TaFRPs gene and application thereof in increasing folic acid content of wheat
By knocking out the TaFRP gene in wheat using the CRISPR-Cas9 system, the folic acid content in wheat grains was increased, solving the problem of low folic acid content in wheat and meeting the nutritional needs of the human body.
Patent Information
- Application Number
- CN202511516136.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-23
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2045-10-23
AI Technical Summary
Wheat has a low folic acid content, which is insufficient to meet the nutritional needs of the human body. Furthermore, the utilization efficiency of chemically synthesized folic acid is problematic due to differences in genotype among populations. No research has been reported on using gene editing technology to increase the folic acid content of wheat.
Using the CRISPR-Cas9 gene editing system, the TaFRP-1A-1, TaFRP-1A-2, TaFRP-1B-1, TaFRP-1B-2, and TaFRP-1D genes in wheat were knocked out. sgRNA targets were designed for gene editing, resulting in five homozygous edited plants that significantly increased the folic acid content in the grains.
By simultaneously knocking out the TaFRP homologous protein in wheat through gene editing technology, the folic acid content in the grains can be significantly increased, creating a high-folic acid wheat variety to meet the nutritional needs of the human body.
Smart Images

Figure CN120966847A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of molecular biology, and particularly relates to TaFRPs a gene and its application in increasing folate content in wheat. BACKGROUND
[0002] Folate belongs to vitamin B (B9), including tetrahydrofolate and 5-methyltetrahydrofolate, 5-formyltetrahydrofolate and other derivatives. Folate is involved in important biological processes such as nucleic acid, amino acid and pantothenic acid synthesis and methylation modification, and is an important substance for all living things to maintain normal life activities. Plants and microorganisms can synthesize folate from scratch, while humans lack the ability to synthesize folate themselves and mainly rely on dietary intake. Insufficient folate intake can lead to the occurrence of various diseases in humans, such as megaloblastic anemia in pregnant women, neural tube defects in newborns, and increased incidence of cardiovascular diseases and cancer. Ensuring daily dietary intake of folate is of great significance to improving the health level of the population.
[0003] Wheat is an important food crop, but the folate content in wheat is low and difficult to meet the nutritional needs of the human body for folate. Some Western countries have alleviated the folate deficiency phenomenon by forcibly adding chemically synthesized folate to flour, but chemically synthesized folate is an oxidized form of folate that needs to be metabolically reduced to 5-methyltetrahydrofolate in the human body before it can be absorbed and utilized by the human body. The enzyme responsible for folate metabolic reduction in the human body varies in genotype among different populations, and the enzyme activity varies significantly, which leads to the inability of some populations to effectively utilize chemically synthesized folate. The folate synthesized by plants is mainly 5-methyltetrahydrofolate, which can be directly absorbed and utilized by the human body. Therefore, cultivating wheat varieties rich in natural folate is an important way to ensure folate intake in the human body.
[0004] Gene editing technology uses the CRISPR-Cas9 gene editing system to achieve precise modification of specific target genes in the genome, and plays an important role in wheat quality and disease resistance improvement. However, there is still no report on using gene editing technology to increase folate content in wheat. Therefore, creating wheat varieties rich in folate through gene editing technology plays an important role in ensuring the nutritional needs of the population for folate. SUMMARY
[0005] The purpose of the present application is to provide TaFRPs a gene and its application in increasing folate content in wheat.
[0006] TaFRPs The gene comprises TaFRP-1A-1 , TaFRP-1A-2 , TaFRP-1B-1 , TaFRP-1B-2 , TaFRP-1DThe nucleotide sequences of the genes are shown in SEQ ID NO: 1-SEQ ID NO: 5, respectively.
[0007] The TaFRPs proteins include TaFRP-1A-1, TaFRP-1A-2, TaFRP-1B-1, TaFRP-1B-2 and TaFRP-1D, and the amino acid sequences thereof are shown in SEQ ID NO: 6-SEQ ID NO: 10, respectively.
[0008] The TaFRPs gene or the TaFRPs protein is used for improving the folate content of wheat.
[0009] A method for improving the folate content of wheat, which uses gene editing technology to simultaneously knockout the TaFRP-1A-1 、 TaFRP-1A-2 、 TaFRP-1B-1 、 TaFRP-1B-2 and TaFRP-1D genes.
[0010] The two specific targets of the gene editing are sgRNA1 and sgRNA2, and the nucleotide sequences thereof are shown in SEQ ID NO: 11-SEQ ID NO: 12, respectively.
[0011] Advantages of the present application: by simultaneously knocking out the five homologous proteins of TaFRP in wheat, five homozygous editing plants are obtained, and by analyzing the folate content of mature grains of the editing plants, it is found that the total folate content is significantly improved, indicating that this method can effectively improve the folate content in wheat grains, and is an effective strategy for creating high folate wheat. BRIEF DESCRIPTION OF DRAWINGS
[0012] Figure 1 The nucleotide sequences of the genes are shown in SEQ ID NO: 1-SEQ ID NO: 5, respectively. TaFRP The nucleotide sequences of the genes are shown in SEQ ID NO: 1-SEQ ID NO: 5, respectively.
[0013] Figure 2 The nucleotide sequences of the genes are shown in SEQ ID NO: 1-SEQ ID NO: 5, respectively. TaRFP The nucleotide sequences of the genes are shown in SEQ ID NO: 1-SEQ ID NO: 5, respectively.
[0014] Figure 3 The nucleotide sequences of the genes are shown in SEQ ID NO: 1-SEQ ID NO: 5, respectively. DETAILED DESCRIPTION
[0015] In order to facilitate the understanding of the present application, the present application will be described more fully below. However, the present application can be realized in many different forms, and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive.
[0016] Example 1 Construction of wheat gene editing vector and genetic transformation of wheat Five homologous genes of wheat folate-related protein (TaFRP) were simultaneously knocked out using gene editing technology. The five genes are TraesCS1A01G310400 ( TaFRP-1A-1 ), TraesCSC1A01G400600 ( TaFRP-1A-2 ), TraesCS1B01G321700 ( TaFRP-1B-1 ), TraesCS1B02G321600 ( TaFRP-1B-2 ), and TraesCS1D01G309900 ( TaFRP-1D ). According to the conserved sequences of the coding regions of the five TaFRP homologous genes, two specific target sites, sgRNA1: AGGTTTTGCTCCGACCATGG and sgRNA2: AGGTTTAGCTCCGACCATGG, were designed and connected to the vector pWMB110 containing the CRISPR / Cas9 editor to construct an editing vector that simultaneously knocks out the five homologous genes of TaFRP. The constructed vector was introduced into Agrobacterium tumefaciens GV3101 strain.
[0017] Using immature young embryos of wheat variety Jimai 22 as explants, two Agrobacterium engineering strains containing the target sites were mixed to infect the explants, and T0 generation positive transformation wheat plants were obtained through tissue culture.
[0018] Through genetic transformation of wheat, a TaFRPs gene editing strain was obtained. After continuous generations of screening and identification, a stable strain KO- TaFRP -7 was obtained, in which the genomic sequences of 5 five homologous genes were edited. In this strain, there was a 1 bp deletion at the target site position, TaFRP there was a 1 bp deletion at the target site position, TaFRP-1A-1 there was a 2 bp deletion at the target site position, TaFRP-1A-2 there was a 1 bp deletion at the target site position, TaFRP-1B-1 there was a 1 bp deletion at the target site position, TaFRP-1B-2 These base deletions caused changes in the amino acid sequences of the proteins encoded by the above five homologous genes at the target site position, and the proteins were prematurely terminated. TaFRP-1D Figure 1 Figure 2
[0019] Example 2 Genotype identification and folate content detection of gene edited wheat DNA sequences of T0 generation positive transformation wheat plants were extracted as templates, specific primers were designed, and TaFRPs genomic sequences were amplified. The PCR products were sequenced and analyzed. TaFRP The editing of the genes. The PCR reaction uses the specific upstream primer listed in Table 1 and the universal reverse primer TaFRP-ABDR. The reaction system is: 2x Taq Master Mix 10 μL, upstream primer (10 μM) 0.5 μL, downstream primer TaGFT-ABDR (10 μM) 0.5 μL, genomic DNA about 100 ng, and ddH2O to a total volume of 20 μL. The reaction program is: 95°C pre-denaturation for 5 min; followed by 35 cycles of amplification (95°C denaturation for 15 s, 58°C annealing for 20 s, and 72°C extension for 45 s); and finally 72°C terminal extension for 3 min.
[0020] Table 1 TaFRPs Gene sequence-specific amplification primer
[0021] After screening and identification, five homologous gene target sequences were edited. The T1 generation seeds were harvested for subsequent planting. The T1 generation seedlings were smeared with ammonium phosphate (concentration 1.5‰), and the plants with yellow leaves, i.e., without T-DNA insertion expression box, were screened. The DNA of the plants was further extracted for identification of the editing of the five homologous gene target sequences. The strains with edited target genes were screened, and the T2 generation seeds were harvested. The genotypes of the T2 and T3 generation seedlings were further identified, and the stable homozygous edited strains were obtained. The T3 generation seeds were harvested for folate content determination. Thirty mature seeds were randomly selected, ground into a uniform powder, and added with phosphate buffer and rat serum for extraction of folate derivatives. The supernatant was filtered to remove impurities and determined by high performance liquid chromatography mass spectrometer.
[0022] Compared with the total folate content of the wild type control wheat grains (26.24 ± 3.51 μg / 100 g of grains), the total folate content of the gene edited wheat KO-TaFRP-7 grains was significantly improved (120.99 ± 21.21 μg / 100 g of grains), indicating that the simultaneous knockout of the five homologous genes of TaFRP can effectively improve the total folate content of wheat.
[0023] The above-described embodiments only express several embodiments of the present application, which are described in detail and specifically, but cannot be understood as limiting the scope of the patent. It should be noted that for ordinary skilled persons in the art, several modifications and improvements can be made without departing from the concept of the present application, which are all within the protection scope of the present application. Therefore, the protection scope of the patent of the present application should be subject to the appended claims.
Claims
1. TaFRPs Genes, characterized by, The TaFRPs Genes include TaFRP-1A-1 , TaFRP-1A-2 , TaFRP-1B- 1 , TaFRP-1B-2 , TaFRP-1D Their nucleotide sequences are shown as SEQ ID NO:1-SEQ ID NO:5, respectively.
2. TaFRPs protein, characterized in that, The TaFRPs proteins include TaFRP-1A-1, TaFRP-1A-2, TaFRP-1B-1, TaFRP-1B-2, and TaFRP-1D, whose amino acid sequences are shown in SEQ ID NO: 6-SEQ ID NO: 10, respectively.
3. The claim 1 TaFRPs The application of the gene or the TaFRPs protein of claim 2 in increasing the folic acid content of wheat.
4. A method for increasing the folic acid content of wheat, characterized in that, Using gene editing technology, simultaneously knocking out the gene described in claim 1 TaFRP-1A-1 , TaFRP-1A-2 , TaFRP-1B-1 , TaFRP-1B-2 and TaFRP-1D Gene.
5. The method for increasing wheat folic acid content according to claim 4, characterized in that, The two specific targets of the gene editing are sgRNA1 and sgRNA2, whose nucleotide sequences are shown in SEQ ID NO: 11-SEQ ID NO: 12, respectively.
Citation Information
Patent Citations
Crop nitrogen utilization efficiency and grain yield collaborative improvement method based on gene editing technology
CN114990151A
Wheat yellow mosaic disease susceptible gene TaEIF4E and application thereof
CN116536327A
Wheat grain protein content related protein TaSKP1 and application of coding gene thereof
CN119120553A