Daidzein reductase mutant as well as construction method and application thereof
By mutating amino acids at specific sites in daidzein reductase, a highly efficient daidzein reductase mutant was constructed, solving the problems of catalytic efficiency and stability of existing enzymes, achieving higher catalytic activity and stability under high concentrations of equol, and promoting equol biosynthesis.
Patent Information
- Application Number
- CN202511127573.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-12
- Publication Date
- 2025-11-18
AI Technical Summary
The existing catalytic efficiency and stability of daidzein reductase DZNR are limited, restricting its application in industrial production.
By mutating the 30th and/or 105th amino acid of wild-type genistein reductase, mutants of genistein reductase, including G30S, A105S, A105C, G30S-A105S, and G30S-A105C, were constructed to improve its catalytic activity and stability.
The catalytic activity of the mutants was significantly improved, especially the combined mutants G30S+A105S and G30S+A105C, which showed an increase of 3.23 times and 2.44 times, respectively. They also exhibited stronger tolerance in the presence of high concentrations of equol, which improved the efficiency of equol and its derivatives preparation.
Smart Images
Figure CN120966778A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of active enzyme technology, specifically relating to a daidzein reductase mutant, its construction method, and its application. Background Technology
[0002] In 2010, Shimada et al. first cloned and identified the first daidzein reductase (DZNR) from *Lactococcus Strain 20-92*, demonstrating that recombinant DZNR heterologously expressed by *E. coli* could catalyze the reduction of the C2-C3 double bond of daidzein in the presence of the coenzyme NADPH, producing R-dihydrodaidzein (R-DHD). Subsequently, other laboratories also cloned the gene for this enzyme from intestinal microbial strains. Deng et al. compared the DZNR gene with the whole genomes of microorganisms and found that DZNR homologs existed in 18 strains, and the activities of DZNR from different sources differed significantly. DZNR belongs to the OYE family, also known as the enol reductase family (EC 1.6.99.1), which catalyzes the asymmetric reduction of C=C bonds, producing chiral α-substitution and / or β-substitution reduction products with high enantiomeric purity.
[0003] Studies have reported that DZNR enzymes can be divided into two categories based on sequence characteristics: DZNR-I and DZNR-II (classes I and II, such as...). Figure 3 (As shown). DZNR-I enzymes are represented by DZNRs in Lac 20_92 and NATTS, with a primary sequence identity of 42-99%. These enzymes catalyze the conversion of genistein to dihydrogenistein. DZNR-II enzymes are represented by DZNRs such as K-07020, with a primary sequence identity of 70-90%. These enzymes possess both invertase and racemic enzyme functions (catalyzing the conversion of genistein and the racemic conversion of the product), but their ability to catalyze the conversion of genistein is lower than that of DZNR-I enzymes.
[0004] Primary sequence alignment analysis of DZNRs of types DZNR-I and DZNR-II revealed significant differences in their primary sequences, but both sequences contained specific conserved regions: a 4Fe-4S cluster motif (CXXCX3CX12C) and two NADH / NADPH binding motifs (GXGXXG). Kawada et al., through gel filtration chromatography and chemical cross-linking analysis, demonstrated that the active form of DZNR consists of eight subunits, and the DZNR octamer forms a "spherical four-leaf clover" structure, with a maximum particle size of [missing information]. The enzyme's activity depends on the cofactor NAD(P)H and is oxygen-sensitive, exhibiting activity under anaerobic conditions.
[0005] DZNR plays a crucial role in the biosynthesis of equol, particularly in the conversion of daidzein to dihydrodaidzein, and is considered the rate-limiting enzyme in this biosynthetic pathway. However, the catalytic efficiency and stability of existing DZNRs are limited, restricting their application in industrial production. Therefore, developing mutants with higher activity and stability is of great significance. Summary of the Invention
[0006] This invention provides a daidzein reductase mutant, its construction method, and its application. The mutant can use isoflavone compounds as substrates to efficiently generate R-dihydrodaidzein or its analogues via catalysis.
[0007] This invention provides a daidzein reductase mutant, which is obtained by mutating the amino acid at position 30 and / or position 105 based on wild-type daidzein reductase.
[0008] The wild-type daidzein reductase has any of the following amino acid sequences:
[0009] (1) As shown in SEQ ID No. 1;
[0010] (2) A sequence that has more than 90% identity with the amino acid sequence shown in SEQ ID No. 1 after deleting, inserting or replacing one or more amino acids based on the amino acid sequence shown in SEQ ID No. 1;
[0011] (3) The sequence obtained by modifying the sequence shown in (1) or (2).
[0012] In a preferred embodiment of the present invention, the mutation includes any one of the following: mutating the G at position 30 of the amino acid sequence shown in SEQ ID No. 1 to S and / or mutating the A at position 105 to C or S.
[0013] In a preferred embodiment of the present invention, the present invention includes mutants G30S, A105S, A105C, G30S-A105S, and G30S-A105C, wherein the amino acid sequence of mutant G30S is shown in SEQ ID No. 2, the amino acid sequence of mutant A105S is shown in SEQ ID No. 3, the amino acid sequence of mutant A105C is shown in SEQ ID No. 4, the amino acid sequence of mutant G30S-A105S is shown in SEQ ID No. 5, and the amino acid sequence of mutant G30S-A105C is shown in SEQ ID No. 6.
[0014] The present invention also provides a gene encoding the above-mentioned daidzein reductase mutant.
[0015] In a preferred embodiment of the present invention, the nucleotide sequence of the gene includes at least one of the following: (1) as shown in SEQ ID No. 7;
[0016] (2) As shown in SEQ ID No. 8;
[0017] (3) As shown in SEQ ID No. 9;
[0018] (4) As shown in SEQ ID No. 10;
[0019] (5) As shown in SEQ ID No. 11;
[0020] (6) A sequence that has more than 90% identity with any of the sequences (1) to (5) obtained by mutating, deleting, inserting or replacing one or more nucleotides based on any of the sequences (1) to (5);
[0021] (7) The sequence obtained by modifying any of the sequences (1) to (6).
[0022] The present invention also provides a recombinant expression vector containing the above-mentioned genes.
[0023] The present invention also provides a recombinant host cell comprising the above-mentioned recombinant expression vector and expressing the above-mentioned daidzein reductase mutant.
[0024] In a preferred embodiment of the present invention, the type of recombinant host cell includes prokaryotic expression cells.
[0025] The present invention also provides the application of the above-mentioned daidzein reductase mutant or the daidzein reductase mutant expressed by the above-mentioned recombinant host cell in catalyzing daidzein or daidzein analogues.
[0026] The present invention also provides a method for catalyzing daidzein or daidzein analogues, comprising using the above-mentioned daidzein reductase mutant or the daidzein reductase mutant induced to be expressed by the above-mentioned recombinant host cell as the catalytic enzyme and isoflavones as the substrate for the catalytic reaction.
[0027] Beneficial Effects: This invention provides a daidzein reductase mutant, obtained by mutation of wild-type daidzein reductase. Specifically, five mutants, G30S, A105S, A105C, G30S-A105S, and G30S-A105C, are provided in the examples. The examples demonstrate that, compared to wild-type DZNR, the whole-cell catalytic activity of the mutants shows a 1.39-fold increase in the activity of the G30S mutant, a 1.53-fold and a 1.44-fold increase in the activities of the A105C and A105S mutants, respectively, and a 3.23-fold and a 2.44-fold increase in the activities of the G30S+A105S and G30S+A105C mutants, respectively. This proves that the daidzein reductase mutant of this invention has higher catalytic activity than wild-type DZNR. Furthermore, the five mutants verified in the embodiments of the present invention showed stronger tolerance in the presence of high concentrations of equol, and the application of the daidzein reductase mutant can improve the preparation efficiency of equol and its derivatives. Attached Figure Description
[0028] Figure 1 The image shows the sequence alignment results of DZNR with enzymes of the same family. The blue markers in the image represent amino acids II and III, which are considered "hotspots".
[0029] Figure 2 The relative activity analysis of the DZNR 30-site mutant is shown, where the horizontal axis represents the amino acid at the 30th site.
[0030] Figure 3 The relative activity analysis of the DZNR 105 site mutant is shown, where the horizontal axis represents the amino acid at the 105 site.
[0031] Figure 4 SDS-PAGE analysis was performed on the expression of recombinant proteins in the supernatant after lysis of each strain. Lane 1: Ecoli-BL21(DE3)-pETDuet-dznr; Lane 2: Ecoli-BL21(DE3)-pETDuet-dznr30S; Lane 3: Ecoli-BL21(DE3)-pETDuet-dznr105S; Lane 4: Ecoli-BL21(DE3)-pETDuet-dznr105C; Lane 5: Ecoli-BL21(DE3)-pETDuet-dznr30S+105S; Lane 6: Ecoli-BL21(DE3)-pETDuet-dznr30S+105C; Lane 7: Ecoli-BL21(DE3)-pETDuet.
[0032] Figure 5 The inhibitory effects of different concentrations of equadol on DZNR and mutants were investigated. Detailed Implementation
[0033] This invention provides a daidzein reductase mutant, which is obtained by mutating the amino acid at position 30 and / or position 105 based on wild-type daidzein reductase.
[0034] The wild-type daidzein reductase has any of the following amino acid sequences:
[0035] (1) As shown in SEQ ID No. 1;
[0036] (2) A sequence that has more than 90% identity with the amino acid sequence shown in SEQ ID No. 1 after deleting, inserting or replacing one or more amino acids based on the amino acid sequence shown in SEQ ID No. 1;
[0037] (3) The sequence obtained by modifying the sequence shown in (1) or (2).
[0038] The wild-type daidzein reductase DNZR of this invention has the amino acid sequence shown in SEQ ID No. 1 in one embodiment. Of course, the sequence of the DNZR can also be mutated to a certain extent to achieve at least 90% identity. The DNZR can also be modified, including acetylation, amidation, cyclization, glycosylation, phosphorylation, alkylation, biotinylation, fluorescent group modification, polyethylene glycol (PEG) modification, or immobilization modification; wherein the tag includes 6×His, GST, EGFP, MBP, Nus, HA, IgG, FLAG, c-Myc, or Profinity eXact.
[0039] In this invention, DZNR belongs to the OYE (Old Yellow Enzyme) family of FMN-dependent NADPH oxidoreductases. This enzyme is a monomeric protein composed of 644 amino acids, containing a 4Fe-4S cluster motif (CXXCX3CX12C), two NADH / NADPH binding motifs (GXGXXG), and a near-N-terminal FMN binding domain. Studies have revealed four conserved "hotspot positions" in OYE family enzymes that are closely related to the stereoconfiguration of the enzyme-catalyzed products; these four regions are named I, II, III, and IV in sequence. Sequence alignment analysis revealed that two sites in DZNR overlap with "hotspot positions" II and III of this family of enzymes. Figure 1 ).
[0040] In one embodiment of the present invention, mutation is performed based on the sequence shown in SEQ ID No. 1. The mutation includes mutating G at position 30 of the amino acid sequence shown in SEQ ID No. 1 to S (G30S) and / or mutating A at position 105 to C or S (A105C or A105S), thereby forming mutants G30S, A105S, A105C, G30S-A105S, and G30S-A105C. The amino acid sequence of mutant G30S is shown in SEQ ID No. 2; the amino acid sequence of mutant A105S is shown in SEQ ID No. 3; the amino acid sequence of mutant A105C is shown in SEQ ID No. 4; the amino acid sequence of mutant G30S-A105S is shown in SEQ ID No. 5; and the amino acid sequence of mutant G30S-A105C is shown in SEQ ID No. 6.
[0041] The present invention also provides a gene encoding the above-mentioned daidzein reductase mutant.
[0042] The coding gene of the mutant targeted in this embodiment of the invention is shown below. Of course, it can also be a sequence with more than 90% identity obtained by mutating, deleting, inserting or replacing one or more nucleotides based on the sequence shown below, or it can be a modified sequence.
[0043] In one embodiment of the present invention, the coding gene of the mutant G30S is shown in SEQ ID No. 7; the coding gene of the mutant A105S is shown in SEQ ID No. 8; the coding gene of the mutant A105C is shown in SEQ ID No. 9; the coding gene of the mutant G30S-A105S is shown in SEQ ID No. 10; and the coding gene of the mutant G30S-A105C is shown in SEQ ID No. 11.
[0044] The present invention also provides a recombinant expression vector containing the above-mentioned genes.
[0045] This invention does not specifically limit the base vector of the recombinant expression vector, as long as it can satisfy the requirement that the gene can be inserted into the vector for expression. In one embodiment, prokaryotic expression was used, and a prokaryotic expression vector such as pETDUet-1 was used as an example. In this embodiment, the above-mentioned gene was inserted between the BamHI and SacI sites of pETDUet-1 to construct the recombinant expression vector pETDUet-1-dznr.
[0046] The present invention also provides a recombinant host cell comprising the above-mentioned recombinant expression vector and expressing the above-mentioned daidzein reductase mutant.
[0047] The types of recombinant host cells described in this invention include prokaryotic expression cells, such as Escherichia coli as the host cell in the embodiments. In one embodiment, the above expression vector pETDUet-1-dznr was transformed into Escherichia coli BL21(DE3) to obtain recombinant Escherichia coli BL21(DE3)-pETDUet-1-dznr.
[0048] The present invention also provides the application of the above-mentioned daidzein reductase mutant or the daidzein reductase mutant expressed by the above-mentioned recombinant host cell in catalyzing daidzein or daidzein analogues.
[0049] In this embodiment of the invention, recombinant Escherichia coli expressing the above mutant was used as raw material. After adding daidzein, the whole-cell catalytic activity of the mutant was analyzed, and the unmutated DZNR was used as a control. The results showed that the activity of the G30S mutant was increased by 1.39 times, A105C and A105S were increased by 1.53 times and 1.44 times, respectively, and G30S+A105S and G30S+A105C were increased by 3.23 times and 2.44 times, respectively.
[0050] The present invention also provides a method for catalyzing daidzein or daidzein analogues, comprising using the above-mentioned daidzein reductase mutant or the daidzein reductase mutant induced to be expressed by the above-mentioned recombinant host cell as the catalytic enzyme and isoflavones as the substrate for the catalytic reaction.
[0051] This invention uses isoflavones, such as daidzein, as a substrate and utilizes the reductase catalysis of the mutant to complete the catalysis in a 200mM pH 8.0 potassium phosphate buffer containing 1mM daidzein, 4% glucose, and 150mg / mL (wet weight) of bacterial cells at 30°C and 150rpm for 5 hours.
[0052] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, provides a daidzein reductase mutant, its construction method, and its application, but these descriptions should not be construed as limiting the scope of protection of the present invention.
[0053] Example 1: Construction of DZNR expression system and construction of site mutants
[0054] Using daidzein reductase from the NCBI database as the original starting sequence (GenBank: AFV15453.1), the gene was optimized according to the codon preference of *E. coli*. The optimized sequence (SEQ ID No. 12) was artificially synthesized and ligated to the expression vector pETDUet-1, which was also double-digested, via the restriction enzyme sites BamHI and SacI, to construct the recombinant expression vector pETDUet-1-dznr. The expression vector pETDUet-1-dznr was transformed into *E. coli* BL21(DE3) to obtain recombinant *E. coli* BL21(DE3)-pETDUet-1-dznr.
[0055] Using the recombinant plasmid pETDuet-dznr as a template, and the sequences listed in Table 1 as primers, the alanine series mutant or half-saturated mutant gene sequences were amplified by whole plasmid PCR technology.
[0056] Table 1 Primer sequences
[0057] Primers Sequence (5′→3′ direction, underlined to indicate the corresponding mutant base) SEQ ID No. 30AF ATAGCATGGCAACATATCTGAA 13 30AR ATATGTTGCCATGCTATTACGAATC 14 30NDTF ATAGCATGNDTACATATCTGAA 15 30NDTR ATATGTAHNCATGCTATTACGAATC 16 105NDTF ATGCAGCTGNDTCATCCGGGTCG 17 105NDTR CCCGGATGAHNCAGCTGCATACCTG 18
[0058] 50μL PCR amplification system: 10μL 5×GC buffer, 4μL 2.5mM dNTPs, 2μL 10μM F, 2μL 10μM R, 1.5μL DMSO, 5ng pETDuet-dznr plasmid, 0.5μL Phusion DNA polymerase, and the remainder ddH2O.
[0059] PCR amplification conditions: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 55℃ annealing for 30s, 72℃ extension for 3min 20s, 25 cycles; 72℃ extension for 10min, storage at 4℃.
[0060] PCR products were detected by 1.0% agarose gel electrophoresis and purified. The PCR products were digested with Dpn I to eliminate the template plasmid; digestion conditions: 37℃ for 5 h. After digestion, all digested products were transformed into *E. coli* DH5α competent cells. Positive transformants were screened and their sequences were determined. The correctly sequenced recombinant plasmids were then transformed into *E. coli* BL21(DE3) competent cells.
[0061] Induction culture of recombinant strains:
[0062] Pick a single colony and place it in 5 mL of LB liquid medium (final Amp concentration of 100 μg / mL) containing ampicillin (Amp), and incubate at 37°C and 200 rpm for about 12 h.
[0063] The recombinant bacteria cultured overnight were transferred at a ratio of 1% to 100 mL of LB liquid medium containing Amp (final Amp concentration of 100 μg / mL) and cultured at 37°C in a shake flask (200 rpm) for about 2 to 3 hours.
[0064] OD pending 600 When the concentration was approximately 0.8, IPTG was added to a final concentration of 0.8 mmol / L, and the induction culture conditions were: 24℃, 200 r / min, 16 h.
[0065] After induction, the culture was centrifuged at 8000 rpm for 3 min, and the bacterial pellet was washed twice with ddH2O. The obtained bacterial pellet was then ultrasonically disrupted or stored at -20℃ for later use.
[0066] Whole-cell catalytic activity analysis of DZNR and its mutants: Resuspended induced recombinant *E. coli* in 100 μL of 200 mM pH 8.0 potassium phosphate buffer to a cell concentration of 150 mg / mL (wet weight). Add 0.1 μL of 1 M daidzein to a final concentration of 1 mM, and 40% glucose to a final concentration of 4%. React at 30℃ and 150 rpm for 5 h. Stop the reaction with 100 μL of acetonitrile, and detect the product by HPLC. The activity of the mutants was compared with that of unmutated DZNR. Results are shown in the figure. Figure 2 and 3 The results showed that the DZNR30S mutant at the 30-site site had a 1.39-fold increased activity compared to the unmutated DZNR, while the DZNR105C and DZNR105S mutants at the 105-site site had 1.53-fold and 1.44-fold increased activity compared to the unmutated DZNR, respectively.
[0067] Example 2: Construction of DZNR30 and 105 site combined mutants
[0068] Using the recombinant plasmid pETDuet-dznr30S extracted from the DZNR30S mutant as a template, and with the sequences listed in Table 2 as primers, the combined mutant gene sequences were amplified using whole plasmid PCR technology.
[0069] Table 2 Primer sequences
[0070] Primers Sequence (5′→3′ direction, underlined to indicate the corresponding mutant base) SEQ ID No. 105SF ATGCAGCTGTCACATCCGGGTCG 19 105SR CCCGGATGTGACAGCTGCATACCTG 20 105CF ATGCAGCTGTGTCATCCGGGTCG 21 105CR CCCGGATGACACAGCTGCATACCTG 22
[0071] 20 μL PCR amplification system: 10 μL 5×GC buffer, 4 μL 2.5 mM dNTPs, 2 μL 10 μM F, 2 μL 10 μM R, 1.5 μL DMSO, 5 ng pETDuet-dznr30S plasmid, 0.5 μL Phusion DNA polymerase, and the remainder ddH2O.
[0072] PCR amplification conditions: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 55℃ annealing for 30s, 72℃ extension for 3min 20s, 25 cycles; 72℃ extension for 10min, storage at 4℃.
[0073] PCR products were detected by 1.0% agarose gel electrophoresis and purified. The PCR products were digested with Dpn I to eliminate the template plasmid; digestion conditions: 37℃ for 5 h. After digestion, all digested products were transformed into *E. coli* DH5α competent cells. Positive transformants were screened and their sequences were determined. The correctly sequenced recombinant plasmids were then transformed into *E. coli* BL21(DE3) competent cells.
[0074] The induced bacterial cells were sonicated and the protein expression in each cell was analyzed by SDS-PAGE. The results are shown in the figure. Figure 4 The results show that the expression levels of the target protein DZNR, the single-site mutants 30 and 105, and the combined mutant 30+105 are basically the same.
[0075] Following the whole-cell activity assay method described above, the activity of the combined mutant cells was measured. Whole-cell enzyme activity units (U) were defined as the number of cells required to produce 1 μmol / min of dihydrogen daidzein per minute under conditions of 30℃, pH 8.0, and using daidzein as a substrate. Table 3 shows the activity comparison between the combined mutants DZNR30S+105S and DZNR30S+105C and the control. Their activities were increased by 3.23 times and 2.44 times, respectively, compared to the unmutated DZNR.
[0076] Table 2 Whole-cell activity and relative activity of DZNR and its mutants
[0077] enzyme name <![CDATA[Cell activity (U / g) (×10 -3 )]]> Relative activity (%) DZNR 12.30(±1.12) 100 DZNR30S+105S 39.67(±0.97) 322.58 DZNR30S+105C 30.01(±1.76) 243.99
[0078] Example 3: Analysis of the substrate transformation ability of DZNR combined mutants
[0079] Previous literature has reported that in whole-cell transformation systems containing DZNR, the equol produced in the system exhibits feedback inhibition of DZNR enzyme activity. To verify the effect of equol on the activity of DZNR and its mutants, 1 mM or 2 mM equol was added to the aforementioned whole-cell catalytic system, and the activities of DZNR and its mutants were measured. Results are shown below. Figure 5The results show that in the presence of 1 mM equol, the wild-type DZNR was significantly inhibited, with its activity decreasing to 54% of the original activity. In the presence of 2 mM equol, its activity was significantly inhibited (virtually no activity). The mutant DZNR30S+105C showed similar results to the wild-type DZNR; in the presence of 1 mM equol, its activity decreased to 57% of the original activity, and in the presence of 2 mM equol, its activity was significantly inhibited (virtually no activity). The mutant DZNR30S+105S showed no significant inhibition of activity in the presence of 1 mM equol, with its activity remaining at 90.2% of the original activity. In the presence of 2 mM equol, its activity was inhibited to 21.9% of the original activity.
[0080] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A daidzein reductase mutant, characterized in that, The daidzein reductase mutant was obtained by mutating the amino acid at position 30 and / or position 105 based on the wild-type daidzein reductase. The wild-type daidzein reductase has any of the following amino acid sequences: (1) As shown in SEQ ID No. 1; (2) A sequence that has more than 90% identity with the amino acid sequence shown in SEQ ID No. 1 after deleting, inserting or replacing one or more amino acids based on the amino acid sequence shown in SEQ ID No. 1; (3) The sequence obtained by modifying the sequence shown in (1) or (2).
2. The daidzein reductase mutant according to claim 1, characterized in that, The mutation includes any one of the following: changing the G at position 30 of the amino acid sequence shown in SEQ ID No. 1 to S and / or changing the A at position 105 to C or S.
3. The daidzein reductase mutant according to claim 1 or 2, characterized in that, The mutants include G30S, A105S, A105C, G30S-A105S, and G30S-A105C, wherein the amino acid sequence of mutant G30S is shown in SEQ ID No. 2, the amino acid sequence of mutant A105S is shown in SEQ ID No. 3, the amino acid sequence of mutant A105C is shown in SEQ ID No. 4, the amino acid sequence of mutant G30S-A105S is shown in SEQ ID No. 5, and the amino acid sequence of mutant G30S-A105C is shown in SEQ ID No.
6.
4. A gene encoding the daidzein reductase mutant according to any one of claims 1 to 3.
5. The gene according to claim 4, characterized in that, The nucleotide sequence of the gene includes at least one of the following: (1) as shown in SEQ ID No. 7; (2) As shown in SEQ ID No. 8; (3) As shown in SEQ ID No. 9; (4) As shown in SEQ ID No. 10; (5) As shown in SEQ ID No. 11; (6) A sequence that has more than 90% identity with any of the sequences (1) to (5) obtained by mutating, deleting, inserting or replacing one or more nucleotides based on any of the sequences (1) to (5); (7) The sequence obtained by modifying any of the sequences (1) to (6).
6. A recombinant expression vector comprising the gene of claim 4 or 5.
7. A recombinant host cell comprising the recombinant expression vector of claim 6 and expressing the daidzein reductase mutant of any one of claims 1 to 3.
8. The recombinant host cell according to claim 7, characterized in that, The types of recombinant host cells include prokaryotic expression cells.
9. The use of the daidzein reductase mutant according to any one of claims 1 to 3, or the daidzein reductase mutant induced by recombinant host cells according to claim 7 or 8, in catalyzing daidzein or daidzein analogues.
10. A method for catalyzing daidzein or daidzein analogues, characterized in that, The reaction includes using the daidzein reductase mutant of any one of claims 1 to 3 or the daidzein reductase mutant induced by recombinant host cells of claim 7 or 8 as the catalytic enzyme and isoflavones as the substrate.