Tetrahedral framework nucleic acid placenta targeted nano delivery system as well as preparation method and application thereof

Abstract

The invention discloses a tetrahedral framework nucleic acid placenta targeted nano delivery system as well as a preparation method and application thereof. The functionalized tetrahedral framework nucleic acid nanostructure is formed by assembling six single-stranded DNA (deoxyribonucleic acid), and nucleotide sequences of the single-stranded DNA are shown as SEQ ID NO.1-6. The six-arm DNA tetrahedron nano-structure constructed by the invention has controllable nano-size, programmable characteristic and good molecular recognition characteristic, can endow a nano-carrier with marker recognition capability by taking a nucleic acid aptamer as a molecular navigation unit, is accumulated in placenta tissue under the action of active targeting or specific enrichment, and can be used for preparing a biomarker. Therefore, the enrichment efficiency of the medicine at the placenta part is obviously improved; the method is helpful for realizing intervention treatment on the limited growth of the fetus, reducing non-targeted exposure to the maternal body and the fetus, and improving the overall safety of treatment.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a tetrahedral framework nucleic acid placenta-targeted nano delivery system, a preparation method and application thereof. BACKGROUND

[0002] Fetal Growth Restriction (FGR) is one of the common and serious pregnancy complications in obstetrics, which is widely defined as the failure of the fetus to achieve its genetically determined growth potential, and its clinical features are usually manifested as fetal weight or abdominal circumference less than the 10th percentile of the same gestational age fetus. The incidence of FGR is about 5% to 10% in all pregnancies. FGR not only significantly increases the intrauterine mortality rate and perinatal morbidity of the fetus, but also is closely related to the risk of stillbirth. In addition to short-term hazards such as low birth weight, FGR also has a profound impact on long-term health, including an increased risk of chronic diseases such as hypertension, obesity, coronary heart disease, stroke, diabetes, and metabolic syndrome in adulthood. FGR is a complex disease with multiple factors and mechanisms, but placental development abnormalities or dysfunction has been widely recognized as one of the core reasons for its occurrence and development. Current research generally believes that the pathogenesis of FGR can be divided into two stages: the first stage occurs in the early stage of pregnancy, mainly manifested as abnormal development of trophoblasts and poor remodeling of spiral arteries, leading to insufficient placental perfusion; the second stage occurs in the middle and late stages of pregnancy, further developing downstream complications such as placental growth restriction, ischemia-reperfusion injury, angiogenesis / anti-angiogenic factor imbalance, increased oxidative stress, and placental nutrient and substance transport dysfunction. In terms of specific mechanisms, it is currently believed that the occurrence of placental FGR may be closely related to the following factors: (1) individualized defects in uterine endometrial decidualization before embryo implantation, leading to poor early placental development; (2) maternal immune tolerance disorder to fetal antigens; (3) incomplete remodeling of uterine spiral arteries, causing insufficient placental perfusion, hypoxia, and local inflammation; (4) imbalance between angiogenic factors (such as VEGF) and anti-angiogenic factors (such as sFlt-1) in maternal blood, etc.

[0003] Although important progress has been made in recent years on the relationship between placental dysfunction and FGR, due to the special nature of drugs during pregnancy, any potential drug with therapeutic effect may have toxic effects on the fetus and mother, thereby affecting the pregnancy outcome. Therefore, the current clinical treatment of FGR is still mainly prevention and pregnancy management, and there is still a lack of precise and effective drug treatment methods, and timely termination of pregnancy is still the main measure to deal with severe FGR. At present, targeted placental precise drug delivery for the treatment of fetal growth restriction is a research hotspot and the direction of future treatment.

[0004] However, the current targeting system has the following defects and limitations: (1) The commonly used inorganic / organic nanocarriers (such as quantum dots, magnetic nanoparticles, liposomes, polymer microparticles, etc.) rely on multi-step modification to achieve targeting function, and the synthesis process is complex. (2) Most hard nanomaterials such as gold, silver and copper have biological non-degradability, which has accumulation toxicity effect in vivo and is not easy to degrade, limiting their clinical use in pregnancy and maternal-fetal system. (3) miRNA is easily degraded by nucleases in vivo, and conventional delivery systems are difficult to protect its biological activity, affecting its effectiveness and targeting efficiency. The use of these nanomaterials in clinical treatment will have potential adverse reactions. (4) FGR is a complex and comprehensive disease with complex mechanisms, and a single target or a single treatment strategy is difficult to reverse the pathological process comprehensively, especially under the premise of ensuring maternal-fetal safety, intelligent and precise delivery of multi-modal collaborative treatment strategies has become a research focus in the future.

[0005] Therefore, it is urgent to develop a new type of nanocarrier system that can achieve placenta-targeted delivery of miRNA nucleic acid drugs, with good biocompatibility, high delivery efficiency and targeting, to realize the intervention of FGR pathological process and the precise regulation of placental function.

[0006] Aptamer (Apt) is an oligonucleotide fragment that can bind to a specific target with high affinity and specificity, and has high specificity, low immunogenicity and good targeting. In recent years, it has been widely studied for use in targeted drug delivery systems. The field of research has found that placenta-specific protein 1 (PLAC1) is a membrane protein specifically expressed in placental tissue, mainly distributed on the surface of trophoblast cells. Therefore, using a nucleic acid aptamer that can specifically recognize PLAC1 as a targeting element to construct an intelligent delivery system that can recognize placental tissue has important research and clinical application prospects.

[0007] In recent years, DNA nanomaterials, especially DNA tetrahedral structures, have attracted widespread attention in the field of nanobiomedicine due to their high programmability, good biocompatibility and stability. DNA tetrahedron is formed by self-assembly of a set of oligonucleotides, and has the advantages of size controllability, sequence designability, strong targeting and high delivery efficiency, and is particularly suitable for nucleic acid drug delivery including miRNA. Compared with traditional nanomaterials (such as liposomes, polymer nanoparticles, inorganic nanomaterials, etc.), DNA nanomaterials not only have good biodegradability and low toxicity, but also can achieve efficient targeted delivery to specific cells or tissues by combining with aptamers. SUMMARY

[0008] In view of the problems of complex synthesis, poor biological safety, immunocompatibility risk, low miRNA delivery efficiency and limited effect of single treatment strategy in the prior art, the application provides a tetrahedral framework nucleic acid placenta-targeted nano delivery system and a preparation method and application thereof.

[0009] The application designs a six-arm tetrahedral nanostructure (TDN) constructed by six short DNA fragments through self-assembly.

[0010] The 3' end of each chain contains a sticky end overhanging sequence, facilitating the complementary connection of miR-26a and Apt chain.

[0011] The application provides a functionalized tetrahedral framework nucleic acid formed by self-assembly of six single-stranded DNAs, and the nucleotide sequence of the single-stranded DNA is shown in SEQ ID NO. 1-6.

[0012] In some embodiments, the tetrahedral framework nucleic acid is modified with a nucleic acid aptamer and miR-26a, and the nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO. 7.

[0013] In some embodiments, the molar ratio of the tetrahedral framework nucleic acid to miR-26a is (1-2):(1-2), preferably 1:1.

[0014] In some embodiments, the functionalized tetrahedral framework nucleic acid nanodelivery system has a diameter of 50-80 nm.

[0015] The application also provides a nucleic acid nanomedicine for intervening fetal growth restriction, which comprises the functionalized tetrahedral framework nucleic acid.

[0016] The application also provides a placenta-targeted nanodelivery system of tetrahedral framework nucleic acid, which comprises the functionalized tetrahedral framework nucleic acid.

[0017] The application also provides an application of the placenta-targeted nanodelivery system in constructing a placenta-specific miRNA delivery platform.

[0018] The application also provides a preparation method of the placenta-targeted nanodelivery system, which comprises the following steps:

[0019] (1) mixing six single-stranded DNAs and aptamers in an annealing buffer to self-assemble a tetrahedral framework nucleic acid nanostructure, and obtaining TDN-Apt;

[0020] (2) incubating the TDN-Apt with miR-26a at room temperature to obtain the placenta-targeted nanodelivery system TDN-Apt-miR26a.

[0021] The application also provides an application of the functionalized tetrahedral framework nucleic acid nanodelivery system in preparing a medicine for intervening fetal growth restriction.

[0022] In some embodiments, the medicine intervenes in the treatment of fetal growth restriction by improving placental angiogenesis disorders, relieving placental oxidative stress or improving placental inflammatory infiltration.

[0023] In summary, compared with the prior art, the application achieves the following technical effects:

[0024] 1. The 6-arm DNA tetrahedral nanostructure constructed in the application has controllable nanosize, specific codeability and good molecular target recognition characteristics, can be accumulated in placental tissue through passive targeting or specific enrichment, thereby significantly improving the enrichment efficiency of the nucleic acid nanomedicine in the placenta, helping to realize precise intervention treatment of fetal growth restriction, reducing non-targeted exposure to the mother and fetus, and improving the overall safety of the treatment.

[0025] 2. The functionalized tetrahedral framework nucleic acid and the placenta-targeted nanodelivery system of the application belong to biological endogenous nucleic acid materials, have excellent biocompatibility and degradability, can be gradually degraded into mononucleotides in the body, and are reabsorbed into the nucleotide circulation and metabolic absorption and utilization, have no persistent toxicity, and have good safety and generalizability in clinical use.

[0026] 3、The present application realizes a multi-mode combined treatment strategy integrating multiple biological functions such as promoting angiogenesis, anti-inflammation and promoting cell proliferation by loading therapeutic microRNA-26a (miR-26a) into a DNA tetrahedral framework nucleic acid nano delivery platform, which is significantly superior to traditional single treatment means, and can more comprehensively intervene in the placental angiogenesis disorder, placental oxidative stress and placental inflammatory infiltration problems existing in placental origin fetal growth restriction, and improve the intervention treatment effect.

[0027] 4、The TDN-Apt-miR-26a complex constructed in the present application can be targeted to the placenta and will not enter the fetus, and this "placenta targeting, fetus avoiding" delivery mode reduces the potential risk of systemic toxicity of the drug to the mother and fetus, and has good clinical transformation value.

[0028] Obviously, according to the above content of the present application, according to the ordinary technical knowledge and conventional means in the art, other various forms of modifications, replacements or changes can be made without departing from the above basic technical ideas of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0029] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed in the embodiments will be briefly introduced as follows, and it should be understood that the following drawings only show some embodiments of the present application, and therefore should not be regarded as a limitation on the scope, and other related drawings can be obtained by those skilled in the art without creative labor on the premise of not departing from the above technical ideas.

[0030] Figure 1 The present application is used for intervening FGR, and the schematic diagram of the multifunctional DNA tetrahedral framework nucleic acid nano delivery system TDN-Apt-miR26a targeted intervention FGR is outlined.

[0031] Figure 2Figure A is the gel electrophoresis result: 1: blank, 2: S1, 3: S1+S2, 4: S1+S2+S3, 5: S1+S2+S3+S4, 6: S1+S2+S3+S4+S5, 7: S1+S2+S3+S4+S5+S6 (TDN), 8: TDN-miR26a; Figure B is the atomic force microscope image of TDN-miR26a; Figure C is the hydrodynamic diameter of TDN and TDN-miR26a at different concentrations; Figure D is the transmission electron microscope image; Figure E is the zeta potential diagram; Figure F is the flow detection of TDN and TDN-miR26a; Figure G is the effect of TDN, TDN-miR26a, and TDN-Apt-miR26a at different concentrations on cell viability (after 12 hours of addition) detected by CCk8; Figure H is the fluorescence imaging diagram, scale bar: 50 μm, green: lysozyme tracker; red: FAM-labeled TDN and TDN-Apt-miR26a; blue: Hoechst 33342-stained nucleus.

[0032] Figure 3 Figure A is the schematic diagram of the experimental design for evaluating the anti-inflammatory activity of RAW264.7 macrophages; Figure B is the relative mRNA expression level of miR26a in the treatment groups; Figure C is the mRNA expression of anti-inflammatory markers (ARG1, YM1) and pro-inflammatory markers (TNF-α, iNOS); Figures D-E are the western blot analysis of the protein expression levels of TNF-α, IL-6, iNOS, COX-2 (pro-inflammatory markers), IL-10, Arg1, and Ym1 (anti-inflammatory markers), respectively, and the data are expressed as mean ± standard deviation; compared with the LPS treatment group, *P<0.05, **P<0.01, ***P<0.001.

[0033] Figure 4Results of miR26a modulating angiogenic activity for Example 4 of the present application; Figure A: relative mRNA expression of VEGF in HUVECs treated with different formulations: Ctrl (control), I (TDN), II (TDN-Apt), III (TDN-miR26a), IV (TDN-Apt-miR26a); Figure B: Western blot analysis of EGFR and galectin-3 protein expression in HUVECs; Figure C: Transwell migration assay; Figure D: quantitative analysis of Transwell migration results (mean ± standard deviation; *P < 0.05, **P < 0.01 vs. Ctrl); Figure E: Western blot analysis of angiogenesis-related proteins (ANG-1, HIF-1a, TGF-b, VEGFA, Smad) in HUVECs; Figures F-G: in vitro angiogenesis assay (tube formation) and statistical quantification of nodes, junctions and meshwork; Figure H: scratch assay to evaluate HUVEC migration after treatment (scale bar: 200 pm), Ctrl: untreated control, I: TDN, II: TDN-Apt, III: TDN-miR-26a, IV: TDN-Apt-miR26a; *P < 0.05, **P < 0.01, ***P < 0.001.

[0034] Figure 5 Antioxidant mechanism of TDN-Apt-miR26a for Example 5 of the present application; Figure A: schematic representation of the proposed antioxidant pathway mediated by TDN-Apt-miR26a; Figure B: flow cytometry analysis of reactive oxygen species (ROS) levels in HTR-8 cells treated with TDN-Apt-miR26a under oxidative stress; Figure C: cell viability assay (CCK-8) demonstrating the protective effect of TDN-Apt-miR26a against H2O2-induced cytotoxicity; Figures D-E: apoptosis analysis by Annexin V / PI staining showing TDN-Apt-miR26a-mediated inhibition of apoptosis induced by oxidative stress; Figures F-G: cell cycle analysis by propidium iodide (PI) staining revealing the modulation of cell cycle progression induced by TDN-Apt-miR26 under oxidative conditions.

[0035] Figure 6Figure A is a schematic of tail vein injection dosing regimen: prophylactic regimen (A, pre-FGR induction) and therapeutic regimen (B, post-FGR induction); Figure B is in vivo fluorescence imaging of pregnant mice showing CY3-labeled TDN-Apt-miR26a accumulation in the placenta, while the fetus is not exposed (pseudocolor scale: red = high signal); Figure C is immunofluorescence co-localization of CY3-labeled TDN-Apt-miR26a (red) with cytokeratin 7 (CK7, green) in placental tissue, confirming decidual-specific targeting (scale bar: 50 μm); Figure D is a schematic of fetal and placental specimen collection; Figure E is statistical analysis of fetal to placental weight ratio and fetal weight, *P < 0.05, **P < 0.01 compared with Dex group; n = 6; Figure F is hematoxylin and eosin (H&E) staining of fetal tissues highlighting morphological recovery in TDN-Apt-miR26a group (scale bar: 200 μm); Figure G is Western blot analysis of epidermal growth factor receptor (EGFR) and galectin-3 protein expression in placental tissue; Figures H-I are Doppler ultrasound parameters of uterine and umbilical artery blood flow, respectively, correlating hemodynamic improvement with FGR alleviation.

[0036] Figure 7 Figure A is a schematic of tail vein injection dosing regimen: prophylactic regimen (A, pre-FGR induction) and therapeutic regimen (B, post-FGR induction); Figure B is in vivo fluorescence imaging of pregnant mice showing CY3-labeled TDN-Apt-miR26a accumulation in the placenta, while the fetus is not exposed (pseudocolor scale: red = high signal); Figure C is immunofluorescence co-localization of CY3-labeled TDN-Apt-miR26a (red) with cytokeratin 7 (CK7, green) in placental tissue, confirming decidual-specific targeting (scale bar: 50 μm); Figure D is a schematic of fetal and placental specimen collection; Figure E is statistical analysis of fetal to placental weight ratio and fetal weight, *P < 0.05, **P < 0.01 compared with Dex group; n = 6; Figure F is hematoxylin and eosin (H&E) staining of fetal tissues highlighting morphological recovery in TDN-Apt-miR26a group (scale bar: 200 μm); Figure G is Western blot analysis of epidermal growth factor receptor (EGFR) and galectin-3 protein expression in placental tissue; Figures H-I are Doppler ultrasound parameters of uterine and umbilical artery blood flow, respectively, correlating hemodynamic improvement with FGR alleviation. DETAILED DESCRIPTION

[0037] For those skilled in the art, the technical solutions in the embodiments of the present application are described clearly and completely to make the present application better understood. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work should belong to the protection scope of the present application.

[0038] The application provides a placenta-targeted miRNA nanodelivery system based on a DNA tetrahedral framework nucleic acid, which integrates structural construction, targeted modification, functional nucleic acid sequence loading and in-vivo and in-vitro function verification into one, and forms a complete and efficient fetal growth restriction (FGR) treatment technology path. By modifying a targeted placental aptamer on the TDN structure and loading miR-26a with angiogenesis and anti-inflammatory functions, a nanodelivery system (TDN-Apt-miR-26a) with placental targeting and biological activity is constructed. The system shows good biological stability and cell uptake efficiency, and has multiple biological characteristics such as anti-inflammatory, antioxidant, promoting angiogenesis and promoting trophoblast proliferation. In the FGR animal model, by injecting TDN-Apt-miR-26a through the tail vein, the fetal growth restriction phenotype induced by dexamethasone can be effectively improved, and the average weight and blood flow of the placenta and fetus can be significantly improved, thereby providing a theoretical basis and technical support for the clinical intervention of FGR.

[0039] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials, reagents, etc. used can be obtained from commercial channels.

[0040] Example 1 Construction and characterization of TDN-Apt-miR26a delivery system

[0041] Synthesis of TDN-Apt-miR26a:

[0042] Six ssDNA single strands (S1-S6) with different sequences were mixed with the Apt strand in the annealing buffer TM Buffer (10 mM Tris, 5 mM MgCl2, pH 8.0), and the final concentration of the ssDNA single strand was 200 nM. After mixing, it was placed in a metal bath and heated at 95°C for 5 minutes, and then slowly cooled to room temperature to obtain TDN-Apt. Then TDN-Apt (final concentration 100 nM) and miR-26a (concentration 100 nM, double-stranded sequence as shown in SEQ ID NO. 8-9) were incubated at room temperature for 1 hour to form TDN-Apt-miR26a complex.

[0043] The construction of TDN-Apt-miR26a is based on the design principle of DNA self-assembly and is theoretically evaluated by UNPACK and SEQUIN programs. The tetrahedral skeleton DNA and miR26a are self-assembled in one step at a molar ratio of 1:1 in vitro, and are prepared by optimizing the annealing process.

[0044] The TDN-Apt-miR26a six-arm tetrahedral self-assembly process was verified by agarose gel electrophoresis. The diluted TDN-Apt-miR26a was dropped on the surface of the mica sheet, and after vacuum freeze-drying overnight, AFM was used to detect its micro-morphology.

[0045] Agarose gel electrophoresis analysis showed that TDN was gradually assembled Figure 2 A). Atomic force microscope (AFM) images and transmission electron microscope (TEM) images showed that the diameter of TDN-Apt-miR26a nanoparticles modified by miR26a was about 65 nm Figure 2 B, 2D). Dynamic light scattering (DLS) Figure 2 C) and zeta potential Figure 2 E) characterization further confirmed that the optimal ratio of miR26a to TDN was 1:1, and the size was between 100 nm.

[0046] Good biocompatibility and safety are essential for TDN nucleic acid nano-platform to deliver miR26a. Cell counting kit-8 (CCK8) was used to analyze the cytotoxicity of different concentrations of TDN and TDN-miR26a on HTR-8. The results are shown in Figure 2 F, that is, even at high concentrations, TDN, TDN-miR26a and TDN-Apt-miR26a have little effect on cell viability, indicating that TDN-Apt-miR26a has good biocompatibility. Based on the results of CCK8, 200 nM was determined as the optimal concentration of TDN and TDN-Apt-miR26a for subsequent studies Figure 2 F).

[0047] Example 2 Characteristics and cellular uptake of TDN-Apt-miR26a

[0048] 1. Laser confocal detection of cell uptake of TDN-Apt-miR26a:

[0049] The specific steps are as follows: human chorionic trophoblast cells (HRT-8) and immune cells Raw 264.7 were plated in a 35mm confocal culture dish, washed twice with PBS buffer, and then FAM-labeled TDN-Apt-miR26a was added for co-culture for 2 hours. Then 10μM lysosome red fluorescent probe was added and incubated for 30 minutes to specifically stain the lysosomes of the cells. Then Hoechst 33342 was stained for about 25 minutes. Finally, the cells were washed three times with PBS buffer. Fluorescence imaging of TDN-Apt-miR26a was performed by laser confocal scanning microscope (60x oil objective), with excitation wavelengths of 405nm and 543nm, and corresponding emission wavelengths in the range of 430-480nm and 550-630nm.

[0050] 2. Cell flow detection uptake efficiency:

[0051] Cells grown to the logarithmic phase were digested with 0.25% trypsin to make a single cell suspension, and 7 x 10 4 cells were inoculated in a 24-well culture plate, and incubated in a constant temperature incubator at 37°C, 5% CO2 and saturated humidity for 24 h. The next day, the old culture medium was discarded, washed with PBS for 3 times, and FAM-TDN-Apt-miR26a was co-cultured with cells at a final concentration of 200 nmol / L for 12 h and 24 h, respectively. After incubation, the culture was terminated, the culture medium was discarded, washed with PBS for 3 times, and the cells were collected by 0.25% trypsin digestion, 300 μL of medium was used for each well, and flow cytometry analysis was performed.

[0052] 3. Uptake mechanism analysis:

[0053] HTR8 (2 x 10 5 cells / well) were cultured in 6-well plates containing culture medium, and the confluence rate reached about 80% to 90% after 24 hours. Before adding FAM-TDN-Apt-miR26a, the cells were pre-cultured with endocytosis inhibitors chlorpromazine (CPZ, 10 μM) and ethylisopropylamine chloride (EIPA, 50 μM) for 30 min, then FAM-TDN-Apt-miR26a (final concentration 200 nM) was added to each sample in serum-free medium, and incubated in a CO2 incubator at 37°C for 6 h. The cells were collected, washed with PBS twice, and then resuspended in ice-cold PBS (300 μL). Finally, the fluorescence of FAM-TDN-Apt-miR26a in the cells was quantified using flow cytometry (20000 events were collected).

[0054] Figure 2 The FACS analysis results of G proved that TDN-Apt-miR26a can be stably taken up by cells. In order to evaluate the ability of TDN-Apt-miR26a to HTR-8, its ability to enter HTR-8 was first evaluated, which is the first step for it to exert biological function. As shown in H, fluorescence image analysis showed that TDN carrying Apt-miR26a did not affect their entry. TDN-miR26a can successfully escape from lysosomes and be released into the cytoplasm at 6 h. Figure 2

[0055] Example 3 Anti-inflammatory effect of TDN-Apt-miR26a

[0056] ​To explore the anti-inflammatory effect of TDN-Apt-miR26a, in this embodiment, TDN, TDN-Apt, TDN-miR26a, TDN-Apt-miR26a were added to macrophage RAW264.7 cell culture for 24h, then washed twice with PBS, added LPS (concentration of 0.2 μg / μL) in the culture medium, 24h later, the cells and supernatant were collected to extract RNA and protein for subsequent qRT-PCR and Western blotting experiments Figure 3 A) The content of anti-inflammatory factors TNF-α and IL-6 secreted by RAW 264.7 cells after different treatments was detected by enzyme-linked immunosorbent assay (ELISA). At the same time, the mRNA and protein expression of M1 type (TNF-α and iNOS) and M2 type (ARG-1 and YM-1) markers of macrophage phenotype conversion before and after different treatments were detected by qRT-PCR and Western blotting molecular techniques.

[0057] By detecting the expression level of miR26a mRNA in cells with different intervention methods, it was found that in the TDN-Apt-miR26a group, the expression of miR26a was the highest Figure 3 B) Next, the mRNA of inflammatory markers was further detected. LPS can reduce the expression of anti-inflammatory factors ARG1 and YM1, and increase the expression of pro-inflammatory factors TNF-α and iNOS, while TDN-Apt-miR26a can reverse the effect of LPS on RAW 264.7 Figure 3 C) WB experiment was used to detect the M1 and M2 markers of macrophages, and the results further confirmed that miR-26a can induce the phenotype conversion of macrophages from M1 to M2, and play an anti-inflammatory role Figure 3 D-E).

[0058] Example 4 Promoting angiogenesis effect of TDN-Apt-miR26a

[0059] To explore the promoting angiogenesis effect of TDN-Apt-miR26a, in this embodiment, the related experiments were carried out by using vascular endothelial cells (HUV). First, the mRNA of VEGF in HUV cells treated by different intervention methods (Ctrl, TDN, TDN-Apt, TDN-miR26a, TDN-Apt-miR26a) was detected, and the results showed that TDN-Apt-miR26a had the most obvious effect on increasing VEGF Figure 4A), WB experiment found that compared with the control group, TDN, TDN-Apt, TDN-miR26a, TDN-Apt-miR26a can improve the expression of EGFR, Galectin3, IGF-1, among which TDN-Apt-miR26a group has the most significant effect of increasing( Figure 4 B) Cell migration experiment found that compared with the control group, TDN-Apt-miR26a can promote the migration of vascular endothelial cells( Figure 4 C-D) WB experiment on the related factors of angiogenesis found that TDN-Apt-miR26a can promote the expression of VEGF, while ING-1, HIF1-alpha, TGF-beta, smad are detected( Figure 4 E) In addition, the angiogenesis was detected and counted( Figure 4 F-G), the results suggest that TDN-Apt-miR26a can promote angiogenesis. Cell migration experiment further confirmed that DN-Apt-miR26a can promote the migration of vascular endothelial cells( Figure 4 H).

[0060] Example 5 Antioxidant function of TDN-Apt-miR26a

[0061] To explore the antioxidant effect of TDN-Apt-miR26a, this embodiment adds TDN, TDN-Apt, TDN-miR26a, TDN-Apt-miR26a to HTR8 cell culture for 24h, then adds LPS (concentration is 0.2 μg / μL) in the culture medium, and collects the cells after 24h for subsequent experiments( Figure 5 A) ROS kit was used to detect the level of reactive oxygen species in cells, and it was found that LPS could induce the generation of reactive oxygen species in HTR8 cells, while TDN, TDN-Apt, TDN-miR26a, TDN-Apt-miR26a could alleviate the generation of reactive oxygen species induced by LPS( Figure 5 B) Further explore the oxidation function of the cell, further detect the cell viability by CCK8 kit, hydrogen peroxide can reduce the activity of RAW 264.7, HTR8 cells, while TDN, TDN-Apt, TDN-miR26a, TDN-Apt-miR26a can improve the cell viability caused by hydrogen peroxide, suggesting that TDN-Apt-miR26a has antioxidant function( Figure 5 C) In addition, further detection of cell apoptosis found that TDN-Apt-miR26a can reduce the apoptosis caused by dexamethasone( Figure 5 D, 5E), while affecting the cell cycle( Figure 5 F, 5G).

[0062] Example 6: Interventional effect of TDN-Apt-miR26a on FGR

[0063] 1. Small animal live imaging (NIR):

[0064] C57 / BL6J mice were housed. Animals had free access to food and water and were kept in a 12:12h light-dark cycle at 21-23℃. After mating, the appearance of a copulatory plug was recorded as day 1 of embryonic development. A dexamethasone-based animal model was used to induce fetal growth restriction (FGR) and explore its mechanism. Dexamethasone is a synthetic glucocorticoid widely used clinically for its anti-inflammatory, anti-shock, and anti-allergic effects, and is widely used in establishing FGR models. From day 13 to day 14, 0.1 mg / kg / day was subcutaneously injected into the scapular region. After successful modeling, 100 μL of Cy7-TDN-Apt-miR26a was injected via the tail vein. NIR imaging was performed at different time points (12, 24, and 48 hours) to observe the fluorescence intensity in the placenta and fetus, confirming the retention time.

[0065] 2. Immunofluorescence staining:

[0066] After injection of Cy3-labeled nucleic acid nanomedicine, placental targeting was investigated using the trophoblast marker cytokeratin (CK7). Following successful FGR model establishment, Cy3-TDN-Apt-miR26a was injected via tail vein, while the same dose of PBS was injected intravenously as a control. 24 hours later, placental tissue was harvested, embedded in OCT, and cut to 8 μm longitudinal sections. Sections were thawed, fixed with 4% formaldehyde solution, and treated with 0.1% Triton X-100. Slides were blocked with 10% BSA, and then blocked overnight at 4°C with CK7 antibody, followed by 2 hours of FITC-goat anti-rabbit IgG secondary antibody blocking. Nuclei were stained with DAPI, and images were captured using a fluorescence microscope.

[0067] like Figure 6 As shown in Figure A, mice were divided into two groups according to the experimental design: TDN-Apt-miR26a (A): healthy group, FGR group, TDN1 group, TDN-Apt group, TDN-miR-145 group, and TDN-Apt-miR26a group; and TDN-Apt-miR26a (B): healthy group, FGR group, TDN1 group, TDN-Apt group, TDN-miR-145 group, and TDN-Apt-miR26a group. Small animal in vivo imaging experiments showed administration of drugs to pregnant mice (…). Figure 6 B), after separating the fetal placenta, fluorescence photography was performed. Figure 6 C). The results showed that the material accumulated in the placenta but did not enter the fetus. The FGR mouse model group showed a significant decrease in fetal and placental weight compared to the normal group. TDN-miR26a in both the treatment and prevention groups effectively increased fetal and placental weight.Figure 6 D and 6E) indicate that TDN-Apt-miR26a-mediated dexamethasone (Dex)-induced FGR reversal. Examination of fetal H&E-stained tissue sections showed similar results. Figure 6 F). Western blotting was used to detect the expression of EFGR, Galectin3, and IGF-1 in the placenta. Figure 6 G). Ultrasound examination of relevant parameters of the uterine artery and umbilical artery in pregnant rats indicated that TDN-Apt-miR26a could improve the pressure of the uterine artery and umbilical artery (6H~I).

[0068] Example 7: Biosafety evaluation of TDN-Apt-miR26a

[0069] Tissue sections were examined to observe placental inflammation and ROS damage. Placental tissue was also ground, and the levels of relevant inflammatory and oxidative factors were detected using ELISA and RT-qPCR. Heart, liver, spleen, lung, and kidney sections were stained with hematoxylin and eosin. Ki67 and ly6g immunohistochemistry and TUNEL assays were performed on tissue sections to detect apoptotic cells.

[0070] Fetal rat bone staining showed that the model group fetuses exhibited more cartilage (Alcian blue staining) and significantly lower bone content compared to the normal control group (Alizarin Red staining). Figure 7 A). In particular, the occipital bone ranked low in the model group. These results show that fetal development in FGR mice is significantly delayed. This indicates that TDN-Apt-miR26a treatment effectively improves abnormal fetal bone development and restores normal skeletal development.

[0071] Figure 7 Further analysis of serum samples from pregnant mice revealed that intravenous injection of TDN-Apt-miR26a significantly reduced serum ALB, AST, and ALT levels (typical diagnostic indicators of ALF). Specifically, AST and ALT levels in both the TDN-Apt-miR26a prevention and treatment groups tended to return to normal. Furthermore, TDN-Apt-miR26a significantly reduced serum urea nitrogen (UN) and serum creatinine (CREAT) levels. Figure 7 Immunohistochemical staining of C showed that the expression of pro-angiogenic and developmental markers was upregulated in the TDN-Apt-miR26a group, indicating that TDN-Apt-miR26a has good biocompatibility.

[0072] In summary, this invention demonstrates the application potential of DNA tetrahedrons as a smart nucleic acid drug delivery platform in the treatment of placental-derived diseases, providing a technical basis and theoretical foundation for the subsequent development of DNA nanomaterials targeting FGR and other placental-related diseases, and expanding the application boundaries of nanobiomedicine.

[0073] The above description is only the preferred embodiment of the present application, and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

[0074] SEQUENCE LISTING

[0075] SEQ ID NO. 1

[0076] GTCTGAGGCAGTTGAGAGATCTCGAACATTCCTTTTTTTTTTTTTTTTTTTTT

[0077] SEQ ID NO. 2

[0078] TAAGTCTGAAGATCCATTTATCACCAGCTGCTGCACGCCATAGTAGACGTATCACCTGTCCTTTTTTTTTTTTTTTTTTTTT

[0079] SEQ ID NO. 3

[0080] AGCTACTTGCTACACGAGGATCTTCAGACTTAGGAATGTTCGAGATCACATGCGAGGACTCGGTCCAATACCGTACTAACGATTACAGATCAATTTTTTTTTTTTTTTTTTTTT

[0081] SEQ ID NO. 4

[0082] CAGCTGGTGATAAAACGTGTAGCAAGTAGCTTTGATCTGTAATCGACTCTACGGGAAGAGCTTTTTTTTTTTTTTTTTTTTT

[0083] SEQ ID NO. 5

[0084] ATGCCCATCCGGCTCACTACTATGGCGTGCAGTTTTTTTTTTTTTTTTTTTTT

[0085] SEQ ID NO. 6

[0086] CGAGTCCTCGCATGACTCAACTGCCTCAGACGGACAGGTGATACGAGAGCCGGATGGGCATGCTCTTCCCGTAGAGATAGTACGGTATTGGACTTTTTTTTTTTTTTTTTTTTT

[0087] SEQ ID NO. 7 (Apt)

[0088] GCCCACCGAGGTTCGTCCATCACAGATCGGTGGTGTCGTGAAAAAAAAAAAAAAAAAA

[0089] SEQ ID NO. 8

[0090] TTCAAGTAATCCAGGATAGGCT

[0091] SEQ ID NO. 9

[0092] AGCCTATCCTGGATTACTTGAAAAAAAAAAAAAAAAAAAA

Claims

1. A functionalized tetrahedral framework nucleic acid, characterized in that, The functionalized tetrahedral framework nucleic acid is assembled from 6 single-stranded DNA molecules, the nucleotide sequences of which are shown in SEQ ID NO. 1 to 6.

2. The functionalized tetrahedral framework nucleic acid according to claim 1, characterized in that, The tetrahedral framework nucleic acid nanostructure is modified with a nucleic acid aptamer and miR-26a, and the nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.

7.

3. The functionalized tetrahedral framework nucleic acid nanostructure according to claim 2, characterized in that, The molar ratio of the tetrahedral framework nucleic acid nanostructure to miR-26a is (1-2):(1-2).

4. The functionalized tetrahedral framework nucleic acid nanodelivery system according to claim 2, characterized in that, The diameter of the functionalized tetrahedral framework nucleic acid nanodelivery system is 50–80 nm.

5. A drug for treating fetal growth restriction, characterized in that, The drug comprises the functionalized tetrahedral framework nucleic acid and gene regulatory element nucleotide sequence as described in any one of claims 1 to 4.

6. A placental-targeted nanodelivery system for tetrahedral framework nucleic acids, characterized in that, Includes the tetrahedral framework nucleic acid and the functional miR-26a nucleotide sequence as described in any one of claims 1 to 4.

7. The application of the placental-targeted nanodelivery system of claim 6 in the construction of a placental-specific miRNA delivery platform.

8. The method for preparing the placental-targeted nanodelivery system according to claim 6, characterized in that, Includes the following steps: (1) Six single-stranded DNAs and nucleic acid aptamers were mixed in an annealing buffer. The annealing temperature was 95°C and the annealing time was 5 min. The mixing reaction time was 1 h. The self-assembly formed a tetrahedral framework nucleic acid nanostructure to obtain TDN-Apt. (2) The TDN-Apt and miR-26a were incubated at room temperature to obtain the placenta-targeted tetrahedral framework nucleic acid nanodelivery system.

9. The use of the functionalized tetrahedral framework nucleic acid nanodelivery system according to any one of claims 1 to 4 in the preparation of a medicament for treating fetal growth restriction.

10. The application according to claim 9, characterized in that, The drug intervenes in fetal growth restriction by improving placental angiogenesis disorders, relieving placental oxidative stress, or improving placental inflammatory infiltration.

Images