Method for efficiently knocking out heterooctaploid Changfeng crucian carp runx2b gene and application
By designing a method for microinjection of specific gRNA targeting the CRISPR/Cas9 system, the problem of low efficiency in editing the runx2b gene of allogeneic octoploid crucian carp was solved, achieving efficient synchronous knockout and significantly reducing the formation of intermuscular spines.
Patent Information
- Application Number
- CN202511085367.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-04
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2045-08-04
AI Technical Summary
Existing technologies are insufficient to efficiently knock out the runx2b gene in allooctoploid crucian carp, resulting in a negligible reduction in the number of intermuscular spines and low gene editing efficiency, as well as off-target risks and non-specific cleavage issues.
Two gRNAs (gRNA-1 and gRNA-2) were designed to target two sets of runx2b alleles from two parents in crucian carp, and were microinjected into fertilized eggs using the CRISPR/Cas9 system to achieve simultaneous editing of eight alleles.
The system achieved efficient knockout of the runx2b gene in allooctoploid crucian carp, with a simultaneous knockout rate of 97.5%-100%, overcoming the difficulties of multi-allelic gene editing and significantly reducing the formation of intermuscular spines.
Smart Images

Figure CN120966918A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a method and application for efficiently knocking out the runx2b gene in allooctoploid crucian carp. Background Technology
[0002] Crucian carp (Carassius auratus) is an important freshwater aquaculture fish in my country. In 2023, its aquaculture production reached 2.8403 million tons, ranking fifth among freshwater aquaculture producers, making a significant contribution to ensuring a stable and effective supply of aquatic products (China Fisheries Statistical Yearbook, 2024). The Changfeng crucian carp was a new crucian carp variety that was systematically bred by the Yangtze River Fisheries Research Institute of the Chinese Academy of Fishery Sciences and the Institute of Hydrobiology of the Chinese Academy of Sciences in 2008. The sixth generation of heterologous gynogenesis was completed in 2015, and it officially passed the national aquatic variety approval in 2016. The Changfeng crucian carp strain uses the heterozygous silver crucian carp (Carassius auratus gibelio) D line as the maternal parent and the Xingguo red carp (Cyprinus carpio var. Xingguonensis) line as the paternal parent. Through heterozygous gynogenesis technology, exogenous genetic material is integrated. Its genome contains the complete genome of the maternal heterozygous silver crucian carp and the genome of the paternal Xingguo red carp, forming a genetically stable heteroooctoploid population with approximately 208 chromosomes, about 50 more chromosomes than the heterozygous silver crucian carp. Changfeng crucian carp grows rapidly, with 1-year-old and 2-year-old fish growing at rates more than 25.0% and 16.0% faster than ordinary silver crucian carp, respectively. Its flesh is delicate, with a muscle fiber density of only 184±24 fibers / mm², 23%–37% finer than ordinary silver crucian carp, resulting in a superior taste. It is rich in nutrients, with a DHA content of 10.3%, 2.28 times that of Pengze crucian carp; and an arachidonic acid content of 8.3%, 1.62 times that of Pengze crucian carp. In a study of 21 fatty acids, the content of unsaturated fatty acids and DHA was 115.16% and 255.17% higher than that of the heterozygous silver crucian carp D strain, respectively. It exhibits strong resistance to adverse conditions and adapts well to various controlled freshwater bodies (such as ponds and paddy fields) throughout China.
[0003] Runt-related transcription factor 2 (Runx2) is a core member of the Runx transcription factor family, which plays a key role in the development of vertebrate skeleton. Studies have shown that there are two direct homologous genes, runx2a and runx2b, in zebrafish. Among them, runx2b has been confirmed to be a core transcription factor for regulating the formation of fish spinules. Through comparing the gene expression differences between the bone tissue cell line and the muscle cell line of the mandarin fish, Guan et al. found that runx2b had a significant up-regulation characteristic in the process of osteoblast differentiation, which provided important basis for the molecular mechanism research of spinule formation. Nie Chunhong et al. further constructed a runx2b deletion zebrafish model through gene editing technology, which confirmed that the deletion of the gene could lead to the complete absence of spinules and did not affect the development of other bones, and clarified the functional positioning of runx2b as a key gene for spinule development.
[0004] As an effective means of precise modification of target genes, gene editing technology has experienced the stages of homologous recombination, zinc finger nucleases (ZFNs), effector nucleases (TALENs), etc. Among them, the CRISPR / Cas9 system has become the current mainstream technology due to its high editing efficiency and strong specificity. However, the genome of the octoploid Carassius auratus gibelio has doubled the number of alleles, resulting in a significant increase in gene redundancy. Knocking out the gene sequence from either the hybrid silver carp or the Xingguo red carp cannot effectively reduce the number of spinules, and the low targeting efficiency of gene editing often leads to random distribution and uncontrollable proportion of phenotypes in offspring. The presence of a large number of repetitive sequences in the genome forms a complex secondary structure, which interferes with the effective binding of gRNA to the target site, and the presence of paralogous sequence variation causes non-specific cutting, doubling the risk of off-targeting. After DNA double-strand break, competitive repair between alleles can cause non-dominant alleles to escape editing, and the non-homologous end joining pathway produces random insertion / deletion mutations, which easily cause nonsense mutations and increase the probability of chimeric formation. Therefore, there is still a lack of efficient solutions for the synchronous editing of multiple alleles of runx2b in the octoploid Carassius auratus gibelio. SUMMARY
[0005] Therefore, the present application provides a method for efficiently knocking out the runx2b gene of the heterologous octoploid Carassius auratus gibelio and its application.
[0006] The technical scheme of the present application is as follows:
[0007] In a first aspect, the present application provides a method for efficiently knocking out the runx2b gene of the heterologous octoploid Carassius auratus gibelio, comprising the following steps:
[0008] S1, gRNA-1 and gRNA-2 are designed for two sets of runx2b alleles of longfeng crucian (runx2b-A and runx2b-B genes from gynogenetic gibel carp, and runx2b-A and runx2b-B genes from xingguo red common carp); the gRNA-1 or gRNA-2 specifically targets 8 alleles of runx2b (all runx2b alleles) at the same time; wherein the gRNA-1 target site sequence is shown as SEQ ID NO: 1, and the gRNA-2 target site sequence is shown as SEQ ID NO: 2;
[0009] S2, the conservative downstream Scaffold overlap primer is used with the upstream primer with T7 promoter and specific gRNA-1 target site sequence or gRNA-2 target site sequence for overlap PCR amplification and purification; the above purified PCR product is used as a template for in vitro transcription and purification to obtain gRNA-1 and gRNA-2 respectively; gRNA-1, gRNA-2 and Cas9 protein are mixed and microinjected into fertilized eggs of single cell stage of longfeng crucian.
[0010] Further, in some specific embodiments, in step S2, after mixing gRNA-1, gRNA-2 and Cas9 protein, the final concentration of gRNA-1 and gRNA-2 is 400 ng / μL, and the concentration of Cas9 protein is 5 μM.
[0011] Further, in some specific embodiments, in step S2, 0.005 μL of the mixture of gRNA-1, gRNA-2 and Cas9 protein is injected into each fertilized egg.
[0012] Further, in some specific embodiments, in step S2, before microinjection, the fertilized eggs of longfeng crucian are obtained by parthenogenetic operation, and the parthenogenetic operation is as follows: the female longfeng crucian and the male xingguo red common carp are injected with oxytocin respectively, wherein the injection dose of oxytocin for the xingguo red common carp is half of that for the longfeng crucian, and after the longfeng crucian starts to lay eggs, artificial insemination is performed to obtain the fertilized eggs.
[0013] Further, in some specific embodiments, the method for efficiently knocking out the heterologous octoploid Carassius auratus gibelio runx2b gene further comprises the following steps: hatching the injected Carassius auratus longipinnis single-cell stage zygotes into juvenile fish stage, taking the caudal fin, extracting genomic DNA, performing PCR amplification with SEQ ID NO: 6-13 as primers, sequencing the PCR product, and selecting Carassius auratus longipinnis in which runx2b-A and runx2b-B genes from Carassius auratus gibelio and Cc are simultaneously knocked out. The Carassius auratus F0 generation individuals in which Cg runx2b-A (from Carassius auratus gibelio), Cc runx2b-A (from Xingguo red common carp), Cg runx2b-B, and Cc runx2b-B are synchronously knocked out successfully are verified by PCR and sequencing, and are bred into parents for breeding of the offspring of the Carassius auratus longipinnis without intramuscular spurs.
[0014] Further, in some specific embodiments, in the step S2, the upstream primer for overlap PCR amplification of gRNA-1 is shown as SEQ ID NO: 3, and the downstream primer is shown as SEQ ID NO: 5; the upstream primer for overlap PCR amplification of gRNA-2 is shown as SEQ ID NO: 4, and the downstream primer is shown as SEQ ID NO: 5.
[0015] In a second aspect, the present application provides a gRNA combination of a heterologous octoploid Carassius auratus longipinnis runx2b gene, which comprises gRNA-1 and gRNA-2; the target site sequence of gRNA-1 is shown as SEQ ID NO: 1, and the target site sequence of gRNA-2 is shown as SEQ ID NO: 2.
[0016] In a third aspect, the present application provides application of the gRNA combination in breeding of Carassius auratus longipinnis mutant lines.
[0017] In a fourth aspect, the present application provides a knockout composition of a heterologous octoploid Carassius auratus longipinnis runx2b gene, which comprises the gRNA combination of claim 7 and a Cas9 protein.
[0018] In a fifth aspect, the present application provides a knockout kit of a heterologous octoploid Carassius auratus longipinnis runx2b gene, which comprises the gRNA combination of claim 7 and a Cas9 protein.
[0019] The present application has at least the following beneficial effects:
[0020] The gRNA-1 (or gRNA-2) provided by the application can guide the CRISPR / Cas9 system to simultaneously edit all 8 alleles of runx2b-A and runx2b-B of two parent sources in allo-octoploid Procyprinus longimamus. Among them, gRNA-1 achieves a synchronous knockout rate of 97.5%, and gRNA-2 achieves a synchronous knockout efficiency of 95%; when the double gRNA synergistic cleavage strategy is used, the complete editing efficiency of 8 functional copies reaches 100%. The application overcomes the difficulty of simultaneously knocking out multiple homologous genes, establishes a kind of efficient gene editing technology for allo-octoploid Procyprinus longimamus, forms a method for quickly knocking out all runx2b homologous genes in vivo, and has important application value. BRIEF DESCRIPTION OF DRAWINGS
[0021] In order to more clearly illustrate the technical solutions in the embodiments of the application, the drawings needed in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor.
[0022] Figure 1 The sequence schematic diagram of the target site of the runx2b-A gene and the runx2b-B gene of Procyprinus longimamus is drawn based on the runx2b gene in the genome sequence of Carassius auratus gibelio (GCA_023724075.1 / GCA_023724085.1 / GCA_023724075.1) and the genome sequence of Cyprinus carpio (Cypcar_WagV4.0) in the GenBank database; Cg runx2b-A / Cg runx2b-B represents the runx2b-A / runx2b-B gene inherited from Carassius auratus gibelio in Procyprinus longimamus, and Cc runx2b-A / Cc runx2b-B represents the runx2b-A / runx2b-B gene inherited from Cyprinus carpio var. sinensis in Procyprinus longimamus;
[0023] Figure 2 The sequencing diagram of the PCR product for detecting the mutation of the runx2b-A gene target site of F0 generation Procyprinus longimamus (Mutant) and wild type (WT) provided by the embodiment is shown in the figure, the red underlined part represents the target site of the target gene, and the red arrow represents the mutation position; Cg runx2b-A / Cg runx2b-B represents the runx2b-A / runx2b-B gene inherited from Carassius auratus gibelio in Procyprinus longimamus, and Cc runx2b-A / Cc runx2b-B represents the runx2b-A / runx2b-B gene inherited from Cyprinus carpio var. sinensis in Procyprinus longimamus;
[0024] Figure 3Sequencing chromatograms of PCR products for F0 generation Mutant and wild type (WT) of runx2b-B gene target site mutation detection provided for the examples, in which the red underlined indicates the target site of the gene of interest, and the red arrow indicates the mutation position; Cg runx2b-A / Cg runx2b-B represents the runx2b-A / runx2b-B gene of Changfeng crucian inherited from the co-cultured gibel carp, and Cc runx2b-A / Cc runx2b-B represents the runx2b-A / runx2b-B gene of Changfeng crucian inherited from the Xingguo red common carp. DETAILED DESCRIPTION
[0025] To make the objectives, technical solutions and advantages of the present application clearer, the technical solutions in the present application will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the protection scope of the present application. The specific conditions not mentioned in the embodiments are carried out according to the conventional conditions or the conditions suggested by the manufacturers. The reagents or instruments not mentioned by the manufacturers are all conventional products that can be obtained by market purchase.
[0026] 1. Experimental materials
[0027] The wild type Changfeng crucian (see patent CN109874707A) male and female parents in the examples were bred in Yaowan Experimental Factory of Changjiang Fisheries Research Institute, Chinese Academy of Fishery Sciences. The embryos used for microinjection of Changfeng crucian were obtained by artificial spawning of sexually mature male and female parents.
[0028] Table 1 Sequence information table
[0029]
[0030] 2. Target site design
[0031] Changfeng crucian belongs to allopolyploid crucian, whose genome is composed of a complete set of genomes of gynogenetic crucian carp (two sets of triploid chromosomes) and a set of genomes of Xingguo red common carp. In the runx2b gene family, Changfeng crucian carries 8 functional copies, including 4 runx2b-A subtypes and 4 runx2b-B subtypes. Specifically, 3 copies of runx2b-A are derived from the genome of gynogenetic crucian carp, and 1 copy is derived from the genome of Xingguo red common carp; the copy source pattern of runx2b-B is consistent with that of runx2b-A, that is, 3 copies are from gynogenetic crucian carp, and 1 copy is from Xingguo red common carp. The CDS region of the runx2b gene in the gynogenetic crucian carp genome (GCA_023724075.1 / GCA_023724085.1 / GCA_023724075.1) and the common carp genome (Cypcar_WagV4.0) in the GenBank database was used as a reference sequence to design target points, and was verified in the cDNA of Changfeng crucian.
[0032] The design of gRNA target sites was screened on the website (https: / / www.crisprscan.org) for suitable target sites of the target gene; the gRNA target site of the target gene was preferably designed in the exon or functional region; the target site with a higher score was selected to ensure that it was an effective target site; the target sequence was ensured to be connected with PAM (NGG); in addition, the target site of the target gene designed could be detected for GC content, Tm value and secondary structure through the website (http: / / www.oligoevaluator.com / LoginServlet). The sequence of synthesized gRNA was composed of a 17bp T7 promoter, a 20bp target sequence and a 20bp scaffold overlap sequence: (TAATACGACTCACTATAggNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC).
[0033] The gRNA-1 target site in this embodiment is located in the conserved sequence region of the first exon of the runx2b-A gene of the gibel carp, the third exon of the runx2b-A gene of the common carp, the third exon of the runx2b-B gene of the gibel carp, and the second exon of the runx2b-B gene of the common carp. The target site can cover 4 copies of runx2b-A and 4 copies of runx2b-B at the same time, and realize synchronous editing of 8 functional copies by single CRISPR-Cas9 operation. Similarly, the gRNA-2 target site is also located in the conserved sequence region of the above-mentioned genes (the first exon of the runx2b-A gene of the gibel carp, the third exon of the runx2b-A gene of the common carp, the third exon of the runx2b-B gene of the gibel carp, and the second exon of the runx2b-B gene of the common carp), and can synchronously target 8 functional copies (4x runx2b-A+4x runx2b-B). The gRNA-2 guides the CRISPR-Cas system, and forms a double cutting strategy spatially adjacent to the gRNA-1, which further improves the gene editing efficiency (as shown in FIG. 1). Figure 1 The gRNA-1 target site and the gRNA-2 sequence are as follows:
[0034] gRNA-1 target site: 5'-GGGCCGGAGGTTCAGTCCGC-3'
[0035] gRNA-2 target site: 5'-GGGAGCGGTTCTCTTGCGCG-3'
[0036] 3. Synthesis of gRNA primers and PCR amplification
[0037] The primers are designed and synthesized, and the primers are subjected to PCR amplification to obtain the gRNA.
[0038] The upstream primer with a T7 promoter and specifically containing the gRNA-1 target site sequence is as follows:
[0039] TAATACGACTCACTATAGGGCCGGAGGTTCAGTCCGCGTTTTAGAGCTAGAAATAGC
[0040] The upstream primer with a T7 promoter and specifically containing the gRNA-2 target site sequence is as follows:
[0041] TAATACGACTCACTATAGGGAGCGGTTCTCTTGCGCGGTTTTAGAGCTAGAAATAGC
[0042] The same downstream primer Scaffold is used for gRNA-1 and gRNA-2:
[0043] AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC
[0044] The above primers were subjected to PCR amplification, and the PCR system was as follows: 10 μM gRNA upstream and downstream primers 2.5 μL each, Master Mix 25 μL, supplemented with 50 μL of enzyme-free water, 100 μL for each gRNA amplification of 2 tubes. The PCR amplification procedure was denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, for 30 cycles; re-extension at 72°C for 5 min, and storage at 4°C. The PCR product was detected by 1.5% agarose gel electrophoresis.
[0045] 4. PCR product recovery and purification
[0046] After detection, the PCR product was purified and recovered by Omega agarose gel recovery kit, and the concentration was measured by Nanodrop 2000 (Thermo Scientific, USA). According to the instructions of Transcriptaid T7 high yield transcription kit (Thermo Scientific, USA), RNA was transcribed in vitro, then purified by phenol-chloroform extraction and anhydrous ethanol precipitation to obtain gRNA-1 and gRNA-2, respectively. 1 μL of RNA was taken to measure the concentration, and the quality of the RNA was detected by 1.5% agarose gel electrophoresis and stored at -80°C for later use.
[0047] 5. Microinjection
[0048] Before injection, female Changfeng crucian carp and male Xingguo red carp were placed in the breeding parent pool, and the female parent was injected with luteinizing hormone releasing hormone A2 (0.16 μg / kg) for labor induction, and the male parent was injected with half the amount of the female parent. The effect time of the labor induction agent after injection was generally 10 h (the effect time was closely related to water temperature, and the time was appropriately shortened or lengthened according to different water temperatures). After the female Changfeng crucian carp began to spawn, artificial insemination was performed to obtain fertilized eggs. Microinjection was started 10 min after the female Changfeng crucian carp began to spawn (the fertilized eggs developed to the single cell stage after the embryos were absorbed water). The injection system was prepared by mixing gRNA-1, gRNA-2, Cas9 protein and nuclease-free water, in which the final concentration of gRNA-1 was 400 ng / μL, the final concentration of gRNA-2 was 400 ng / μL, and the final concentration of Cas9 protein was 5 μM Spy Cas9 NLS nuclease Cat# M0646T) and 0.2% (wt%) of phenol red as an indicator. The experimental reagents were injected into the single-cell stage of the C. idellus embryos at a dose of 0.005 ng / particle of fertilized eggs using a Picoliter Microinjector injection instrument (Warner, PL-100A, USA). After the injection was completed, the C. idellus embryos were incubated in still water in a pond, and the water temperature was 25±2℃. During the hatching process of the C. idellus, special attention should be paid to the management of water quality, keeping sufficient oxygen in the water, timely water change and cleaning dead eggs to prevent hypoxia or water mold disease.
[0049] 6. Detection of mutation rate of target site
[0050] Ten C. idellus juvenile fish (8-10 cm in length) edited by CRISPR / cas9 and 10 wild type C. idellus juvenile fish were randomly selected, and the tail fins were cut and placed in 0.2 ml eight-tube tubes. After 100 μL NaOH was added and reacted at 94℃ for 20 min, the reaction was terminated at 4℃ for 20 min, vortexed, 5 μl of Tris-Hcl was added, mixed, and stored at 4℃ as a DNA template. The amplification primers were:
[0051] Cg runx2b-A-F: 5 'GATAGCTGACCAAACCGTGCGA 3 '
[0052] Cg runx2b-A-R: 5 'CTATTCGTATTTGTCATTGCTGCA 3 '
[0053] Cg runx2b-B-F: 5 'GAGTGCTGGCCGAATCGTACA 3 '
[0054] Cg runx2b-B-R: 5 'TTCTCTATTTGTCAGTGCTGTCA 3 '
[0055] Cc runx2b-A-F: 5 'CGGAGAGCTGACCGAACTGTAC 3 '
[0056] Cc runx2b-A-R: 5 'ACTGTATTCATAAAGACTAACGCG 3 '
[0057] Cc runx.2b-B-F: 5 'GAGAGCTGACCAAACCGTGCAA 3 '
[0058] Cc runx2b-B-R: 5 'TCCACGTTGCACATATTACTTTAATA 3 '
[0059] The amplification PCR system is: 1.5 μL of upstream and downstream primers respectively, Master Mix 25 μL, DNA template 2 μL, and enzyme-free water supplemented to 50 μL. The PCR amplification procedure is 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 30 s, 32 cycles; 72°C re-extension for 5 min, and 4°C storage. Then the purified PCR product is cloned and subjected to Sanger sequencing. The Sanger sequencing peak chart of the wild type is a single peak in the upstream and downstream regions near the target site, and the Sanger sequencing peak chart of the CRISPR / cas9 edited experimental fish has a nested peak in the region near the target site, which is preliminarily judged to be knockout at the target site (such as Figure 2 and Figure 3 As shown). By comparing the mutant sequence and the wild type sequence in Cg runx2b-A1 / A2 / A3, Cc runx2b-A, Cg runx2b-B1 / B2 / B3 and Cc runx2b-B, the knockout efficiency of target site 1 and target site 2 is finally determined. The statistical results are as follows:
[0060]
[0061] Note: ○ represents successful knockout, and × represents unsuccessful knockout.
[0062] From the above experimental data, it can be seen that the target site 1 achieves a synchronous knockout rate of 97.5% in the runx2b gene of the hybrid silver carp and the Xingguo red carp, and the target site 2 achieves a synchronous knockout efficiency of 95%; when the double gRNA collaborative cutting strategy is used, the complete editing efficiency of the 8 functional copies reaches 100%. The Cg runx2b-A, Cc runx2b-A, Cg runx2b-B and Cc runx2b-B synchronous knockout success screened by PCR and sequencing are bred to 180 dph, and then the X-ray imaging instrument is used for rapid scanning screening in vivo. Compared with the normal intermuscular spine wild type silver carp, about 55% (n=34 / 62) of the runx2b-A and runx2b-B mutant hybrid silver carp in the F0 generation showed partial deletion of the intermuscular spine. These individuals with partial deletion of the intermuscular spine will be bred into parents for the breeding of the next generation of hybrid silver carp without intermuscular spine.
[0063] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. A method for efficiently knocking out the runx2b gene of a heterologous octoploid Carassius auratus gibelio, characterized in that, It comprises the following steps: S1, designing gRNA-1 and gRNA-2 for runx2b alleles of two sets of parent sources in Changfeng crucian; the gRNA-1 or gRNA-2 specifically targets 8 alleles of runx2b at the same time; wherein the gRNA-1 target site sequence is shown as SEQ ID NO: 1, and the gRNA-2 target site sequence is shown as SEQ ID NO: 2; S2, using a conservative downstream Scaffold overlap primer and an upstream primer with a T7 promoter containing the gRNA-1 target site sequence or the gRNA-2 target site sequence, performing overlap PCR amplification and purification; using the above purified PCR product as a template, in vitro transcription and purification are performed to obtain gRNA-1 and gRNA-2 respectively; mixing gRNA-1, gRNA-2 and Cas9 protein, and microinjecting into fertilized eggs of Changfeng crucian at the single cell stage.
2. The method of claim 1, wherein, In the step S2, after mixing gRNA-1, gRNA-2 and Cas9 protein, the final concentration of gRNA-1 and gRNA-2 is 400 ng / μL, and the final concentration of Cas9 protein is 5 μM.
3. The method of claim 2, wherein, In the step S2, 0.005 μL of the mixture of gRNA-1, gRNA-2 and Cas9 protein is injected into each fertilized egg.
4. The method of claim 1, wherein, In the step S2, before microinjection, the fertilized eggs of Changfeng crucian are obtained by parthenogenetic operation, and the parthenogenetic operation is as follows: the female Changfeng crucian and the male Xingguo red crucian are injected with oxytocin respectively, wherein the injection dose of oxytocin for the male Xingguo red crucian is half of that for the female Changfeng crucian, and after the female Changfeng crucian starts to lay eggs, artificial insemination is performed to obtain fertilized eggs.
5. The method of claim 1, wherein, It further comprises the following steps: hatching the single cell stage fertilized eggs of Changfeng crucian after injection to the juvenile stage, taking the tail fins, extracting genomic DNA, performing PCR amplification with SEQ ID NO: 6-13 as primers, sequencing the PCR products, and selecting Changfeng crucian in which runx2b-A and runx2b-B genes from the hybrid crucian carp and the Xingguo red crucian are simultaneously knocked out.
6. The method of claim 1, wherein, In the step S2: the upstream primer for overlap PCR amplification of gRNA-1 is shown as SEQ ID NO: 3, and the downstream primer is shown as SEQ ID NO: 5; the upstream primer for overlap PCR amplification of gRNA-2 is shown as SEQ ID NO: 4, and the downstream primer is shown as SEQ ID NO:
5.
7. A gRNA combination of the heterologous octoploid Procyprinus cunlins runx2b gene, characterized by, It comprises gRNA-1 and gRNA-2; the gRNA-1 target site sequence is shown as SEQ ID NO: 1, and the gRNA-2 target site sequence is shown as SEQ ID NO:
2.
8. The gRNA combination of claim 7 is used for breeding mutant strains of Changfeng crucian.
9. A knock-out composition of the heterologous octoploidy of the runx2b gene of Tanichthys albonubes, characterized in that, It comprises the gRNA combination of claim 7 and Cas9 protein.
10. A knock-out kit of a heterologous octoploid Procyprinus cunlins runx2b gene, characterized in that, It comprises the gRNA combination of claim 7 and Cas9 protein.
Citation Information
Patent Citations
Method for efficiently creating heterooctaploid silver crucian carp
CN109874707A
Intramuscular-thorn-free germplasm creation method for breeding economic fishes and application
CN115720874A
Method for creating intermuscular spiny prussian carp
CN115943930A
Method for knocking out runx2b gene at double gRNA sites in grass carp and application
CN116515907A
Method for creating intermuscular thorn-free grass carp based on runx2b gene editing and application
CN117265017A