exhibiting significant proliferative capacity in an in vitro chronic stimulation model ( Figure 7 It has no side effects in the body and enhances the eradication of GBM tumors in the body. Figure 10A -D, Figure 11). In summary, the three-module CAR T construct TGFβRII CART-EGFR-IL13Rα2 described in this article addresses the clinical challenges of antigenic heterogeneity and immunosuppressive TME in GBM.

[0429] List of implementation methods The following implementation methods are provided, and their numbers should not be interpreted as indicating a level of importance.

[0430] Implementation 1 provides a nucleic acid comprising a) a first polynucleotide sequence encoding a first chimeric antigen receptor (CAR) comprising a first antigen-binding domain, a transmembrane domain, and an intracellular domain for binding human IL13Rα2; b) a second polynucleotide sequence encoding a second CAR comprising a second antigen-binding domain, a transmembrane domain, and an intracellular domain for binding epidermal growth factor receptor (EGFR) or an isotype thereof; and c) a third polynucleotide sequence encoding a dominant-negative TGFβ type II receptor (DN-TGFβRII).

[0431] Implementation 2 provides the nucleic acid of Implementation 1, wherein the first and / or second antigen-binding domain is selected from full-length antibodies or their antigen-binding fragments, Fab, single-chain variable region fragments (scFv), or single-domain antibodies.

[0432] Embodiment 3 provides a nucleic acid according to any of the foregoing embodiments, wherein the first antigen-binding domain comprises: a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence TKYGVH (SEQ ID NO: 1), HCDR2 comprises the amino acid sequence GVKWAGGSTDYNSALMS (SEQ ID NO: 3), and HCDR3 comprises the amino acid sequence DHRDAMDY (SEQ ID NO: 4); and a light chain variable region comprising three light chain complementarity-determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASLSVSSTYLH (SEQ ID NO: 5), LCDR2 comprises the amino acid sequence STSNLAS (SEQ ID NO: 6), and LCDR3 comprises the amino acid sequence HQYHRSPLT (SEQ ID NO: 7).

[0433] Embodiment 4 provides a nucleic acid of any of the foregoing embodiments, wherein the first antigen-binding domain comprises a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 8; and / or a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 9.

[0434] Implementation 5 provides a nucleic acid of any of the foregoing embodiments, wherein the first antigen-binding domain is a single-stranded variable region fragment (scFv) comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 10 or 11.

[0435] Embodiment 6 provides a nucleic acid of any of the foregoing embodiments, wherein the first polynucleotide sequence encodes a CAR, the CAR comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 23 or 24.

[0436] Embodiment 7 provides a nucleic acid according to any of the foregoing embodiments, wherein the second antigen-binding domain comprises: a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence GYSITSDFAWN (SEQ ID NO: 25), HCDR2 comprises the amino acid sequence GYISYSGNTRYNPSLK (SEQ ID NO: 26), and HCDR3 comprises the amino acid sequence VTAGRGFPYW (SEQ ID NO: 27); and a light chain variable region comprising three light chain complementarity-determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence HSSQDINSNIG (SEQ ID NO: 28), LCDR2 comprises the amino acid sequence HGTNLDD (SEQ ID NO: 29), and LCDR3 comprises the amino acid sequence VQYAQFPWT (SEQ ID NO: 30).

[0437] Embodiment 8 provides a nucleic acid of any of the foregoing embodiments, wherein the second antigen-binding domain comprises a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 31; and / or a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 32.

[0438] Embodiment 9 provides a nucleic acid of any of the foregoing embodiments, wherein the second antigen-binding domain is a single-stranded variable region fragment (scFv) comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 33 or 71.

[0439] Embodiment 10 provides a nucleic acid of any of the foregoing embodiments, wherein the second polynucleotide sequence encodes a CAR, the CAR comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 35 or 75.

[0440] Embodiment 11 provides a nucleic acid of any of the foregoing embodiments, wherein the DN-TGFβRII comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 2.

[0441] Implementation 12 provides a nucleic acid of any of the foregoing embodiments, wherein the nucleic acid encodes an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 77 or 79.

[0442] Implementation 13 provides any of the nucleic acids described in the foregoing embodiments, wherein the transmembrane domain is selected from artificial hydrophobic sequences and the transmembrane domains of type I transmembrane proteins, the α, β or ζ chains of T cell receptors, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, OX40 (CD134), 4-1BB (CD137) and CD154, or the transmembrane domain of a suicide immunoglobulin-like receptor (KIR).

[0443] Implementation 14 provides a nucleic acid of any of the foregoing embodiments, wherein the transmembrane domain comprises the transmembrane domain of CD8.

[0444] Implementation 15 provides the nucleic acid of Implementation 13, wherein the transmembrane domain of CD8 is the transmembrane domain of CD8α.

[0445] Implementation 16 provides a nucleic acid of any of the foregoing embodiments, wherein the intracellular domain comprises a co-stimulatory signal transduction domain and an intracellular signal transduction domain.

[0446] Implementation 17 provides a nucleic acid of any of the foregoing embodiments, wherein the intracellular domain comprises a co-stimulatory domain of a protein selected from the TNFR superfamily, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS, NKG2C, and B7-H3 (CD276) or variants thereof, or an intracellular domain derived from a suicide immunoglobulin-like receptor (KIR).

[0447] Implementation 18 provides a nucleic acid of any of the foregoing embodiments, wherein the intracellular domain comprises a 4-1BB co-stimulatory domain.

[0448] Embodiment 19 provides a nucleic acid of any of the foregoing embodiments, wherein the intracellular signal transduction domain comprises an intracellular domain selected from: human CD3ζ chain (CD3ζ), FcγRIII, FcsRI, the cytoplasmic tail region of the Fc receptor, a cytoplasmic receptor carrying an immune receptor tyrosine-based activation motif (ITAM), an intracellular signal transduction domain of TCRζ, FcRγ, CD3γ, CD3-δ, CD3ε, CD5, CD22, CD79a, CD79b and CD66d, or variants thereof.

[0449] Implementation 20 provides a nucleic acid of any of the foregoing embodiments, wherein the intracellular signal transduction domain comprises the intracellular domain of CD3ζ.

[0450] Embodiment 21 provides a nucleic acid comprising a first polynucleotide sequence encoding a chimeric antigen receptor (CAR) capable of binding IL13Rα2 and a second polynucleotide sequence encoding a dominant-negative TGFβ type II receptor (DN-TGFβRII), wherein the CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen-binding domain comprises: a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence TKYGVH (SEQ ID NO: 1), HCDR2 comprises the amino acid sequence GVKWAGGSTDYNSALMS (SEQ ID NO: 3), and HCDR3 comprises the amino acid sequence DHRDAMDY (SEQ ID NO: 4); and a light chain variable region comprising three light chain complementarity-determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASLSVSSTYLH (SEQ ID NO: 5), LCDR2 comprises the amino acid sequence STSNLAS (SEQ ID NO: 6), and LCDR3 comprises the amino acid sequence HQYHRSPLT (SEQ ID NO: 5). 7).

[0451] Implementation 22 provides the nucleic acid of Implementation 20, wherein the antigen-binding domain comprises a heavy chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 8; and / or a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 9.

[0452] Implementation 23 provides the nucleic acid of Implementation 20, wherein the antigen-binding domain is scFv, the scFv comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 10 or 11.

[0453] Embodiment 24 provides the nucleic acid of Embodiment 20, wherein the CAR comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 23, 24, 42, or 43.

[0454] Embodiment 25 provides a nucleic acid as described in any one of Embodiments 20-23, wherein the DN-TGFβRII comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 2.

[0455] Embodiment 26 provides a nucleic acid comprising a first polynucleotide sequence encoding a CAR and a second polynucleotide sequence encoding a dominant-negative TGFβ type II receptor (DN-TGFβRII)...

Claims

1. A nucleic acid comprising The first polynucleotide sequence encoding the first chimeric antigen receptor (CAR) includes a first antigen-binding domain, a transmembrane domain, and an intracellular domain that bind to human IL13Rα2. The second polynucleotide sequence encoding the second CAR includes a second antigen-binding domain that binds to the epidermal growth factor receptor (EGFR) or its isotype, a transmembrane domain, and an intracellular domain. The third polynucleotide sequence encoding the dominant-negative TGFβ type II receptor (DN-TGFβRII).

2. The nucleic acid according to claim 1, wherein the first antigen-binding domain and / or the second antigen-binding domain are selected from full-length antibodies or their antigen-binding fragments, Fab, single-chain variable region fragments (scFv), or single-domain antibodies.

3. The nucleic acid according to any one of the preceding claims, wherein the first antigen-binding domain comprises: The heavy chain variable region comprises three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence TKYGVH (SEQ ID NO: 1), HCDR2 contains the amino acid sequence GVKWAGGSTDYNSALMS (SEQ ID NO: 3), and HCDR3 contains the amino acid sequence DHRDAMDY (SEQ ID NO: 4); and The light chain variable region comprises three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence TASLSVSSTYLH (SEQ ID NO: 5), LCDR2 contains the amino acid sequence STSNLAS (SEQ ID NO: 6), and LCDR3 contains the amino acid sequence HQYHRSPLT (SEQ ID NO: 7).

4. The nucleic acid according to any one of the preceding claims, wherein the first antigen-binding domain comprises a heavy chain variable region, the heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 8; and / or a light chain variable region, the light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

9.

5. The nucleic acid according to any one of the preceding claims, wherein the first antigen-binding domain is a single-stranded variable region fragment (scFv), the single-stranded variable region fragment comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 10 or 11.

6. The nucleic acid according to any one of the preceding claims, wherein the first polynucleotide sequence encodes a CAR, the CAR comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 23, 24, 42, or 43.

7. The nucleic acid according to any one of the preceding claims, wherein the second antigen-binding domain comprises: The heavy chain variable region comprises three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence GYSITSDFAWN (SEQ ID NO: 25), HCDR2 contains the amino acid sequence GYISYSGNTRYNPSLK (SEQ ID NO: 26), and HCDR3 contains the amino acid sequence VTAGRGFPYW (SEQ ID NO: 27); and The light chain variable region comprises three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence HSSQDINSNIG (SEQ ID NO: 28), LCDR2 contains the amino acid sequence HGTNLDD (SEQ ID NO: 29), and LCDR3 contains the amino acid sequence VQYAQFPWT (SEQ ID NO: 30).

8. The nucleic acid according to any one of the preceding claims, wherein the second antigen-binding domain comprises a heavy chain variable region, the heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 31; and / or a light chain variable region, the light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

32.

9. The nucleic acid according to any one of the preceding claims, wherein the second antigen-binding domain is a single-stranded variable region fragment (scFv), the single-stranded variable region fragment comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 33 or 71.

10. The nucleic acid according to any one of the preceding claims, wherein the second polynucleotide sequence encodes a CAR, the CAR comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 35 or 75.

11. The nucleic acid according to any one of the preceding claims, wherein the DN-TGF RII contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:

2.

12. The nucleic acid according to any one of the preceding claims, wherein the nucleic acid encodes an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 77 or 79.

13. The nucleic acid according to any one of the preceding claims, wherein the transmembrane domain is selected from the transmembrane domains of artificial hydrophobic sequences and type I transmembrane proteins, the α, β or ζ chains of T cell receptors, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, OX40 (CD134), 4-1BB (CD137) and CD154, or the transmembrane domain of a suicide immunoglobulin-like receptor (KIR).

14. The nucleic acid according to any one of the preceding claims, wherein the transmembrane domain comprises the transmembrane domain of CD8.

15. The nucleic acid according to claim 9, wherein the transmembrane domain of CD8 is the transmembrane domain of CD8α.

16. The nucleic acid according to any one of the preceding claims, wherein the intracellular domain comprises a co-stimulatory signal transduction domain and an intracellular signal transduction domain.

17. The nucleic acid according to any one of the preceding claims, wherein the intracellular domain comprises a co-stimulatory domain of a protein selected from the TNFR superfamily, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS, NKG2C, and B7-H3 (CD276) or variants thereof, or an intracellular domain derived from a suicide immunoglobulin-like receptor (KIR).

18. The nucleic acid according to any one of the preceding claims, wherein the intracellular domain comprises a 4-1BB co-stimulatory domain.

19. The nucleic acid according to any one of the preceding claims, wherein the intracellular signal transduction domain comprises an intracellular domain selected from: human CD3ζ chain (CD3ζ), FcγRIII, FcsRI, the cytoplasmic tail region of the Fc receptor, a cytoplasmic receptor carrying an immune receptor tyrosine-based activation motif (ITAM), an intracellular domain of TCRζ, FcRγ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b and CD66d, or variants thereof.

20. The nucleic acid according to any one of the preceding claims, wherein the intracellular signal transduction domain comprises the intracellular domain of CD3ζ.

21. A nucleic acid comprising a first polynucleotide sequence encoding a chimeric antigen receptor (CAR) capable of binding to IL13Rα2 and a dominant-negative TGF-β2. The second polynucleotide sequence of the type II receptor (DN-TGFβRII), The CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen-binding domain comprises: The heavy chain variable region comprises three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence TKYGVH (SEQ ID NO: 1), HCDR2 contains the amino acid sequence GVKWAGGSTDYNSALMS (SEQ ID NO: 3), and HCDR3 contains the amino acid sequence DHRDAMDY (SEQ ID NO: 4); and The light chain variable region comprises three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence TASLSVSSTYLH (SEQ ID NO: 5), LCDR2 contains the amino acid sequence STSNLAS (SEQ ID NO: 6), and LCDR3 contains the amino acid sequence HQYHRSPLT (SEQ ID NO: 7).

22. The nucleic acid of claim 21, wherein the antigen-binding domain comprises a heavy chain variable region encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 8; and / or a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

9.

23. The nucleic acid according to claim 21, wherein the antigen-binding domain is scFv, the scFv comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 10 or 11.

24. The nucleic acid according to claim 21, wherein the CAR comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 23, 24, 42, or 43.

25. The nucleic acid according to any one of claims 21-24, wherein the DN-TGF RII contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:

2.

26. A nucleic acid comprising The first polynucleotide sequence encoding a CAR, said CAR comprising an antigen-binding domain binding to epidermal growth factor receptor (EGFR) or an isotype thereof, a transmembrane domain, and an intracellular domain, and Encoding dominant-negative TGF Type II receptor (DN-TGF) The second polynucleotide sequence of RII).

27. The nucleic acid according to claim 26, wherein the antigen-binding domain comprises a heavy chain variable region, the heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 31; and / or a light chain variable region, the light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

32.

28. The nucleic acid according to claim 26, wherein the antigen-binding domain is scFv, the scFv comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 33 or 71.

29. The nucleic acid according to claim 26, wherein the CAR comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 23, 24, 35, 42, 43, or 75.

30. The nucleic acid according to claim 26, wherein the DN-TGF RII contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:

2.

31. The nucleic acid according to claim 26, wherein the nucleic acid encodes an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 81, 83, or 85.

32. A nucleic acid comprising a first polynucleotide sequence encoding a first CAR capable of binding IL13Rα2, a second polynucleotide sequence encoding a second CAR capable of binding epidermal growth factor receptor (EGFR) or an isotype thereof, and encoding a dominant-negative TGF. Type II receptor (DN-TGF) The third polynucleotide sequence of RII, wherein: The first CAR includes an antigen-binding domain, the antigen-binding domain comprising: The heavy chain variable region comprises three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence TKYGVH (SEQ ID NO: 1), HCDR2 contains the amino acid sequence GVKWAGGSTDYNSALMS (SEQ ID NO: 3), and HCDR3 contains the amino acid sequence DHRDAMDY (SEQ ID NO: 4); and The light chain variable region comprises three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence TASLSVSSTYLH (SEQ ID NO: 5), LCDR2 contains the amino acid sequence STSNLAS (SEQ ID NO: 6), and LCDR3 contains the amino acid sequence HQYHRSPLT (SEQ ID NO: 7), and The second CAR includes an antigen-binding domain, which comprises: The heavy chain variable region comprises three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence GYSITSDFAWN (SEQ ID NO: 25), HCDR2 contains the amino acid sequence GYISYSGNTRYNPSLK (SEQ ID NO: 26), and HCDR3 contains the amino acid sequence VTAGRGFPYW (SEQ ID NO: 27); and The light chain variable region comprises three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence HSSQDINSNIG (SEQ ID NO: 28), LCDR2 contains the amino acid sequence HGTNLDD (SEQ ID NO: 29), and LCDR3 contains the amino acid sequence VQYAQFPWT (SEQ ID NO: 30), and The DN-TGF RII contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:

2.

33. A nucleic acid comprising a first polynucleotide sequence encoding a first CAR capable of binding IL13Rα2, a second polynucleotide sequence encoding a second CAR capable of binding epidermal growth factor receptor (EGFR) or an isotype thereof, and a DN-TGF-encoding ... The third polynucleotide sequence of RII, in which: The first CAR includes: The heavy chain variable region is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 44 or 54; and The light chain variable region is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 48 or 58; and The second CAR includes: The heavy chain variable region is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 73; and The light chain variable region is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

74.

34. A nucleic acid comprising a first polynucleotide sequence encoding a first CAR capable of binding IL13Rα2, a second polynucleotide sequence encoding a second CAR capable of binding epidermal growth factor receptor (EGFR) or an isotype thereof, and a DN-TGF-encoding ... The third polynucleotide sequence of RII, in which: The first CAR comprises a single-stranded variable region fragment (scFv) encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 64, 65, 66, or 69; and The second CAR comprises a single-stranded variable region fragment (scFv) encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

70.

35. A nucleic acid comprising a first polynucleotide sequence encoding a first chimeric antigen receptor capable of binding IL13Rα2, a second polynucleotide sequence encoding a second chimeric antigen receptor (CAR) capable of binding epidermal growth factor receptor (EGFR) or its isotype, and encoding DN-TGF. The third polynucleotide sequence of RII, in which: The first polynucleotide sequence comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 62, or SEQ ID NO: 63; and The second polynucleotide sequence comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

34.

36. The nucleic acid according to any one of claims 32-35, wherein the DN-TGF RII contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:2, or is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

14.

37. The nucleic acid according to any one of the preceding claims, wherein the first polynucleotide sequence and the second polynucleotide sequence are separated by a linker.

38. The nucleic acid according to any one of the preceding claims, wherein the second polynucleotide sequence and the third polynucleotide sequence are separated by a linker.

39. The nucleic acid according to any one of the preceding claims, wherein the nucleic acid comprises a second polynucleotide sequence of 5' to 3', a linker, and a first polynucleotide sequence.

40. The nucleic acid according to any one of the preceding claims, wherein the nucleic acid comprises a second polynucleotide sequence of 5' to 3', a linker, a first polynucleotide sequence, a linker, and a third polynucleotide sequence.

41. A vector comprising the nucleic acid of any one of the preceding claims.

42. The carrier according to claim 41, wherein the carrier is an expression carrier.

43. The vector according to claim 41 or 42, wherein the vector is selected from DNA vectors, RNA vectors, plasmids, lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, and retroviral vectors.

44. The vector according to any one of claims 41-43, further comprising the EF-1 promoter.

45. The vector according to any one of claims 41-44, further comprising a marmot hepatitis virus post-transcriptional regulatory element (WPRE).

46. ​​The carrier according to any one of claims 41-45, further comprising a rev-responsive element (RRE).

47. The vector according to any one of claims 41-46, further comprising a cPPT sequence.

48. The carrier according to any one of claims 41-47, wherein the carrier is a self-deactivating carrier.

49. A modified immune cell or its precursor cell, comprising a nucleic acid according to any one of claims 1-40 or a vector according to any one of claims 41-48.

50. A modified immune cell or its precursor cell, comprising: A first chimeric antigen receptor (CAR), comprising a first antigen-binding domain capable of binding IL13Rα2; and The second chimeric antigen receptor (CAR) includes a second antigen-binding domain capable of binding to the epidermal growth factor receptor (EGFR) or its isotype. and dominant-negative TGF Type II receptor (DN-TGF) RII).

51. A modified immune cell or its precursor cell, comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGF) RII), where: The first CAR includes: The heavy chain variable region comprises three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence TKYGVH (SEQ ID NO: 1) or SRNGMS (SEQ ID NO: 12), HCDR2 contains the amino acid sequence GVKWAGGSTDYNSALMS (SEQ ID NO: 3) or TVSSGGSYIYYADSVKG (SEQ ID NO: 13), and HCDR3 contains the amino acid sequence DHRDAMDY (SEQ ID NO: 4) or QGTTALATRFFDV (SEQ ID NO: 15); and The light chain variable region comprises three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence TASLSVSSTYLH (SEQ ID NO: 5) or KASQDVGTAVA (SEQ ID NO: 16), LCDR2 contains the amino acid sequence STSNLAS (SEQ ID NO: 6) or SASYRST (SEQ ID NO: 17), and LCDR3 contains the amino acid sequence HQYHRSPLT (SEQ ID NO: 7) or QHHYSAPWT (SEQ ID NO: 18); and The second CAR includes: The heavy chain variable region comprises three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence GYSITSDFAWN (SEQ ID NO: 25), HCDR2 contains the amino acid sequence GYISYSGNTRYNPSLK (SEQ ID NO: 26), and HCDR3 contains the amino acid sequence VTAGRGFPYW (SEQ ID NO: 27); and The light chain variable region comprises three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence HSSQDINSNIG (SEQ ID NO: 28), LCDR2 contains the amino acid sequence HGTNLDD (SEQ ID NO: 29), and LCDR3 contains the amino acid sequence VQYAQFPWT (SEQ ID NO: 30).

52. A modified immune cell or its precursor cell, comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGF) RII), where: The first CAR includes: Heavy chain variable region, the heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 8 or 19; and / or A light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 9 or 20; and The second CAR includes: Heavy chain variable region, said heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 31; and / or The light chain variable region comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

32.

53. A modified immune cell or its precursor cell, comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGF) RII), where: The first CAR includes a single-stranded variable region fragment (scFv) containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 10 or 11; and The second CAR includes a single-stranded variable region fragment (scFv) containing an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 33 or 71.

54. A modified immune cell or its precursor cell, comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGF) RII), where: The first CAR contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 23, 24, 42, or 43; and The second CAR contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 35 or 75.

55. A modified immune cell or its precursor cell, comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGF) RII), where: The first CAR includes: The heavy chain variable region is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 44 or 54; and The light chain variable region is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 48 or 58; and The second CAR includes: The heavy chain variable region is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 73; and The light chain variable region is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

74.

56. A modified immune cell or its precursor cell, comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGF) RII), where: The first CAR comprises an scFv encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 64, 65, 66, or 69; and The second CAR comprises an scFv encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

70.

57. A modified immune cell or its precursor cell, comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGF) RII), where: The first polynucleotide sequence comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 62, or SEQ ID NO: 63; and The second polynucleotide sequence comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

34.

58. The modified immune cell or its precursor cell according to any one of claims 51-57, wherein the DN-TGF RII contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 2, or is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

14.

59. The modified cell according to any one of claims 49-58, wherein the second CAR is capable of binding to an EGFR isotype selected from: wild-type EGFR (wtEGFR), mutant EGFR, EGFR A289V EGFR A289D EGFR A289T EGFR A289T EGFR R108K EGFRR 108G EGFR G598V EGFR D126Y EGFR C628F EGFR R108K / A289V EGFR R108K / D126Y EGFR A289V / G598V EGFR A289V / C628F and EGFR variant II, or any combination thereof.

60. The modified cell according to any one of claims 49-59, wherein the modified cell is a modified T cell.

61. The modified cell according to any one of claims 49-60, wherein the modified cell is an autologous cell.

62. The modified cell according to any one of claims 49-61, wherein the modified cell is an autologous cell obtained from a human subject.

63. The modified cells according to any one of claims 49-62, wherein the DN-TGF RII contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:

2.

64. A pharmaceutical composition comprising a therapeutically effective amount of modified cells according to any one of claims 49-63.

65. A method of treating a disease in a subject in need of treatment, comprising administering to said subject an effective amount of a modified cell according to any one of claims 49-63 or a pharmaceutical composition according to claim 64.

66. The method of claim 65, wherein the disease is cancer.

67. The method of claim 66, wherein the cancer is a glioma.

68. The method according to claim 65 or 66, wherein the cancer is an astrocytoma.

69. The method according to any one of claims 65-68, wherein the cancer is a high-grade astrocytoma.

70. The method according to any one of claims 65-68, wherein the cancer is glioblastoma.

71. A method of treating glioblastoma in a subject in need of treatment, comprising administering an effective amount of modified T cells to the subject, the modified T cells comprising: A first chimeric antigen receptor (CAR), comprising a first antigen-binding domain capable of binding IL13Rα2; and The second chimeric antigen receptor (CAR) comprises a second antigen-binding domain capable of binding to epidermal growth factor receptor (EGFR) or its isotype; and dominant-negative TGF. Type II receptor (DN-TGF) RII).

72. A method of treating glioblastoma in a subject in need of treatment, comprising administering an effective amount of modified T cells to the subject, said modified T cells comprising: a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its allotype, and a dominant-negative TGF. Type II receptor (DN-TGFβRII), among which The first CAR includes: The heavy chain variable region comprises three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence TKYGVH (SEQ ID NO: 1) or SRNGMS (SEQ ID NO: 12), HCDR2 contains the amino acid sequence GVKWAGGSTDYNSALMS (SEQ ID NO: 3) or TVSSGGSYIYYADSVKG (SEQ ID NO: 13), and HCDR3 contains the amino acid sequence DHRDAMDY (SEQ ID NO: 4) or QGTTALATRFFDV (SEQ ID NO: 15); and The second CAR includes: The heavy chain variable region comprises three heavy chain complementarity-determining regions (HCDRs), wherein HCDR1 contains the amino acid sequence GYSITSDFAWN (SEQ ID NO: 25), HCDR2 contains the amino acid sequence GYISYSGNTRYNPSLK (SEQ ID NO: 26), and HCDR3 contains the amino acid sequence VTAGRGFPYW (SEQ ID NO: 27); and The light chain variable region comprises three light chain complementarity-determining regions (LCDRs), wherein LCDR1 contains the amino acid sequence HSSQDINSNIG (SEQ ID NO: 28), LCDR2 contains the amino acid sequence HGTNLDD (SEQ ID NO: 29), and LCDR3 contains the amino acid sequence VQYAQFPWT (SEQ ID NO: 30).

73. A method of treating glioblastoma in a subject in need, comprising administering an effective amount of modified T cells to the subject, said modified T cells comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its allotype, and a dominant-negative TGF. Type II receptor (DN-TGFβRII), of which: The first CAR includes: The heavy chain variable region comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 8 or 19; and A light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 9 or 20; and The second CAR includes: Heavy chain variable region, said heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 31; and / or The light chain variable region comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

32.

74. A method of treating glioblastoma in a subject in need, comprising administering an effective amount of modified T cells to the subject, said modified T cells comprising: a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its allotype, and a dominant-negative TGF. Type II receptor (DN-TGFβRII), of which: The first CAR contains an scFv, the scFv containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 21, or SEQ ID NO: 22, and The second CAR contains scFv, which contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 33 or 71.

75. A method of treating glioblastoma in a subject in need of treatment, comprising administering an effective amount of modified T cells to the subject, said modified T cells comprising: a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGFβRII), of which: The first CAR contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 42, or SEQ ID NO: 43; and The second CAR contains an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 35 or 75.

76. The method according to any one of claims 71-75, wherein the DN-TGF RII contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 2, or is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

2.

77. A method of treating glioblastoma in a subject in need of treatment, comprising administering an effective amount of modified T cells to the subject, said modified T cells comprising a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its isotype, and a dominant-negative TGF. Type II receptor (DN-TGFβRII), of which: The first CAR includes: The heavy chain variable region is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 44 or 54; and The light chain variable region is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 48 or 58; and The second CAR includes: The heavy chain variable region is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 73; and The light chain variable region is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

74.

78. A method of treating glioblastoma in a subject in need, comprising administering an effective amount of modified T cells to the subject, said modified T cells comprising: a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its allotype, and a dominant-negative TGF. Type II receptor (DN-TGFβRII), of which: The first CAR comprises an scFv encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 64, 65, 66, or 69; and The second CAR comprises an scFv encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

70.

79. A method of treating glioblastoma in a subject in need, comprising administering an effective amount of modified T cells to the subject, said modified T cells comprising: a first CAR capable of binding IL13Rα2, a second CAR capable of binding EGFR or its allotype, and a dominant-negative TGF. Type II receptor (DN-TGFβRII), of which: The first CAR contains a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 62, or SEQ ID NO: 63; and The second CAR contains a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

34.

80. The method according to any one of claims 77-79, wherein the DN-TGF RII contains an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:2, or is encoded by a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:

14.

81. A method of treating glioblastoma in a subject in need of treatment, comprising administering an effective amount of modified T cells to the subject, said modified T cells comprising a polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 76 or 78.

Images