Base editing system based on I-E type Cas3 and application of base editing system in saccharomyces cerevisiae gene editing
By constructing the MutaIEC system, which fuses an IE-type CRISPR system with the error-prone DNA polymerase PO1I5M, in Saccharomyces cerevisiae, the problems of low mutation rate and limited base editing range in traditional Saccharomyces cerevisiae gene editing have been solved, achieving efficient arbitrary base substitution and expansion of genetic diversity.
Patent Information
- Application Number
- CN202511163907.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-20
- Publication Date
- 2025-11-18
AI Technical Summary
In existing gene editing technologies for Saccharomyces cerevisiae, traditional random mutagenesis methods lead to decreased cell fitness, low mutation rates, and difficulty in optimizing multiple related genes. Furthermore, the existing CRISPR-Cas9 system has a limited base editing range, making it impossible to achieve conversions and transversions between purines or pyrimidines, thus limiting genetic diversity.
The MutaIEC system was constructed by fusing an IE-type CRISPR system with the error-prone DNA polymerase PO1I5M. It contains coding sequences for Cas3, Cas5, Cas6, Cas7, Cas8, and Cas11, as well as gRNA, enabling substitution between any bases within the targeting window. Genetic diversity was expanded through the fusion expression of the Cas3 coding sequence and the error-prone DNA polymerase PO1I5M.
Efficient arbitrary base substitutions were achieved in Saccharomyces cerevisiae, increasing the mutation rate, broadening the editing window, and significantly expanding genetic diversity. It can realize A/T→C/G, C/G→A/T transversions and A→G, T→C, C→T, G→A conversions.
Smart Images

Figure CN120966867A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of gene editing, and particularly relates to a base editing system based on I-E type Cas3 and application thereof in gene editing of Saccharomyces cerevisiae. BACKGROUND
[0002] Random mutagenesis, as a key strategy in biological research, is widely applied in various fields, including genotype-phenotype association analysis, lineage tracing, protein function modification and directed evolution. In particular, in the optimization of microbial cell factories, this technology plays a core role. The introduction of complex heterologous metabolic pathways into microorganisms can synthesize specific target products, such as antibiotics, enzymes, terpenoids and other high-value biomolecules. However, the introduction and expression of these heterologous pathways often lead to insufficient metabolic flux, low catalytic efficiency or accumulation of toxic intermediates, thus requiring large-scale optimization to improve the final yield of target products. Traditional whole-genome random mutagenesis relies on exogenous mutagenic factors acting on the entire genome, such as ultraviolet irradiation or chemical mutagens. Although these methods can generate diverse genetic variations, their indiscriminate mutagenesis characteristics lead to decreased cellular adaptability. To overcome the above limitations, researchers have developed various methods aimed at more precisely and controllably generating genetic diversity. Among them, multiple automated genome engineering (MAGE) is a representative technology of early in vitro mutagenesis. MAGE achieves replacement, insertion or deletion at specific sites through iterative introduction of a large number of in vitro synthesized oligonucleotides targeting the lagging strand of replication forks in an automated process. However, MAGE and other in vitro mutagenesis techniques are subject to multiple constraints, including dependence on in vitro oligonucleotide library preparation and host transformation, low editing efficiency, need for complex automated equipment, and limited range of editable bases.
[0003] To improve editing efficiency, some researchers use dCas9 in conjunction with cytidine deaminase. However, although such systems show potential for application in prokaryotic and eukaryotic cells, their range of action is usually limited to a narrow region of about 40 base pairs around the gRNA target site, making it difficult to meet the mutagenesis needs of long genomic fragments. T7 RNA polymerase and cytidine deaminase, supplemented with DNA repair factors to enhance mutation diversity, can act continuously on a region of about 2 kb downstream of the T7 promoter. However, its coverage is still insufficient to optimize multiple related genes in metabolic pathways, and it cannot target in situ genomic sequences, requiring additional primer T7 promoters. Moreover, this tool can only achieve specific conversion of cytosine (C) to thymine (T), and cannot cover random replacement of other base types (such as A, G, T, etc.). This single mutation spectrum significantly reduces the theoretical genetic diversity, limiting the complexity of the generated mutation library and potentially affecting the efficiency of subsequent screening for ideal phenotypes. or
[0004] Furthermore, current continuous evolution strategies in *Saccharomyces cerevisiae* are primarily based on the CRISPR-Cas9 base editing evolution system. These systems are limited by low mutation rates. Screening for auxiliary elements is also crucial for achieving high mutagenicity. Error-prone DNA polymerase-guided IE-type Cas3-type base editors have not yet been developed in *Saccharomyces cerevisiae*. Summary of the Invention
[0005] To address the aforementioned technical problems, this invention develops a novel directed evolution tool for Saccharomyces cerevisiae, which can achieve arbitrary base substitutions within a target window, covering conversions and transversions between purines, purines and pyrimidines, and pyrimidines, with a high mutation rate, significantly expanding the dimensions of genetic diversity generation and application scenarios.
[0006] The first objective of this invention is to provide a gene editing system suitable for brewer's yeast, the gene editing system comprising:
[0007] Cas5 encoded sequence;
[0008] Cas6 encoded sequence;
[0009] Cas7 encoded sequence;
[0010] Cas8 encoded sequence;
[0011] Cas11 encoded sequence;
[0012] The Cas3 coding sequence and the error-prone DNA polymerase PO1I5M coding sequence fused to its N-terminus;
[0013] gRNA targeting target genes.
[0014] Furthermore, the Cas3 encoding sequence is shown in SEQ ID NO.1, the Cas5 encoding sequence is shown in SEQ ID NO.2, the Cas6 encoding sequence is shown in SEQ ID NO.3, the Cas7 encoding sequence is shown in SEQ ID NO.4, the Cas8 encoding sequence is shown in SEQ ID NO.5, and the Cas11 encoding sequence is shown in SEQ ID NO.6;
[0015] The coding sequence of the error-prone DNA polymerase PO1I5M is shown in SEQ ID NO.10.
[0016] Furthermore, the Cas3 coding sequence and the error-prone DNA polymerase PO1I5M coding sequence are linked by a ligation sequence, as shown in SEQ ID NO.13.
[0017] Accordingly, the present invention also provides a fusion protein for gene editing of Saccharomyces cerevisiae, the fusion protein containing a Cas3 coding sequence and a fault-prone DNA polymerase PO1I5M coding sequence fused to its N-terminus, and the two are linked by the linker sequence shown in SEQ ID NO. 13.
[0018] A second objective of this invention is to provide a recombinant brewer's yeast containing the aforementioned gene editing system or fusion protein.
[0019] Furthermore, the host of the recombinant brewer's yeast includes, but is not limited to, Saccharomyces cerevisiae CEN.PK2-1C.
[0020] Furthermore, Cas5, Cas6, Cas7, Cas8, Cas11, Cas3, and the error-prone DNA polymerase PO1I5M are expressed either integratedly or in a free manner.
[0021] Most preferably, Cas5, Cas6, Cas7, and Cas8 are integrated and expressed, and the integration sites include, but are not limited to, the PNSX-2 site shown in SEQ ID NO.8 and / or the PNSXI-3 site shown in SEQ ID NO.9.
[0022] A third objective of this invention is to provide a method for efficient base editing of Saccharomyces cerevisiae, comprising the step of introducing the gene editing system into Saccharomyces cerevisiae.
[0023] A fourth objective of this invention is to provide the application of the gene editing system in gene editing of Saccharomyces cerevisiae.
[0024] Furthermore, the application includes the conversion of any ACGT base on the Saccharomyces cerevisiae genome.
[0025] By means of the above-described solution, the present invention has at least the following advantages:
[0026] This invention fuses Cas3 from an IE-type CRISPR system with error-prone DNA polymerases PO1I5M and TPDNAP1 (i.e., the MutaIEC system) to achieve arbitrary base mutations at specific sites in the genome of *Saccharomyces cerevisiae*. The base editing system based on the error-prone DNA polymerase PO1I5M has been verified to perform better in *Saccharomyces cerevisiae*. After introducing the editing system into cells and culturing the yeast cells, the fusion protein induces base substitution mutations at the target sites under the guidance of sgRNA. These mutations include transversions of A / T→C / G and C / G→A / T, as well as conversions of A→G, T→C, C→T, and G→A.
[0027] The PO1I5M-Cas3 fusion protein designed and constructed in this invention broadens the operable scope of the base editor on the Saccharomyces cerevisiae genome, with a larger editing window and a significantly improved mutation rate.
[0028] The above description is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention and to implement it in accordance with the contents of the specification, the following describes the preferred embodiments of the present invention in conjunction with detailed drawings. Attached Figure Description
[0029] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings.
[0030] Figure 1 The recombinant plasmid is Cas6-Cas7.
[0031] Figure 2 The recombinant plasmid is Cas5-Cas8.
[0032] Figure 3 The recombinant plasmid is Cas11-Cas3-gCAN1.
[0033] Figure 4 The recombinant plasmid is TPDNAP1-Cas3.
[0034] Figure 5 The recombinant plasmid is PO1I5M-Cas3.
[0035] Figure 6 The recombinant plasmid is SDD7-Cas3.
[0036] Figure 7 Results of feasibility verification for gene editing using the IE-type CRISPR system.
[0037] Figure 8 The mutation rate of different IE-type CRISPR systems was validated.
[0038] Figure 9 The results of target gene editing by different IE-type CRISPR systems. Detailed Implementation
[0039] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.
[0040] The solution involved in this invention is as follows:
[0041] To achieve efficient targeted mutagenesis within the Saccharomyces cerevisiae genome, this invention constructs a MutaIEC system based on a fusion strategy of the Escherichia coli IE type CRISPR-Cas3 system and a fault-prone DNA polymerase. Details are as follows:
[0042] (1) Acquisition of genes related to the IE-type CRISPR system
[0043] The Cas3, Cas5, Cas6, Cas7, Cas8, and Cas11 sequences of different *E. coli* strains were obtained from NCBI. Using *Saccharomyces cerevisiae* as the chassis strain, screening was performed. The sequence derived from *E. coli* MG1655 showed a significant advantage in gene editing, and was therefore selected as the optimal choice. Subsequent sequence optimization was performed to construct the gene synthesis expression cassette, including the promoter, Cas genes, and terminator. The nucleotide sequences of Cas3, Cas5, Cas6, Cas7, Cas8, and Cas11 are shown in SEQ ID NO. 1-6.
[0044] (2) Construction of an IE-type CRISPR editing system
[0045] Primers were designed based on the optimized Cas gene sequence, vector sequence, and *Saccharomyces cerevisiae* genome sequence. Simultaneously, a gRNA sequence was designed using the *Saccharomyces cerevisiae* CAN1 gene sequence. The gRNA expression cassette was synthesized, and the Cas gene expression cassette, vector, and the upstream and downstream homologous arms of the integrated Cas5, Cas6, Cas7, and Cas8 expression cassettes, along with the gRNA expression cassette, were amplified by PCR. Each part had at least 15 bp of overlapping regions. Finally, the expression cassette integration plasmid and gene editing plasmid were obtained through one-step cloning. Competent *Saccharomyces cerevisiae* cells were prepared. Using CRISPR-Cas9 technology, the Cas6 and Cas7 dual expression cassettes were integrated into the PNSX-2 site of the yeast genome, and the Cas5 and Cas8 dual expression cassettes were integrated into the PNSXI-3 site to obtain a recombinant strain (named ST1602). The Cas3, Cas11, and gRNA expression cassettes were expressed in plasmid form, resulting in a recombinant *Saccharomyces cerevisiae* strain containing an IE-type CRISPR editing system (named ST1603). The gCAN1 sequence is shown in SEQ ID NO.7, the PNSX-2 site sequence in SEQ ID NO.8, and the PNSXI-3 site sequence in SEQ ID NO.9.
[0046] (3) Feasibility verification of IE-type CRISPR system
[0047] ST1602 competent yeast cells were prepared, and the Cas11-Cas3-gCAN1 plasmid was transformed into yeast to obtain ST1603 strain. After validation by strain P, positive transformants were selected and cultured in SC-URA-Raf medium for 12 h, followed by induction culture in SC-URA-Gal medium for 16 h. 100 μL of the culture was then plated on SC-canavanine plates.
[0048] (4) MutaIEC System Testing
[0049] After codon optimization of the sequences of error-prone DNA polymerases PO1I5M and TPDAP1, and cytosine deaminase SDD7, genes were synthesized and fused with the Cas3 gene in the Cas11-Cas3-gCAN1 plasmid, respectively, to obtain PO1I5M-Cas3, TPDAP1-Cas3, and SDD7-Cas3 plasmids. ST1602 yeast cells were prepared as competent cells and transformed into PO1I5M-Cas3, TPDAP1-Cas3, and SDD7-Cas3 plasmids, respectively. Positive transformants were cultured in SC-URA-Raf medium for 12 h, followed by induction culture in SC-URA-Gal medium for 24 h. 100 μL of each transformant was then plated on SC-canavanine plates. The nucleotide sequence of PO1I5M is shown in SEQ ID NO.10, the nucleotide sequence of TPDAP1 is shown in SEQ ID NO.11, and the nucleotide sequence of SDD7 is shown in SEQ ID NO.12. PO1I5M, TPDNAP1, or SDD7 are fused with Cas3 via a linker, the linker sequence of which is shown in SEQ ID NO.13.
[0050] Materials and reagents involved in the experiment:
[0051] (1) Strains, cells and plasmids
[0052] Escherichia coli DH5α, Saccharomyces cerevisiae CEN.PK2-1C, plasmid
[0053] pML104.
[0054] (2) Solution and culture medium
[0055] 5 g / L L-canavanine solution: Weigh 0.5 g L-canavanine powder, add 80 ml of distilled water to dissolve, and make up to 100 mL.
[0056] 100g / L 5-FOA solution: Weigh 1g of 5-fluoroorotic acid, dissolve it in 8mL of dimethyl sulfoxide, and bring the volume to 10mL.
[0057] 100mg / mL ampicillin solution: Weigh 0.1g of ampicillin powder, add 80ml of distilled water to dissolve, and make up to 100mL.
[0058] 1 mol / L LiAc solution: Weigh 6.6 g of LiAc solid powder, add 80 ml of distilled water to dissolve, and make up to 100 mL.
[0059] 50% PEG3350 solution: Weigh 50mg of PEG3350 powder, add 80ml of distilled water to dissolve, and make up to 100mL.
[0060] LB medium: 5g yeast extract, 10g peptone, 10g NaCl, add appropriate amount of distilled water to dissolve, then bring the volume to 1L, sterilize at 121℃ / 20min, add 20g agar to solid plates.
[0061] YPD medium: Dissolve 10g yeast extract, 20g peptone, and 20g glucose in an appropriate amount of distilled water, bring the volume to 1L, sterilize at 115℃ for 30min, and add 20g agar to solid plates.
[0062] SC-URA-Glu medium (1L): 6.7g YNB, 20g glucose, dissolved in an appropriate amount of distilled water, and brought to a final volume.
[0063] 1L, 115℃ / 30min. Add 10mL of filtered and sterilized amino acids (5g / L tryptophan, 5g / L histidine, 5g / L leucine), and add 20g agar to the solid plate.
[0064] SC-5-FOA medium (1L): 6.7g YNB, 20g glucose, dissolved in an appropriate amount of distilled water, and brought to a final volume.
[0065] 1L, 115℃ / 30min. Add 10mL of filtered and sterilized amino acids (5g / L tryptophan, 5g / L histidine, 5g / L leucine, 5g / L uracil) and 10mL 5-FOA solution, and add 20g agar to the solid plate.
[0066] SC-URA-Raf medium (1L): 6.7g YNB, 20g raffinose, dissolved in an appropriate amount of distilled water, and brought to a final volume.
[0067] 1L, 115℃ / 30min. Add 10mL of filtered and sterilized amino acids (5g / L tryptophan, 5g / L histidine, 5g / L leucine), and add 20g agar to the solid plate.
[0068] SC-URA-Gal medium (1L): 6.7g YNB, 20g galactose, dissolved in an appropriate amount of distilled water, and brought to a final volume.
[0069] 1L, 115℃ / 30min. Add 10mL of filtered and sterilized amino acids (5g / L tryptophan, 5g / L histidine, 5g / L leucine), and add 20g agar to the solid plate.
[0070] SC-canavanine: Dissolve 6.7g YNB and 20g glucose in an appropriate amount of distilled water, and bring the volume to a final depth.
[0071] 1L, 115℃ / 30min. Add 10mL of filtered and sterilized amino acids (5g / L tryptophan, 5g / L histidine, 5g / L leucine, 5g / L uracil) and 10mL of filtered and sterilized L-canavanine, and add 20g agar to the solid plate.
[0072] The sequences involved in the embodiments are as follows:
[0073] Primer sequences are shown in Table 1.
[0074] Table 1
[0075]
[0076]
[0077] Cas3 nucleotide sequence (SEQ ID NO.1)
[0078]
[0079] Cas5 nucleotide sequence (SEQ ID NO.2)
[0080] AGGTCATATCTGATCTTGAGGTTGGCGGGTCCGATGCAGGCTTGGGGACAGCCGACTTTTGAGGGTACGAGGCCAACAGGAAGATTTCCGACACGTTCGGGCTTGTTGGGGTTATTAGGTGCTTGCCTCGGGATACAGCGAGATGATACCAGTTCGCTTCAGGCACTATCTGAATCCGTGCAATTTGCGGTACGTTGCGATGAACTCATCCTCGATGACCGCCGTGTGTCGGTGACTGGTTTAAGGGACTACCATACGGTGCTAGGGGCACGCGAGGATTACCGGGGGCTGAAGTCGCACGAAACAATACAGACGTGGAGAGAGTACCTGTGTGACGCCAGTTTCACGGTGGCACTGTGGCTGACTCCACATGCGACCATGGTTATCTCCGAATTGGAGAAAGCTGTACTTAAACCGAGATATACGCCTTATCTTGGAAGGCGTTCGTGCCCGCTCACCCACCCTCTTTTTCTTGGCACCTGCCAAGCGAGTGACCCCCAAAAGGCATTGCTAAATTATGAGCCGGTCGGAGGCGATATATATAGTGAAGAAAGTGTTACAGGGCATCACTTGAAGTTTACGGCTCGCGACGAACCCATGATTACACTACCCAGGCAGTTTGCATCTCGGGAGTGGTACGTCATAAAGGGAGGGATGGACGTTTCGCAATAG
[0081] Cas6 nucleotide sequence (SEQ ID NO.3)
[0082] TATCTCTCCAAAGTTATCATTGCACGGGCTTGGTCAAGAGACTTATATCAGCTACATCAAGGCCTTTGGCACTTGTTCCCAAATAGGCCTGACGCAGCTAGGGACTTCCTTTTTCACGTCGAAAAACGAAATACGCCGGAGGGATGTCACGTACTACTGCAATCAGCTCAAATGCCGGTCAGTACTGCCGTCGCAACAGTCATAAAGACGAAGCAAGTGGAGTTCCAGTTACAAGTAGGTGTTCCGCTCTACTTTCGCTTGCGGGCTAACCCAATTAAAACTATTCTAGACAACCAAAAACGGCTAGACAGTAAAGGCAATATCAAGCGCTGTAGAGTCCCACTTATAAAAGAAGCGGAGCAGATCGCGTGGTTGCAAAGAAAGCTTGGGAATGCGGCACGTGTAGAAGATGTGCACCCAATATCAGAGCGTCCCCAATACTTTTCAGGCGATGGGAAATCTGGGAAAATTCAGACCGTTTGTTTCGAGGGCGTACTAACTATCAACGACGCGCCAGCTCTAATCGACCTTGTTCAACAAGGAATTGGGCCCGCCAAATCTATGGGGTGTGGACTGCTCAGCCTAGCGCCGTTATAG
[0083] Cas7 nucleotide sequence (SEQ ID NO.4)
[0084]
[0085] Cas8 nucleotide sequence (SEQ ID NO.5)
[0086]
[0087] Cas11 nucleotide sequence (SEQ ID NO.6)
[0088] GCTGATGAGATTGATGCGATGGCATTATATAGGGCTTGGCAGCAACTAGACAATGGATCATGTGCGCAAATCCGTAGAGTCAGCGAGCCGGATGAGCTCCGGGACATACCCGCATTTTATAGACTTGTGCAGCCCTTTGGCTGGGAGAACCCTCGGCACCAACAGGCGCTCCTCCGTATGGTCTTCTGCTTGTCGGCTGGGAAAAATGTGATTCGACATCAGGATAAAAAGAGTGAGCAGACCACTGGCATTTCCCTGGGAAGGGCACTCGCGAACTCTGGAAGAATTAATGAGAGGCGTATATTTCAATTGATTCGTGCTGACAGGACGGCGGACATGGTACAACTGCGGCGACTATTGACACATGCTGAACCAGTCCTGGATTGGCCTCTTATGGCACGGATGCTAACATGGTGGGGAAAAAGAGAACGACAGCAGCTTCTAGAAGACTTTGTACTCACCACAAACAAAAACGCGTAG
[0089] gCAN1 sequence (SEQ ID NO.7)
[0090] aagTAGCATGAATACAGATCTGTGGCCTTTGCTGT
[0091] PNSX-2 locus sequence (SEQ ID NO.8)
[0092] GTAACGGGATCCCTCTGTGA
[0093] PNSXI-3 locus sequence (SEQ ID NO.9)
[0094] ATATGTCTCTAATTTTGGAA
[0095] PO1I5M nucleotide sequence (SEQ ID NO.10)
[0096]
[0097] TPDNAP1 nucleotide sequence (SEQ ID NO.11)
[0098]
[0099] SDD7 nucleotide sequence (SEQ ID NO.12)
[0100] ATGTTGGAAGCTGTTAGAGCCAGATTGATTGGTGAAGGTGGTGGTCCAGGTGCTGTTCCTGAAGGCGGTGATGGTCCACCAGCTGTTCCAGCTGAAGAAGTTGAAAGATTGAGAGGTGAATTGCCA CCACCTGTTGTTCCAGGTACTGGTCAAAAGACTCATGGTAGATGGATTGGTCCAGATGGTAGAGTTAGAGCTATAGTTTCTGGTAGAGATGAAGATGCTGCTTTGGTTCATGCTCAATTGGCTGCT AAAGGTATTCCAGATGAACCTACTAGAAACTCCGATGTCGAACAAAAATTAGCTGCTCATATGGTTGCCAACGGTATTAGACATGTTACCTTGGTTATTAACCACAGACCATGTAGAGGTTTCGATGATTCTTGTGATACTTTGGTCCCAATCATTTTGCCAGAAGGTTGTACTTTGACTGTTCATGGTCAAACTGATAAGGGTATGAGAGTCAGAGTTAGATATACTGGTGGTGCTAGACATGGTGGTCT
[0101] Linker nucleotide sequence (SEQ ID NO.13)
[0102] TCCGGTAGCGAAACGCCGGGGACGAGCGAGTCCCGCGACTCCCGA GTCTtctgga
[0103] Example 1: MutaIEC System Testing (TPDNA1-Cas3)
[0104] (1) Feasibility verification of IE-type CRISPR system
[0105] (A) Construction of Cas6-Cas7 expression cassette plasmids
[0106] Based on the Cas6-Cas7 sequence information of plasmids, specific primers PR1 / PR2, PR7 / PR8, PR3 / PR6, and PR4 / PR5 were designed. Each primer carried at least 15 bp complementary sequences at both ends of the Cas6-Cas7 expression cassette, the pML104 vector, and the upstream and downstream homologous arms of the PNSX-2 site, respectively. Amplification of the Cas6 and Cas7 expression cassettes, the pML104 vector, and the upstream and downstream homologous arms of the PNSX-2 site was performed using Prime STAR Max (Takara). PCR reaction conditions were: 98℃ for 5 min, 98℃ for 15 s, 55℃ for 15 s, 72℃ for 1 min 10 s, 34 cycles, followed by 72℃ for 10 min. After PCR product detection by 1% agarose gel electrophoresis, rapid cloning was performed using the TOLOBIO One-Step Seamless Cloning Kit. The ligation product was then transformed into Escherichia coli DH5α competent cells. After single colonies emerged, colony PCR was performed using primers PR9 / PR10. Positive colonies were inoculated into LB medium containing Amp and cultured overnight. Plasmids were extracted and sequenced using PR9 and PR10 at Genewiz, yielding the Cas6-Cas7 expression cassette plasmid. The plasmid map is shown below. Figure 1 .
[0107] (B) Construction of Cas5-Cas8 expression cassette plasmids
[0108] Based on the Cas5-Cas8 sequence information, specific primers PR11 / PR12, PR17 / PR18, PR13 / PR14, and PR15 / PR16 were designed, each with at least 15 bp complementary sequences at both ends of the primers for the Cas5-Cas8 expression cassette, the pML104 vector, and the upstream and downstream homologous arms of the PNSXI-3 site. Amplification of the Cas5 and Cas8 expression cassettes, the pML104 vector, and the upstream and downstream homologous arms of the PNSXI-3 site was performed using Prime STAR Max (Takara). PCR reaction conditions were: 98℃ for 5 min, 98℃ for 15 s, 55℃ for 15 s, 72℃ for 45 s, 34 cycles, followed by 72℃ for 10 min. After PCR product detection by 1% agarose gel electrophoresis, rapid cloning was performed using the TOLOBIO One-Step Seamless Cloning Kit, and the ligation product was transformed into Escherichia coli DH5α competent cells. After single colonies emerged, colony PCR was performed using primers PR19 / PR20. Positive colonies were inoculated into LB medium containing Amp and cultured overnight. Plasmids were extracted and sequenced using PR19 and PR20 at Genewiz, yielding the Cas5-Cas8 expression cassette plasmid. The plasmid map is shown below. Figure 2 .
[0109] (C) Construction of Cas3-Cas11-gRNA plasmid
[0110] Based on the CAN1 gene sequence of *Saccharomyces cerevisiae* CEN.PK2-1C, the following gRNA sequence was designed: 5'-aagTAGCATGAATACAGATCTGTGGCCTTTGCTGT-3', where lowercase aag represents the PAM sequence. Based on the Cas3-Cas11-gRNA sequence information, specific primers PR21 / PR22, PR23 / PR24, and PR25 / PR26 were designed, each with at least 15 bp complementary sequences at both ends for the Cas3-Cas8 expression cassette, the pML104 vector, and the gRNA expression cassette, respectively. The Cas3-Cas8 expression cassette, pML104 vector, and gRNA expression cassette fragments were amplified using Prime STAR Max (Takara). PCR reaction conditions were: 98℃ for 5 min, 98℃ for 15 s, 55℃ for 15 s, 72℃ for 1 min, 34 cycles, followed by 72℃ for 10 min. After PCR products were detected by 1% agarose gel electrophoresis, rapid cloning was performed using a one-step seamless cloning kit manufactured by TOLOBIO. The ligation products were transformed into Escherichia coli DH5α competent cells. Once single colonies emerged, colony PCR was performed using primers PR9 / PR10. Positive colonies were inoculated into LB medium containing Amp and cultured overnight. Plasmids were extracted and sequenced using PR9 and PR10 at Genewiz, yielding the Cas3-Cas11-gRNA plasmid. The plasmid map is shown below. Figure 3 .
[0111] (D) Construction of IE-type CRISPR system
[0112] Expression cascade fragments were amplified from plasmids Cas6-Cas7 and Cas5-Cas8 using primers PR5 / PR6 and PR16 / PR14. PCR was performed using Prime STARMax from Takara under the following conditions: 98℃ for 5 min, 98℃ for 15 s, 55℃ for 15 s, 72℃ for 1 min, 34 cycles, followed by a final PCR at 72℃ for 40 s. Simultaneously, the Cas9-gRNA-X-2-XI-3 plasmid, preserved in the laboratory, was extracted. In a clean bench, dip a sterilized toothpick into the bacterial suspension from a CEN.PK2-1C preservation tube and streak it onto a YPD agar plate. After incubating upside down at 30°C for two days, pick a single colony from the plate and transfer it to a 3mL LYPD test tube. Incubate at 30°C until the OD600 reaches approximately 0.8–1.0. Transfer the bacterial suspension to a 50mL EP tube, wash twice with water, centrifuge at 3000g for 5 minutes at room temperature, remove the supernatant, resuspend the cells in 1mL of sterile water, and aliquot into 100μL tubes to prepare competent yeast cells. Centrifuge 100 μL of competent yeast cells at 12000g for 30s, remove the supernatant, and then add 240 μL of 50% PEG3350, 36 μL of 1M LiAC, 10 μL of ssDNA (10 mg / mL) purchased from Solarbio, 34 μL of the amplified Cas expression cascade fragment and Cas9-gRNA-X-2-XI-3 plasmid. Vortex to mix, heat shock at 42℃ for 30 min, centrifuge at 12000g for 30s, plate onto SC-URA-Glu plates, and incubate at 30℃ inverted for 2 days. Single colonies were selected, and PNSX-2 site integration was verified using primers PR27 / PR28, and PNSXI-3 site integration was verified using primers PR29 / PR30. Positive transformants (ST1602 strain) were selected and inoculated into SC-5-FOA liquid medium and cultured at 30°C for two days. Then, they were streaked onto solid medium at 30°C. After discarding the Cas9-gRNA-X-2-XI-3 plasmid, the Cas3-Cas11-gRNA plasmid was introduced following the above transformation steps. The mixture was then cultured upside down at 30°C for two days. The single colonies that grew were the positive transformants, i.e., ST1603 strain.
[0113] (E) Targeted knockout of the CAN1 gene
[0114] A single colony of ST1603 was picked and inoculated into SC-URA-Raf liquid medium and cultured at 30°C for 12 h. 50 μL of the bacterial suspension was then incubated in SC-URA-Gal liquid medium for 16 h. One mL of the bacterial suspension was washed twice with water, centrifuged at 12000g for 30 s, resuspended in 1 mL of sterile water, and 100 μL was plated onto SC-canavanine plates. After two days of incubation at 30°C, the growth of a single colony indicated that the CAN1 gene had been knocked out. This demonstrates the feasibility of gene editing using the IE-type CRISPR system constructed in this invention.
[0115] (2) TPDNA1-Cas3 performance test
[0116] (A) Construction of TPDNA1-Cas3 plasmid
[0117] Except for the primers, everything else is the same as in Example 1 (1C). The plasmid map is shown below. Figure 4 .
[0118] (B) Construction of TPDNA1-Cas3-no-target plasmid
[0119] Except for the different primers, this plasmid does not contain the 32bp sequence of gRNA, and is otherwise the same as in Example 1 (1C).
[0120] (C) TPDNA1-Cas3 Performance Testing
[0121] The ST1602 strain was transformed into TPDNA1-Cas3 and TPDNA1-Cas3-no-target plasmids, respectively, using the transformation method described in Example 1(D). Positive single colonies and ST1602 single colonies obtained from the transformation were picked and inoculated into SC-URA-Raf liquid medium and cultured at 30°C for 12 h. 50 μL of the bacterial suspension was then incubated in SC-URA-Gal liquid medium for 24 h. 1 mL of the bacterial suspension was washed twice with water, centrifuged at 12000g for 30 s, resuspended in 1 mL of sterile water, and 100 μL was plated. Strains transformed into TPDNA1-Cas3 and TPDNA1-Cas3-no-target plasmids were plated on SC-canavanine plates, while the ST1602 strain was plated on YPD plates. After two days of incubation at 30°C, the number of single colonies was counted. The mutation rates of the TPDNA1-Cas3 and TPDNA1-Cas3-no-target colonies were calculated by dividing the TPDNA1-Cas3 and TPDNA1-Cas3-no-target colony counts by the ST1602 colony count.
[0122] (3) Performance testing of PO1I5M-Cas3
[0123] (A) Construction of PO1I5M-Cas3 plasmid
[0124] Except for the primers, everything else is the same as in Example 1 (1C). The plasmid map is shown below. Figure 5 .
[0125] (B) Construction of PO1I5M-Cas3-no-target plasmid
[0126] Except for the different primers, this plasmid does not contain the 32bp sequence of gRNA, and is otherwise the same as in Example 1 (1C).
[0127] (C) PO1I5M-Cas3 Performance Test
[0128] Same as Example 1 (2C).
[0129] (4) SDD7-Cas3 performance test
[0130] (A) Construction of SDD7-Cas3 plasmid
[0131] Except for the primers, everything else is the same as in Example 1 (1C). The plasmid map is shown below. Figure 6 .
[0132] (B) Construction of SDD7-Cas3-no-target plasmid
[0133] Except for the different primers, this plasmid does not contain the 32bp sequence of gRNA, and is otherwise the same as in Example 1 (1C).
[0134] (C)SDD7-Cas3 Performance Test
[0135] Same as Example 1 (2C).
[0136] The results are as follows:
[0137] This invention targets the yeast CAN1 gene by fusing Cas3 from an IE-type CRISPR system with error-prone DNA polymerases PO1I5M, TPDNAP1, and cytosine deaminase SDD7. Results showed that the Cas3 fusion expression with the error-prone DNA polymerase PO1I5M exhibited the highest mutation efficiency, with a mutation rate of 5.31 × 10⁻⁶. -6 Secondly, the Cas3-TPDNAP1 mutation rate is 1.09 × 10⁻⁶. -6 The mutation rate of SDD7-Cas3 is only 6.67 × 10⁻⁶. -7 (Appendix) Figure 3 Furthermore, Cas3 fusion expression with TPDNAP1 and PO1I5M enables arbitrary base substitutions within the targeting window (see appendix). Figure 4 ).
[0138] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. A gene editing system suitable for Saccharomyces cerevisiae, characterized in that, The gene editing system contains: Cas5 encoded sequence; Cas6 encoded sequence; Cas7 encoded sequence; Cas8 encoded sequence; Cas11 encoded sequence; The Cas3 coding sequence and the error-prone DNA polymerase PO1I5M coding sequence fused to its N-terminus; gRNA targeting target genes.
2. The gene editing system according to claim 1, characterized in that, The Cas3 encoding sequence is shown in SEQ ID NO.1, the Cas5 encoding sequence is shown in SEQ ID NO.2, the Cas6 encoding sequence is shown in SEQ ID NO.3, the Cas7 encoding sequence is shown in SEQ ID NO.4, the Cas8 encoding sequence is shown in SEQ ID NO.5, and the Cas11 encoding sequence is shown in SEQ ID NO.
6. And / or, the coding sequence of the error-prone DNA polymerase PO1I5M is shown in SEQ ID NO.
10.
3. The gene editing system according to claim 1, characterized in that, The Cas3 coding sequence and the error-prone DNA polymerase PO1I5M coding sequence are linked by a ligation sequence; the ligation sequence includes the sequence shown in SEQ ID NO.
13.
4. Recombinant Saccharomyces cerevisiae containing the gene editing system of any one of claims 1-3.
5. The recombinant brewing yeast according to claim 4, characterized in that, The host of the recombinant brewer's yeast is Saccharomyces cerevisiae CEN.PK2-1C.
6. The recombinant brewing yeast according to claim 4, characterized in that, Integrated or free expression of Cas5, Cas6, Cas7, Cas8, Cas11, Cas3 or error-prone DNA polymerase PO1I5M.
7. The recombinant brewing yeast according to claim 6, characterized in that, The Cas5, Cas6, Cas7 and Cas8 are integrated and expressed, with integration sites including the PNSX-2 site and / or the PNSXI-3 site.
8. A fusion protein for gene editing in Saccharomyces cerevisiae, characterized in that, The fusion protein contains a Cas3 coding sequence and a fault-prone DNA polymerase PO1I5M coding sequence fused to its N-terminus, and the two are linked by the linker sequence shown in SEQ ID NO.
13.
9. The application of the gene editing system according to any one of claims 1-3 or the fusion protein according to claim 8 in gene editing of Saccharomyces cerevisiae.
10. A method for efficient base editing of brewing yeast, characterized in that, Includes the step of introducing the gene editing system according to any one of claims 1-3 into Saccharomyces cerevisiae.