Application of OsABI5 gene in improving photosynthesis and yield of rice

Abstract

The invention discloses application of an OsABI5 gene in improvement of photosynthesis and yield of rice. The OsABI5 mutants osabi5-ko and osabi5-1 in the invention show more excellent photosynthetic capacities: the SPAD value, the stomatal conductance and the intercellular CO2 concentration are all remarkably improved, the photosynthetic capacities under different light intensities and different CO2 concentrations are remarkably enhanced, and the photosynthetic nitrogen utilization efficiency under high nitrogen and low nitrogen conditions is remarkably improved. The tiller number, the ear length, the thousand seed weight, the maturing rate, the grain width and the grain length of osabi5-ko and osabi5-1 plants are remarkably increased compared with those of the middle flower 11 (ZH11). Finally, the biomass of the osabi5-ko single plant and the biomass of the osabi5-1 single plant straw are increased by 13% and 14% respectively, and the yield of the single plant is increased by 18% and 10% respectively. In conclusion, the photosynthetic efficiency and yield of the rice can be effectively improved by reducing the expression quantity of the OsABI5.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of plant genetic engineering technology, and particularly relates to application of an OsABI5 (ABA Insensitive 5) gene in improving photosynthesis and yield of rice. BACKGROUND

[0002] Photosynthesis is a biological process that uses solar energy, water and carbon dioxide (CO2) in the atmosphere to synthesize organic carbon compounds. Photosynthesis is mainly carried out by autotrophic and semi-autotrophic organisms, and is the main driving force for food production of heterotrophic organisms for billions of years. The main food crops, maize, rice, wheat and soybean, provide two-thirds of the calories consumed globally. With the reduction of arable land, climate change, extreme weather events and stagnation of yield of major food crops, the crop yield will double by 2050 to meet the demand of the world population under the condition of rapid population growth. Current research aimed at improving crop productivity mainly focuses on photosynthesis. Improving photosynthesis is a key research field with great potential in improving sustainable agricultural productivity and addressing global food security challenges.

[0003] Abscisic acid (ABA) is an important plant hormone that not only participates in plant stress response, but also affects plant growth and development by negatively regulating photosynthesis and nitrogen utilization. Studies have shown that by targeting knockout of the PYL gene (PYL1-6, PYL12) of rice ABA receptor, a mutant with significantly increased biomass and yield is obtained. This provides a theoretical and practical basis for improving crop yield by regulating the ABA signaling pathway. In the ABA signaling pathway, the core component ABI5 downstream of the PYL receptor is involved in regulating photosynthesis-related processes, including promoting chlorophyll degradation, regulating nitrogen utilization, and participating in photoprotection. The effect of OsABI5 gene mutation on rice photosynthesis and yield still needs further exploration. SUMMARY

[0004] In order to overcome the shortcomings and deficiencies of the prior art, the purpose of the present application is to provide an application of an OsABI5 gene in improving photosynthesis and yield of rice, a method for enhancing photosynthesis of rice and improving yield by knocking out or knocking down OsABI5, and obtaining a new variety of rice with high photosynthetic efficiency and high yield.

[0005] The purpose of the present application is achieved by the following technical solutions:

[0006] The present application provides an application of an OsABI5 gene in improving photosynthesis and yield of rice.

[0007] Further, the present application provides an application of a rice OsABI5 gene in improving growth and development of rice.

[0008] Further, the application provides application of the rice OsABI5 gene in improving chlorophyll content, stomatal conductance, intercellular CO2 concentration, net photosynthetic rate, maximum net photosynthetic rate, maximum carboxylation rate and / or photosynthetic nitrogen use efficiency of rice.

[0009] Specifically, the improving photosynthesis of rice includes improving relative chlorophyll content (SPAD value), improving stomatal conductance (g s ), improving intercellular CO2 concentration (C i ), improving net photosynthetic rate, improving net photosynthetic rate under different light intensity or different CO2 concentration, improving photosynthetic nitrogen use efficiency (PNUE) under high nitrogen and low nitrogen conditions.

[0010] Further, the application provides application of the rice OsABI5 gene in improving yield of rice.

[0011] Further, the application provides application of the rice OsABI5 gene in improving tiller number, ear length, thousand-grain weight, seed setting rate, grain width, grain length, straw biomass per plant and / or yield per plant of rice.

[0012] Further, the application provides application of the rice OsABI5 gene in plant breeding.

[0013] Further, the application provides application of the rice OsABI5 gene in cultivating transgenic plants.

[0014] The plant includes but is not limited to rice, wheat, sorghum, millet, corn, Arabidopsis, sugarcane, cotton, tomato, alfalfa and elephant grass;

[0015] The rice OsABI5 gene encodes an amino acid sequence as shown in GenBank No. XP_015628684.1.

[0016] The rice OsABI5 gene has one of the following nucleotide sequences:

[0017] 1) the DNA sequence shown in GenBank No. XM_015773198.3;

[0018] 2) the DNA sequence shown in GenBank No. XM_015773198.3 from 49bp to 1215bp;

[0019] 3) the DNA sequence encoding the protein shown in GenBank No. XP_015628684.1.

[0020] The above application is achieved by knocking out or knocking down the rice OsABI5 gene.

[0021] The knockout or knockdown is achieved through genome editing technology or RNA interference technology.

[0022] A method for rice breeding includes the following steps: obtaining rice by knocking out or knocking down the OsABI5 gene; compared with wild-type ZH11, said rice exhibits superior photosynthetic capacity: SPAD value, stomatal conductance (g) s ) and intercellular CO2 concentration (C i All of these factors significantly improved, with enhanced photosynthetic capacity under different light intensities and CO2 concentrations. PNUE was significantly increased under both high and low nitrogen conditions. The number of tillers, spike length, thousand-grain weight, seed setting rate, grain width, and grain length of the plant were significantly increased compared to the wild type ZH11. Ultimately, the straw biomass per plant increased by 13% and 14% respectively compared to the wild type ZH11, and the yield per plant increased by 18% and 10% respectively.

[0023] A method for improving photosynthesis and yield in rice includes the following steps: improving photosynthesis and yield in rice by knocking out or knocking down the OsABI5 gene.

[0024] The improvement of rice photosynthesis includes increasing the relative chlorophyll content (SPAD value) and stomatal conductance (g). s ), intercellular CO2 concentration (C i This improves the net photosynthetic rate under different light intensities and CO2 concentrations, and increases the PNUE under high and low nitrogen conditions.

[0025] The aforementioned increase in rice yield includes increasing the number of tillers per plant, panicle length, thousand-grain weight, seed setting rate, grain width, grain length, straw biomass per plant, and yield per plant.

[0026] The present invention has the following advantages and effects compared with the prior art:

[0027] The OsABI5 mutants osabi5-ko and osabi5-1 in this invention exhibit superior photosynthetic capacity: SPAD value, stomatal conductance (g) s ) and intercellular CO2 concentration (C i) were significantly improved, and the photosynthetic capacity under different light intensities and different CO2 concentrations was significantly enhanced. The photosynthetic nitrogen use efficiency under high nitrogen and low nitrogen conditions was significantly higher than that of wild type ZH11. The tiller number, ear length, 1000-grain weight, seed setting rate, grain width and grain length of osabi5-ko and osabi5-1 plants were significantly increased compared with ZH11. Finally, the straw biomass of osabi5-ko and osabi5-1 was increased by 13% and 14% respectively, and the yield per plant was increased by 18% and 10% respectively compared with wild type ZH11. In summary, reducing the expression of OsABI5 can effectively improve the photosynthetic efficiency and yield of rice. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 is the preparation of rice osabi5-ko plants and their growth performance; wherein (a): the nucleotide sequence of the target region in wild type and knockout strain osabi5-ko using CRISPR / Cas9 system, the deleted nucleotides are represented by red bars; (b): the phenotype and aboveground fresh weight of three-week-old wild type ZH11, osabi5-ko and osabi5-1. Compared with wild type ZH11, *P<0.05, **P<0.01; P value was obtained by Student t-test.

[0029] Figure 2 is the photosynthetic parameters of wild type ZH11, osabi5-ko and osabi5-1 at the heading stage; wherein (a): the phenotype of wild type ZH11, osabi5-ko and osabi5-1 at the filling stage; (b): relative chlorophyll content, SPAD value; (c): stomatal conductance (g s ); (d): intercellular CO2 concentration (C i ); (e): net photosynthetic rate; (f): light response curve under 0, 50, 100, 200, 300, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400 μmol m -2 s -1 PFD, and the maximum net photosynthetic rate (light-saturated photosynthetic rate, A max ) calculated from the light response curve; (g): CO2 response curve of intercellular CO2 concentration (C -1 ) under 400, 300, 200, 100, 50, 20, 200, 400, 600, 800, 1000, 1200, 1400, 1600 μmol mol i environmental CO2 concentration, and the maximum carboxylation rate (V i ) calculated from the A-C cmax curve; (h): the response curve of net photosynthetic rate to nitrogen concentration under 5 mM NO3 -(high nitrogen, HN) and 0.25 mM NO3 - The photosynthetic nitrogen use efficiency (PNUE) of the last but one leaf of wild type ZH11, osabi5-ko and osabi5-1 plants grown under low nitrogen (LN) supply conditions. *P<0.05, **P<0.01 compared with wild type ZH11; P values were obtained using Student t-test.

[0030] Figure 3 The yield traits analysis and determination of wild type ZH11, osabi5-ko and osabi5-1; (a): the mature stage phenotypes of wild type ZH11, osabi5-ko and osabi5-1 (upper panel: mature stage plant phenotypes, lower panel: single plant panicle grain phenotypes); (b): tiller number; (c): panicle length; (d): 1000-grain weight; (e): setting rate; (f): straw biomass; (g): grain yield per plant; (h): grain width and grain length. *P<0.05, **P<0.01 compared with wild type ZH11; P values were obtained using Student t-test. DETAILED DESCRIPTION

[0031] The application will be further described in conjunction with the following examples and drawings, but the embodiments of the application are not limited thereto. The test methods in the following examples, for which no specific experimental conditions are indicated, were usually carried out according to the conventional experimental conditions or according to the experimental conditions suggested by the manufacturers. The materials, reagents and the like used were commercially available reagents and materials, unless otherwise specified.

[0032] OsABI5 gene knockout plant osabi5-1 was purchased from Biogle GeneTech (http: / / biogle.cn / ), and also disclosed in the literature "CN116751812A-OsABI5 gene in enhancing rice nitrogen stress resistance application".

[0033] Example 1: Preparation of rice osabi5-ko mutant and its seedling stage phenotype

[0034] (1) Knockout of the rice OsABI5 gene: The OsABI5 gene was knocked out using the CRISPR / Cas9 system. The sequence of the OsABI5 gene is shown in XM_015773198.3 (CDS sequence is shown from 49bp to 1215bp in XM_015773198.3), and the encoded amino acid sequence is shown in XP_015628684.1. Cas9 is expressed by the maize Ubiquitin promoter Pubi, and sgRNA is expressed by the OsU6a promoter. To specifically target the rice OsABI5 gene, we synthesized a target sequence that specifically recognizes the target gene, which contains a 20bp target recognition sequence ( Figure 1 (a)). Referring to the method in the literature "Zeng Dongchang, Ma Xingliang, Xie Xianrong, et al. Operational method for construction and mutation analysis of plant CRISPR / Cas9 multi-gene editing vectors [J]. Science in China: Life Sciences, 2018, 48(7):12.DOI:CNKI:SUN:JCXK.0.2018-07-008.", the sgRNA expression cassette (OsU6a promoter-target sequence-sgRNA) was assembled into pYLCRISPR / Cas9P using the "cut-and-ligate" method. ubi Between the two BsaⅠ restriction sites of the -H plasmid, pYLCRISPR / Cas9P was constructed. ubi The -H-OsABI5 vector was transformed into the japonica rice variety Zhonghua 11 (ZH11, Oryza sativa L.) using Agrobacterium-mediated transformation. To ensure the stability of the multi-gene-edited line genotype, genotyping was performed on plants from each generation. Stable genotype plants without Cas9 (identification primer sequences: SEQ ID NO: 2-3) were selected for seed harvesting and phenotypic identification.

[0035] Target sequence (5′-3′): GAAGGTCACCGATGATCAAG; (SEQ ID NO: 1)

[0036] The Cas9 identification primer sequences (5′-3′) are as follows:

[0037] Cas9 identify F:ATGGCTCCTAAGAAGAAGCGGAA; (SEQ ID NO: 2)

[0038] Cas9 identify R:TGAAGCTTAGCGTCCTCAGCGA. (SEQ ID NO: 3)

[0039] (2) Biomass determination: Wild-type ZH11, osabi5-ko, and osabi5-1 were cultured in Kimura B nutrient solution (Yoshida et al. (1971) Laboratory Manual for Physiological Studies of Rice (Manila: International Rice Research Institute)) and placed under greenhouse conditions. The greenhouse photoperiod was 14 hours light / 10 hours dark; humidity was 60%; light intensity was 0 from 0 to 6 o'clock, and the temperature was 25°C; the light intensity at 7 o'clock was 100 μmol m. -2 s -1 The temperature is 25℃; the light intensity at point 8 is 200 μmol m. -2 s -1 The temperature is 25℃; the light intensity at point 9 is 500 μmol m. -2 s -1 The temperature was 26℃; the light intensity at 10 points was 700 μmol m. -2 s -1 The temperature was 28℃; the light intensity at 11 o'clock was 900 μmol m. -2 s -1 The temperature was 30℃; the light intensity at 12-13 o'clock was 1000 μmol m. -2 s -1 The temperature is 30℃; the light intensity at 14 o'clock is 900 μmol m. -2 s -1 The temperature was 28℃; the light intensity at 15 points was 700 μmol m. -2 s -1 The temperature was 26℃; the light intensity at 16 points was 600 μmol m. -2 s -1 The temperature was 26℃; the light intensity at 17 o'clock was 400 μmolm. -2 s -1 The temperature was 25℃; the light intensity at 18 points was 200 μmol m. -2 s -1 The temperature was 25℃; the light intensity at 19 points was 100 μmol m. -2 s -1 The temperature was 25℃; the light intensity was 0 from 20:00 to 24:00, and the temperature was 25℃. When the seedlings reached 3 weeks of age, the above-ground parts were cut from the connection between the root and the stem. Four seedlings were set up as one replicate, and 10 biological replicates were set up for fresh weight determination.

[0040] Experiments showed that the biomass of rice OsABI5 gene knockout plants osabi5-ko and osabi5-1 was significantly increased compared with wild-type ZH11. Figure 1 (b) shows that knocking out the OsABI5 gene promotes rice growth.

[0041] Example 2: Determination of photosynthetic parameters of osabi5-ko and osabi5-1

[0042] (1) Determination of relative chlorophyll content (SPAD value): ZH11, osabi5-ko, and osabi5-1 were planted in a field in Guangzhou in autumn 2024. The lines were arranged in a randomized block design with a planting density of 15 × 15 cm per plant, in at least two blocks. Phenotypic values ​​were recorded during the grain-filling stage. Figure 2 (a) and the SPAD value of the sword leaf was determined. Three points were taken from the middle part of the best-growing sword leaf of each seedling for measurement. The average value of the three points was taken as the SPAD value of the plant. Each seedling was a biological replicate, and no less than 10 biological replicates were measured for each strain.

[0043] Experiments showed that the relative chlorophyll content of osabi5-ko and osabi5-1 was significantly higher than that of wild-type ZH11. Figure 2 (b) in the middle.

[0044] (2) Measurement of photosynthetic parameters: ZH11, osabi5-ko, and osabi5-1 were cultured in containers containing approximately 10 L of clay, with 4 seedlings in each container. Approximately 70 days later, when the seedlings were in the heading stage, the photosynthetic parameters of wild-type ZH11, osabi5-ko, and osabi5-1 were measured using a LI6800-XT photosynthesis system (LI-COR, USA) with a leaf chamber temperature of 30℃ and a relative humidity of 60%. The CO2 concentration was 400 μmol / mol. -1 , PFD (photosynthetic photon flux density) is 1,000μmol m -2 s -1 Under the conditions, its porosity (g) was measured. s ), intercellular CO2 concentration (C i ) and net photosynthetic rate; at 0, 50, 100, 200, 300, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400 μmol m -2 s -1 The light response curve was measured under PFD, and the maximum net photosynthetic rate (light-saturated photosynthetic rate, A) was calculated from the light response curve. max ); at 400, 300, 200, 100, 50, 20, 200, 400, 600, 800, 1000, 1200, 1400, 1600 μmol mol -1The CO2 response curve was measured under ambient CO2 concentration, and the AC value was calculated from the CO2 response curve using the built-in system of the LI6800-XT photosynthesis system. i Curve, then from AC i The maximum carboxylation rate (V) calculated from the curve cmax A max and V cmax All results were calculated using plant light and CO2 response models constructed by Ye Zihua et al. (photosynthetic.sinaapp.com).

[0045] Experimental results show that the stomatal conductance (g) of osabi5-ko and osabi5-1 is significantly higher than that of osabi5-1. s , Figure 2 (c) in the middle), intercellular CO2 concentration (C) i , Figure 2 (d) and net photosynthetic rate ( Figure 2 The net photosynthetic rate of osabi5-ko and osabi5-1 was significantly higher than that of ZH11 under different light intensities. The light response curves showed that, under different light intensities, the net photosynthetic rates of osabi5-ko and osabi5-1 were significantly higher than those of ZH11, and their maximum net photosynthetic rate (A) was significantly higher. max ) increased by 16% and 11% respectively. Figure 2 (f)). The carbon dioxide response curves further confirmed that, at different CO2 concentrations, the net photosynthetic rates of osabi5-ko and osabi5-1 were higher than those of ZH11, and their maximum carboxylation rate (V) was higher. cmax ) respectively increased by 44% and 42% Figure 2 (g) in the middle.

[0046] (3) Determination of photosynthetic nitrogen use efficiency (PNUE): Germinated ZH11, osabi5-ko, and osabi5-1 seedlings were cultured in small pots containing approximately 300 mL of clay. The bottom of each pot was perforated, and one seedling was planted in each pot. These small pots were then placed in a large pot measuring 520×350×150 cm. A modified Kimura B nutrient solution with high nitrogen (HN) and low nitrogen (LN) was added to the large pot. (Yoshida et al. (1971) Laboratory Manual for Physiological Studies of Rice (Manila: International Rice Research)) Institute)): KNO3 (0.18mM), Ca(NO3)·4H2O (0.37mM), (NH4)2SO4 (0.36mM), MgSO4·7H2O (0.55mM), CaCl2 (0.37mM), K2S O4 (0.09mM), KH2PO4 (0.18mM), FeSO4·7H2O (20μM), Na2EDTA (20μM), MnCl2·4H2O (9.14μM), H3BO3 (46.2μM), (NH4)6Mo7O 24 The nutrient solutions used were 4H₂O (0.15 μM), ZnSO₄·7H₂O (0.76 μM), and CuSO₄·5H₂O (0.32 μM). In the modified Kimura B culture medium, KNO₃ was replaced with KCl, and Ca(NO₃)·4H₂O was replaced with CaCl₂. 5 mM and 0.25 mM KNO₃ were added, respectively, while the control group was supplemented with 5 mM and 0.25 mM KCl. The rice received its main nutrients and water from the nutrient solution, without additional watering or fertilization. The culture medium was refreshed every 3 days.

[0047] Approximately 70 days later, when the seedlings were in the heading stage, a photosynthesis system LI6800-XT (LI-COR, USA) was used, with the leaf chamber temperature set at 30℃, relative humidity at 60%, and CO2 concentration at 400 μmol / L. -1 , PFD (photosynthetic photon fluxdensity) is 1200μmol m -2 s -1 Under the specified conditions, the net photosynthetic rates of ZH11, osabi5-ko, and osabi5-1 were measured. A 1cm section was cut from the leaf region where the net photosynthetic rate was measured. 2Leaves were collected, with at least 10 biological replicates for each strain. After drying, the leaves were sent to Shanghai Youxuan Biotechnology Co., Ltd. to determine the total nitrogen content using the Kjeldahl method. Finally, the photosynthetic nitrogen use efficiency was calculated.

[0048] The formula for calculating photosynthetic nitrogen use efficiency is as follows: PNUE = P n ×SLA / N mass ;P n Leaf net photosynthetic rate (unit: μmol CO2 m) -2 s -1 N mass Nitrogen content per unit leaf dry weight (unit: g N g) -1 DW); SLA: Specific leaf area (unit: m²) 2 g -1 DW, which stands for leaf area per unit dry weight.

[0049] The results showed that the photosynthetic nitrogen use efficiency of osabi5-ko and osabi5-1 was significantly higher than that of ZH11 under both high and low nitrogen conditions. Figure 2 (h) in the middle.

[0050] Example 3: Analysis and determination of yield traits of osabi5-ko and osabi5-1

[0051] In the autumn of 2024, ZH11, osabi5-ko, and osabi5-1 were planted in a field in Guangzhou. The lines were arranged in a randomized block design with a planting density of 15 × 15 cm per plant, in at least two blocks. Phenotypic results were recorded at maturity. Figure 3 In step (a), after harvesting and drying, the number of tillers, panicle length, thousand-grain weight, seed setting rate, grain width, grain length, single-plant straw biomass, and single-plant yield were measured. Single-plant straw biomass was the dry weight of a single rice plant after removing panicle grains; single-plant yield was the dry weight of panicle grains after removing all panicle grains and empty grains. Each of these operations was performed in at least 30 biological replicates.

[0052] The results showed that the number of tillers in osabi5-ko and osabi5-1 plants ( Figure 3 (b) of the middle, ear length ( Figure 3 (c) of the middle, thousand-grain weight ( Figure 3 (d) in the middle), fruit setting rate ( Figure 3 (e) in the middle, grain width and grain length ( Figure 3 The (h) of the osabi5-ko and osabi5-1 plants was significantly higher than that of the wild type. Ultimately, the single-plant straw biomass of osabi5-ko and osabi5-1 was increased by 13% and 14% respectively compared to the wild type. Figure 3 In (f)), the yield per plant increased by 18% and 10% respectively. Figure 3 (g) in the middle.

[0053] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of the OsABI5 gene, characterized by: For one of the following applications: (1) Application in increasing rice yield; (2) Application in improving rice photosynthesis; (3) Application in improving the growth and development of rice.

2. The application according to claim 1, characterized in that: For one of the following applications: (I) Application in improving the number of tillers, panicle length, thousand-grain weight, seed setting rate, grain width, grain length, single-plant straw biomass and / or single-plant yield of rice; (II) Application in improving chlorophyll content, stomatal conductance, intercellular CO2 concentration, net photosynthetic rate, maximum net photosynthetic rate, maximum carboxylation rate and / or photosynthetic nitrogen use efficiency in rice.

3. The application of the OsABI5 gene is characterized by: For one of the following applications: (a) Applications in plant breeding; (b) Application in the cultivation of transgenic plants.

4. The application according to claim 3, characterized in that: The plants mentioned include rice, wheat, sorghum, millet, corn, Arabidopsis thaliana, sugarcane, cotton, tomato, alfalfa, and elephant grass.

5. The application according to any one of claims 1 to 4, characterized in that: The amino acid sequence encoded by the rice OsABI5 gene is shown in GenBank ID: XP_015628684.

1.

6. The application according to any one of claims 1 to 4, characterized in that: The sequence of the rice OsABI5 gene is one of the following nucleotide sequences: 1) The DNA sequence shown in GenBank ID: XM_015773198.3; 2) The DNA sequence shown from 49bp to 1215bp in GenBank ID: XM_015773198.3; 3) The DNA sequence encoding the protein shown in GenBank number XP_015628684.

1.

7. The application according to any one of claims 1 to 4, characterized in that: The application is achieved by knocking out or knocking down the rice OsABI5 gene.

8. The application according to claim 7, characterized in that: The knockout or knockdown is achieved through genome editing technology or RNA interference technology.

9. A method for rice breeding, characterized in that: The process includes the following steps: obtaining the OsABI5 gene by knocking out or knocking down the OsABI5 gene in rice.

10. A method for improving photosynthesis and yield in rice, characterized in that: The steps include: improving rice photosynthesis and yield by knocking out or knocking down the OsABI5 gene in rice.

Images