Male Hexagrammos otakii deleted DNA fragment and application of primer in sex determination

Abstract

The invention relates to application of a DNA fragment deleted by male hexagrammos otakii and a primer in sex identification, and belongs to the field of molecular technology detection. The invention provides a DNA (Deoxyribose Nucleic Acid) fragment specifically deleted from male hexagrammos otakii and a detection primer thereof. The DNA fragment has a nucleotide sequence as shown in SEQ ID NO: 1. The sequences of the primers are as shown in SEQ ID NO: 4 and SEQ ID NO: 5. The genetic sex of the hexagrammos otakii can be accurately and efficiently identified by utilizing the DNA fragment and the primer thereof, the identification method is simple and easy to operate, the required cost is low, and the method is suitable for large-scale detection in breeding work.

Description

Technical Field

[0001] This invention belongs to the field of molecular technology detection, specifically involving the application of missing DNA fragments and primers in the sex identification of male Hexagrammos otakii. Background Technology

[0002] The ogakii (Hexagrammos otakii), belonging to the wrasse family, is an important marine economic fish widely distributed in the Northwest Pacific Ocean, primarily inhabiting the coastal waters of northern China, Japan, and the waters surrounding the Korean Peninsula. In recent years, due to overfishing and the continued deterioration of the marine environment, the wild population of this species has shown a continuous downward trend. Furthermore, the ogakii is widely popular for its delicious and nutritious flesh, making it an important economic species in marine fisheries and highly favored by consumers and aquaculture practitioners.

[0003] Currently, although adult fish exhibit certain sex differences in their external physical characteristics, it remains difficult to accurately determine the sex of juvenile fish based on external morphology. Existing methods for sex determination mainly rely on histological observation of gonads, which is not only complex and time-consuming but also potentially lethal, severely hindering the efficient implementation of resource assessment, artificial breeding, and germplasm improvement.

[0004] Therefore, developing an efficient, accurate, and non-invasive molecular sex marker method is of great significance for early sex identification and sex-controlled breeding of *Hexagrammos otakii*. The establishment of this technology will not only help reveal the molecular mechanisms of its sex differentiation and promote the development of artificial breeding and propagation techniques, but also provide strong technical support for the protection of its wild resources and the sustainable development of the aquaculture industry. Summary of the Invention

[0005] The purpose of this invention is to provide an application of a DNA fragment and primers specifically missing from male Hexagrammos oysterfish in genetic sex identification, which can identify the genetic sex of Hexagrammos oysterfish at the molecular level.

[0006] A missing DNA fragment of a male rockfish, the DNA fragment having the nucleotide sequence shown in SEQ ID NO:1.

[0007] The specific nucleotide sequence shown in SEQ ID NO:1 is 99 bp in length:

[0008] TCATGTGGGAGTTTGTCCTTATCCAATGCGAGGGTCCAAGGACAGAG GATGTTGTATGCTGTAAGGGTTGTTGAGCACTCTGAGGCAAATTTGTGATAT

[0009] A pair of specific marker primers for identifying the genetic sex of *Hexagrammos ogakii*, the primer sequences of which are as follows: PSTEL-Forward: 5'TAACTTACCAGCCTGGATGTG 3' (SEQ ID NO.4),

[0010] PSTEL-Reverse:5'GCATCAAGGACCGCAGTAAAT 3'(SEQ ID NO.5);

[0011] The present invention also provides the application of the missing DNA fragment in the male Hexagrammos oysterfish in identifying the genetic sex of the Hexagrammos oysterfish.

[0012] This invention also provides the application of the primers in identifying the genetic sex of *Hexagrammos ogakii*. The application involves using the primers to amplify two bands in male individuals via PCR, namely the fragments SEQ ID NO:2 and SEQ ID NO:3, with lengths of 263 bp and 362 bp, respectively; and to amplify one band in female individuals, namely the fragment SEQ ID NO:3. This is used to identify the genetic sex of *Hexagrammos ogakii*.

[0013] Furthermore, the PCR amplification system is 50 μL: 1 μL each of upstream and downstream primers (10 μmol / L), 25 μL of Rapid enzyme, 1 μL of DNA template (300-500 ng / μL), and 22 μL of ultrapure water.

[0014] The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min; and storage at 12℃.

[0015] The specific nucleotide sequence shown in SEQ ID NO:2 is 263 bp in length:

[0016] TAACTTACCAGCCTGGATGTGAAGGTCTGGTCCTTACTGCGAAGCGACGGGGACACACTGTCCAGATCGGAAAAAAAAGAAGAAAATATCAAAGGAGCAGAGCGTTACTGATTATTCAGAAACTGTAAAGTA CTCTAATTGCTACATTTCAAAATGTAATCCTGCTTTGCTGATAGTAAGTGGGCTATACAAATAAAATTGAGTGAATGTGTACAAGTTACCAAAAATCTTTCACTGTTCAGACCGTTTAGGGGTAATTCAGG;

[0017] The specific nucleotide sequence shown in SEQ ID NO:3 is 362 bp in length:

[0018] TAACTTACCAGCCTGGATGTGAAGGTCCGGTCCTTACTGCGAAGCGACGGGGACACACTGTCCAGATCGGAAAAAAGAAGAAAATATCAAAGGAGCAGAGCGTTACTGATTATTCAGAAACTGTAAAGTACTCTAATTCCTACATTTCAAAATGTAATCCTGCTTTGCTGATAGTAAGT CATGTGGGAGTTTGTCCTTATCCAATGCGAGGGTCCAAGGACAGAGGATGTTGTATGCTGTAAGGGTTGTTGAGCACTCTGAGGCAAATTTGTGATATTGGGCTATACAAATAAAATTGAGTGAATGTGTACAAGTTACCAAAAATCTTTCACTGTTCAGACCGTTTAGGGGTAATTCAGG.

[0019] The beneficial effects of this invention compared to the prior art are as follows:

[0020] The sex-specific molecular marker primers provided in this study can accurately and efficiently identify the genetic sex of *Hexagrammos otakii*. The identification method is simple to operate, low in cost, and suitable for large-scale testing in breeding work. Since only fins need to be collected, the testing process causes minimal harm to the fish, which is beneficial for the protection of germplasm resources. At the same time, it helps to advance research on the sex differentiation mechanism of *Hexagrammos otakii*, screen for sex-reversed individuals, and conduct sex-controlled breeding. Attached Figure Description

[0021] Figure 1 Electrophoretic images of males and females for genetic sex identification of the Ōtaki Hexagrammos;

[0022] Figure 2 This is a nucleotide sequence alignment diagram of SEQ ID NO:2 and SEQ ID NO:3, where SEQ ID NO:1 is the unique missing part in SEQ ID NO:2;

[0023] Figure 3 The images show histological sections of the gonads of a partial sample of *Hexagrammos ogacara*, with A being an oocyte, B being an oogonia, and C being a spermatogonium. Detailed Implementation

[0024] To better understand the content of this invention, please refer to the accompanying drawings. Figure 1-3The technical content of this invention will be further explained with specific implementation examples. All materials and reagents used are commercially available. The described implementation examples are only a part of this invention and not all embodiments. The scope of protection of this invention is not limited in any way, and all other embodiments obtained without inventive effort are within the scope of protection of this invention.

[0025] Example 1

[0026] First, a sex-determining region (SDR) of approximately 3.11 Mb was precisely located on chromosome 9 of *Hexagrammos oxtaki*, with a physical location ranging from 4.95 to 8.06 Mb. Subsequently, by comparing the sequencing depth of this SDR region in males and females, a 99 bp male-specific deletion fragment was discovered, the sequence of which is shown in SEQ ID NO.1. The sequencing depth of this fragment in males was significantly lower than that in females, approximately 50% of that in females, indicating that this region is a male-specific deletion region. Based on this male-specific deletion fragment, specific molecular marker primers were designed and screened, specifically: PSTEL-Forward: 5'TAACTTACCAGCCTGGATGTG 3' (SEQ ID NO.4), PSTEL-Reverse: 5'GCATCAAGGACGCAGTAAAT 3' (SEQ ID NO.5). To verify the accuracy of the sex-specific molecular marker primers of this invention, they were validated in *Hexagrammos oxtaki*.

[0027] Sample collection of Hexagrammos otakii: 24 sexually mature individuals of Hexagrammos otakii were selected from the fish farm.

[0028] Histological determination of gonads: Twenty-four large-scaled rockfish were dissected, and their gonads were fixed overnight in 4% paraformaldehyde. After fixation, they were dehydrated with graded ethanol, embedded in paraffin, and cut into 4µm sections. After staining with eosin / hematoxylin, they were observed under a microscope to distinguish sex: 12 females and 12 males. Figure 3 As shown.

[0029] DNA extraction: Fish fins were collected from each sample, and DNA samples were prepared using a DNA extraction kit. The extracted DNA was then tested for quality using a nucleic acid quantification instrument.

[0030] 1 μL each of forward and reverse primers (10 μmol / L), 25 μL of Rapid enzyme, 1 μL of DNA template (300-500 ng / μL), and 22 μL of ultrapure water. The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min; and storage at 12℃.

[0031] Amplification result detection: PCR products were detected by 1% agarose gel electrophoresis to analyze their specificity. Electrophoresis results are as follows: Figure 1 and Figure 2 As shown. Figure 1 The male individuals were amplified as a combination of the SEQ ID NO:2 and SEQ ID NO:3 fragments, with lengths of 362bp and 263bp, respectively; the female individuals were amplified as the SEQ ID NO:3 fragment, with a length of 362bp.

[0032] This case study verifies that the PCR electrophoresis results of sex-specific molecular marker amplification in *Hexagrammos ogacara* are consistent with the results of gonadal histology, proving that this specific molecular marker can accurately identify the genetic sex of *Hexagrammos ogacara*. This identification method is simple to operate, has a clear procedure, and provides intuitive and accurate results.

[0033] The above description is merely a preferred embodiment of the present invention and does not limit the invention. Equivalent substitutions and modifications based on the content of the present invention are all within the scope of protection of the present invention.

Claims

1. The application of a missing DNA fragment in male *Hexagrammos ogakii* in identifying the genetic sex of *Hexagrammos ogakii*, characterized in that... The nucleotide sequence of the DNA fragment is shown in SEQ ID NO:

1.

2. The application of a pair of specific marker primers in identifying the genetic sex of the Ōtaki Hexagrammos, characterized in that, The application involves using the specific marker primers to perform PCR amplification on the DNA of the *Hexagrammos otakii* sample to be tested. Male individuals showed two bands, with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3, respectively, and lengths of 263 bp and 362 bp. Female individuals showed one band, with the nucleotide sequence as shown in SEQ ID NO:

3. The specific marker primers were designed based on the DNA fragment with the nucleotide sequence shown in SEQ ID NO:

1.

3. The application according to claim 1, characterized in that, The PCR amplification system consists of 50 μL: 1 μL each of 10 μmol / L upstream and downstream primers, 25 μL of Rapid enzyme, 1 μL of 300-500 ng / μL DNA template, and 22 μL of ultrapure water. The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min; and storage at 12℃.

Images