SPP1-targeting RNAi agent, lipid nanoparticle containing same and medical application of SPP1-targeting RNAi agent

Abstract

The invention relates to an SPP1 targeting RNAi agent, lipid nanoparticles containing the SPP1 targeting RNAi agent and medical application of the SPP1 targeting RNAi agent. In particular, the present invention relates to the use of RNAi agents targeting SPP1, IFN-gamma mRNA and lipid nanoparticles comprising the same in the treatment of cancer.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of cancer treatment, in particular lung cancer treatment. In particular, the present application relates to the use of RNAi agents targeting SPP1 and lipid nanoparticles comprising the same in the treatment of lung cancer. BACKGROUND

[0002] Lung cancer is one of the most common cancers worldwide and the leading cause of cancer-related deaths [1, 2]. Traditional treatment methods such as surgery, chemotherapy and radiotherapy have made great progress, but due to late diagnosis and the presence of extensive metastasis, many lung cancer patients still have poor prognosis [3]. The emergence of immune checkpoint inhibitors (ICIs) has changed the treatment prospects of lung cancer [4, 5]. Clinical trials have shown that immune checkpoint inhibitors, whether administered alone or in combination, can effectively improve the survival of patients with locally advanced or metastatic non-small cell lung cancer [6]. Studies have shown that when immunotherapy is applied as a new adjuvant therapy, 14%-45% of non-small cell lung cancer patients can achieve major pathological response [5]. Nevertheless, there are still some lung cancer patients who cannot benefit from immunotherapy. Large-scale phase III trials have shown that the overall response rate of immunotherapy combined with chemotherapy is only 47%-63% [1, 8]. Therefore, it is urgent to find strategies to improve the effectiveness of immunotherapy in clinical practice.

[0003] The tumor immune microenvironment plays a crucial role in influencing the immune response of ICIs [9]. As an important component of the immune microenvironment, tumor-associated macrophages (TAMs) have high plasticity and can develop various phenotypes under the slight changes of the microenvironment

[10] . According to the traditional polarization, M1 type macrophages have anti-tumor activity triggered by cytokines such as interferon-γ, while M2 type macrophages tend to have an immunologically silent phenotype [11, 12].

[0004] Osteopontin, also known as secreted phosphoprotein-1 (SPP1), is a multifunctional protein expressed in various cell types and involved in intercellular communication [13-15]. In recent years, studies have shown that SPP1-positive TAM (SPP1+TAM) is a key factor in determining the efficacy of immunotherapy [16-18]. SPP1+TAM, which is biased towards the M2 phenotype, exhibits pro-tumor properties and is associated with poor prognosis in tumor treatment

[19] . Mechanistically, SPP1+TAM interacts with tumor-associated fibroblasts to form an immunological barrier in the tumor region, preventing the infiltration of immune cells

[16] . In addition, SPP1+TAM hinders the proliferation of CD8+ T cells and accelerates their exhaustion through the SPP1 / CD44 axis, thereby hindering the efficacy of ICI

[20] . Blocking SPP1 or conditionally knocking out SPP1+TAM has been shown to restore the efficacy of ICI, indicating that SPP1+TAM can serve as a therapeutic target for reactivating anti-tumor immune responses [16, 19].

[0005] Lipid nanoparticle (LNP)-mediated nucleic acid delivery has been shown to be effective in various treatments, such as mRNA efficient delivery, RNA interference, and gene editing for rare diseases

[21] . Due to the good biosafety and suitability for large-scale production of LNP, the U.S. Food and Drug Administration (FDA) has approved several LNP for therapeutic use

[22] . Currently, the siRNA-based drug Partisiran has been clinically approved, and the COVID-19 vaccine is a large-scale application of LNP loaded with mRNA

[23] . Although there have been increasing studies on RNA delivery in recent years, reports on the combined delivery of RNAi and mRNA are still limited. Due to the abundant blood supply and strong metabolic function of the liver, LNP is prone to accumulate in liver tissue when administered intravenously, limiting its therapeutic potential in organs other than the liver.

[0006] The emergence of selective organ targeting (SORT) LNP (SORT-LNP) has facilitated organ-specific delivery [24, 25]. By adjusting the molar percentage of 1,2-disulfonato-3-trimethylpropane (DOTAP), SORT-LNP achieves a wide range of applications in multi-organ targeting. SUMMARY

[0007] To solve the technical problems existing in cancer treatment, the present inventors provide a SORT-LNP co-delivery system loaded with RNAi and mRNA, and demonstrate its specificity and biosafety in targeting the lung.

[0008] Since SPP1+TAMs usually present M2 phenotype, which is characterized by high expression of mannose receptor (MRC1, CD206), SORT-LNP can be aggregated near SPP1+TAMs by mannose modification through the interaction of mannose with mannose receptor. The siSPP1 and IFN-γ mRNA loaded in SORT-LNP synergistically reverse the pro-tumor characteristics of TAMs and reprogram them to an anti-tumor phenotype, laying a foundation for ICI combination therapy. The present application not only explores the effective co-delivery of RNAi and mRNA, but also proposes an effective strategy to reshape SPP1+TAMs in lung cancer, providing a new direction for synergistic immunotherapy.

[0009] In a first aspect, the present application provides a lipid nanoparticle comprising:

[0010] a) a nucleic acid mixture comprising:

[0011] i) at least one RNAi agent targeting secreted phosphoprotein-1 (SPP1), and

[0012] ii) an IFN-γ mRNA; and

[0013] b) a lipid material comprising 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOTAP), and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol 2000-mannose (DMG-PEG2k-mannose);

[0014] wherein the nucleic acid mixture is encapsulated in the lipid material, and the lipid nanoparticle has an average particle size of less than 500 nm, preferably less than 400 nm, less than 350 nm, less than 300 nm, less than 250 nm, most preferably, less than 200 nm.

[0015] In specific embodiments, the molar ratio of the DOTAP in the lipid material is about 30% to about 40%, preferably about 40%.

[0016] In specific embodiments, the molar ratio of the DMG-PEG2k-mannose in the lipid material is about 1.2% to about 3.0%, preferably about 2.4%.

[0017] In specific embodiments, the lipid material further comprises distearoylphosphatidylcholine (DSPC), 4-(N,N-dimethylamino)butanoic acid (dilinoleyl) methyl ester (D-Lin-MC3-DMA), and cholesterol.

[0018] In specific embodiments, the molar ratio of the DSPC in the lipid material is about 1% to about 50%.

[0019] In particular embodiments, the D-Lin-MC3-DMA is present in the lipid material at a molar ratio of about 10% to about 50%.

[0020] In particular embodiments, the cholesterol is present in the lipid material at a molar ratio of about 5% to about 50%.

[0021] In particular embodiments, the lipid material comprises:

[0022] DSPC at a molar ratio of about 1% to about 50%,

[0023] DOTAP at a molar ratio of about 30% to about 40%, preferably about 40%,

[0024] D-Lin-MC3-DMA at a molar ratio of about 10% to about 50%,

[0025] cholesterol at a molar ratio of about 5% to about 50%, and

[0026] DMG-PEG2k-mannose at a molar ratio of about 1.2% to about 3.0%, preferably about 2.4%.

[0027] In particular embodiments, the lipid material comprises:

[0028] DSPC at a molar ratio of 5.90%,

[0029] DOTAP at a molar ratio of 40%,

[0030] D-Lin-MC3-DMA at a molar ratio of 29.4%,

[0031] cholesterol at a molar ratio of 22.3%, and

[0032] DMG-PEG2k-mannose at a molar ratio of 2.4%.

[0033] In particular embodiments, the RNAi agent targeting SPP1 comprises a sense strand and an antisense strand forming a double-stranded region, wherein:

[0034] the sense strand comprises at least 19 contiguous nucleotides of the nucleotide sequence set forth in SEQ ID NO: 1 and the antisense strand comprises at least 19 contiguous nucleotides of the nucleotide sequence set forth in SEQ ID NO: 2, and / or

[0035] the sense strand comprises at least 19 contiguous nucleotides of the nucleotide sequence set forth in SEQ ID NO: 3 and the antisense strand comprises at least 19 contiguous nucleotides of the nucleotide sequence set forth in SEQ ID NO: 4.

[0036] In particular embodiments, the RNAi agent targeting SPP1 comprises a sense strand and an antisense strand forming a double-stranded region, wherein:

[0037] the sense strand comprises nucleotides 1-19 of the 5' to 3' end of the nucleotide sequence set forth in SEQ ID NO: 1 and the antisense strand comprises nucleotides 1-19 of the 5' to 3' end of the nucleotide sequence set forth in SEQ ID NO: 2, and / or

[0038] the sense strand comprises nucleotides 1-19 of the 5' to 3' end of the nucleotide sequence set forth in SEQ ID NO: 3 and the antisense strand comprises nucleotides 1-19 of the 5' to 3' end of the nucleotide sequence set forth in SEQ ID NO: 4.

[0039] In particular embodiments, the IFN-g mRNA has the nucleotide sequence set forth in SEQ ID NO: 5.

[0040] In particular embodiments, the mass concentration ratio of the RNAi agent to the IFN-g mRNA is from 1 : 1 to 5: 1; for example, 1.1 : 1, 1.2: 1, 1.3: 1, 1.4: 1, 1.5: 1, 1.6: 1, 1.7: 1, 1.8: 1, 1.9: 1, 2: 1, 2.1 : 1, 2.2: 1, 2.3: 1, 2.4: 1, 2.5: 1, 2.6: 1, 2.7: 1, 2.8: 1, 2.9: 1, 3: 1, 3.1 : 1, 3.2: 1, 3.3: 1, 3.4: 1, 3.5: 1, 3.6: 1, 3.7: 1, 3.8: 1, 3.9: 1, 4.0: 1, 4.1 : 1, 4.2: 1, 4.3: 1, 4.4: 1, 4.5: 1, 4.6: 1, 4.7: 1, 4.8: 1, 4.9: 1, 5: 1; preferably about 2.6: 1.

[0041] In particular embodiments, the Zeta potential of the lipid nanoparticle is from about +1 to about +5 mV.

[0042] In a second aspect, the present application provides a nucleic acid mixture comprising:

[0043] i) at least one RNAi agent targeting secreted phosphoprotein 1 (SPP1), and

[0044] ii) an IFN-g mRNA.

[0045] In particular embodiments, the RNAi agent targeting SPP1 comprises a sense strand and an antisense strand forming a double-stranded region, wherein:

[0046] the sense strand comprises at least 19 contiguous nucleotides of the nucleotide sequence set forth in SEQ ID NO: 1 and the antisense strand comprises at least 19 contiguous nucleotides of the nucleotide sequence set forth in SEQ ID NO: 2, and / or

[0047] the sense strand comprises at least 19 contiguous nucleotides of the nucleotide sequence set forth in SEQ ID NO: 3 and the antisense strand comprises at least 19 contiguous nucleotides of the nucleotide sequence set forth in SEQ ID NO: 4.

[0048] In particular embodiments, the RNAi agent targeting SPP1 comprises a sense strand and an antisense strand forming a double-stranded region, wherein:

[0049] the sense strand comprises nucleotides 1-19 of the 5' to 3' end of the nucleotide sequence set forth in SEQ ID NO: 1 and the antisense strand comprises nucleotides 1-19 of the 5' to 3' end of the nucleotide sequence set forth in SEQ ID NO: 2, and / or

[0050] the sense strand comprises nucleotides 1-19 of the 5' to 3' end of the nucleotide sequence set forth in SEQ ID NO: 3 and the antisense strand comprises nucleotides 1-19 of the 5' to 3' end of the nucleotide sequence set forth in SEQ ID NO: 4.

[0051] In particular embodiments, the IFN-g mRNA has the nucleotide sequence set forth in SEQ ID NO: 5.

[0052] In particular embodiments, the mass concentration ratio of the RNAi agent to the IFN-g mRNA is 1 : 1 to 5: 1 ; for example, 1.1 : 1, 1.2: 1, 1.3: 1, 1.4: 1, 1.5: 1, 1.6: 1, 1.7: 1, 1.8: 1, 1.9: 1, 2: 1, 2.1 : 1, 2.2: 1, 2.3: 1, 2.4: 1, 2.5: 1, 2.6: 1, 2.7: 1, 2.8: 1, 2.9: 1, 3: 1, 3.1 : 1, 3.2: 1, 3.3: 1, 3.4: 1, 3.5: 1, 3.6: 1, 3.7: 1, 3.8: 1, 3.9: 1, 4.0: 1, 4.1 : 1, 4.2: 1, 4.3: 1, 4.4: 1, 4.5: 1, 4.6: 1, 4.7: 1, 4.8: 1, 4.9: 1, 5: 1 ; preferably about 2.6: 1.

[0053] In a third aspect, the present application provides an RNAi agent targeting SPP1 comprising a sense strand and an antisense strand forming a double-stranded region, wherein:

[0054] the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 2, and / or

[0055] the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 2, and / or

[0056] In a fourth aspect, the present application provides a delivery system for pulmonary targeted delivery of an RNAi agent and / or a nucleic acid mixture, the delivery system comprising: 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOTAP), and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol 2000-mannose (DMG-PEG2k-mannose).

[0057] In a specific embodiment, the DOTAP is present in the delivery system at a molar ratio of about 30% to about 40%, preferably about 40%.

[0058] In a specific embodiment, the DMG-PEG2k-mannose is present in the delivery system at a molar ratio of about 1.2% to about 3.0%, preferably about 2.4%.

[0059] In a specific embodiment, the delivery system further comprises distearoylphosphatidylcholine (DSPC), 4-(N,N-dimethylamino)butanoic acid (dilinoleyl) methyl ester (D-Lin-MC3-DMA), and cholesterol.

[0060] In a specific embodiment, the DSPC is present in the delivery system at a molar ratio of about 1% to about 50%.

[0061] In a specific embodiment, the D-Lin-MC3-DMA is present in the delivery system at a molar ratio of about 10% to about 50%.

[0062] In a specific embodiment, the cholesterol is present in the delivery system at a molar ratio of about 5% to about 50%.

[0063] In a specific embodiment, the delivery system comprises:

[0064] DSPC at a molar ratio of about 1% to about 50%,

[0065] DOTAP at a molar ratio of about 30% to about 40%, preferably about 40%,

[0066] D-Lin-MC3-DMA at a molar ratio of about 10% to about 50%,

[0067] cholesterol at a molar ratio of about 5% to about 50%, and

[0068] DMG-PEG2k-mannose at a molar ratio of about 1.2% to about 3.0%, preferably about 2.4%.

[0069] In a particular embodiment, the delivery system comprises:

[0070] DSPC at a molar ratio of 5.90%,

[0071] DOTAP at a molar ratio of 40%,

[0072] D-Lin-MC3-DMA at a molar ratio of 29.4%,

[0073] Cholesterol at a molar ratio of 22.3%, and

[0074] DMG-PEG2k-mannose at a molar ratio of 2.4%.

[0075] In a fifth aspect, the present application provides the use of a lipid nanoparticle, a nucleic acid mixture or an RNAi agent targeting SPP1 according to the present application for the manufacture of a medicament for the treatment of a cancer.

[0076] In a particular embodiment, the cancer is a lung cancer.

[0077] In a particular embodiment, the lung cancer comprises lung metastatic cancer and primary lung cancer.

[0078] In a sixth aspect, the present application provides the use of a lipid nanoparticle, a nucleic acid mixture or an RNAi agent targeting SPP1 according to the present application in combination with an immune checkpoint inhibitor for the manufacture of a medicament for the treatment of a cancer.

[0079] In a particular embodiment, the immune checkpoint inhibitor comprises, but is not limited to:

[0080] a PD-1 inhibitor, for example, Nivolumab, Pembrolizumab, Toripalimab, Sindilimab, Camrelizumab;

[0081] a PD-L1 inhibitor, for example, Atezolizumab, Durvalumab, Avelumab;

[0082] a CTLA-4 inhibitor, for example, Ipilimumab, Tremelimumab.

[0083] In a particular embodiment, the cancer is a lung cancer.

[0084] In a particular embodiment, the lung cancer comprises lung metastatic cancer and primary lung cancer.

[0085] In particular, lung metastatic cancers include, but are not limited to, breast cancer lung metastasis, colorectal cancer lung metastasis, renal cancer lung metastasis, melanoma lung metastasis, osteosarcoma lung metastasis, liver cancer lung metastasis, endometrial cancer lung metastasis, prostate cancer lung metastasis, ovarian cancer lung metastasis, pancreatic cancer lung metastasis, soft tissue sarcoma lung metastasis, gastric cancer lung metastasis, bladder cancer lung metastasis, esophageal cancer lung metastasis, thyroid cancer lung metastasis, nasopharyngeal cancer lung metastasis, testicular tumor lung metastasis, and cervical cancer lung metastasis.

[0086] In particular, primary lung cancers include, but are not limited to, non-small cell lung cancer, e.g., lung adenocarcinoma, squamous cell carcinoma, and large cell carcinoma; and small cell lung cancer.

[0087] In a seventh aspect, the present application provides a pharmaceutical combination comprising:

[0088] i) a lipid nanoparticle according to the present application, and

[0089] ii) one or more immune checkpoint inhibitors, in particular, the immune checkpoint inhibitors are selected from:

[0090] PD-1 inhibitors, PD-L1 inhibitors, and CTLA-4 inhibitors.

[0091] In particular embodiments, the lipid nanoparticle and the immune checkpoint inhibitor in the pharmaceutical combination according to the present application can be administered simultaneously, sequentially, or separately.

[0092] In an eighth aspect, the present application provides a method of treating cancer, preferably lung cancer, the method comprising:

[0093] administering to a subject in need thereof a therapeutically effective amount of a lipid nanoparticle, a nucleic acid mixture, an RNAi agent targeting SPP1, or a pharmaceutical combination according to the present application.

[0094] In particular embodiments, the lung cancer includes lung metastatic cancers and primary lung cancers.

[0095] In particular, lung metastatic cancers include, but are not limited to, breast cancer lung metastasis, colorectal cancer lung metastasis, renal cancer lung metastasis, melanoma lung metastasis, osteosarcoma lung metastasis, liver cancer lung metastasis, endometrial cancer lung metastasis, prostate cancer lung metastasis, ovarian cancer lung metastasis, pancreatic cancer lung metastasis, soft tissue sarcoma lung metastasis, gastric cancer lung metastasis, bladder cancer lung metastasis, esophageal cancer lung metastasis, thyroid cancer lung metastasis, nasopharyngeal cancer lung metastasis, testicular tumor lung metastasis, and cervical cancer lung metastasis.

[0096] In particular, primary lung cancers include, but are not limited to, non-small cell lung cancer, e.g., lung adenocarcinoma, squamous cell carcinoma, and large cell carcinoma; and small cell lung cancer.

[0097] The lipid nanoparticle, the nucleic acid mixture, the RNAi agent targeting SPP1, or the pharmaceutical combination according to the present application can be administered to a subject via a variety of administration modes, including but not limited to: intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, intratracheal administration, nasal inhalation, or other systemic or local administration modes suitable for delivering lipid nanoparticles or RNAi agents.

[0098] In specific embodiments, the lipid nanoparticle, the nucleic acid mixture, the RNAi agent targeting SPP1, or the pharmaceutical combination is administered via intravenous injection.

[0099] In specific embodiments, the lipid nanoparticle, the nucleic acid mixture, the RNAi agent targeting SPP1, or the pharmaceutical combination can be delivered locally, such as via nasal or intratracheal administration. BRIEF DESCRIPTION OF DRAWINGS

[0100] Figure 1 Morphology of luci@mLNP under transmission electron microscope (scale bar: left 200 nm, right 100 nm) (A) and cryo-electron microscope (scale bar: left 100 nm, right 50 nm) (B). Figure 1 Morphology of luci@mLNP under transmission electron microscope (scale bar: left 200 nm, right 100 nm) (A) and cryo-electron microscope (scale bar: left 100 nm, right 50 nm) (B). Figure 1

[0101] Figure 2 Size, polydispersity index (PDI) and Zeta potential of luci@mLNP with different molar ratios of DOTAP (30%, 40%, 50%, 60%) were detected by dynamic light scattering (DLS); wherein:

[0102] Figure 2 Size of luci@mLNP with different molar ratios of DOTAP (A).

[0103] Figure 2 PDI of luci@mLNP with different molar ratios of DOTAP (B).

[0104] Figure 2 Zeta potential of luci@mLNP with different molar ratios of DOTAP (C).

[0105] Figure 3 Cy5@mLNP has lysosome escape ability (scale bar: 20 μm).

[0106] Figure 4 Results of luci@mLNP with different molar ratios of DOTAP 6 h after intravenous injection in mice, wherein,​

[0107] Figure 4 Figure 2A shows the bioluminescence imaging of major organs at 6h post injection of different ratios of DOTAP;

[0108] Figure 4 Figure 2B shows the fluorescence intensity of lung at 6h post injection of different ratios of DOTAP (3 mice per group);

[0109] Figure 4 Figure 2C shows the percentage of lung fluorescence intensity in total major organs fluorescence intensity at 6h post injection of different ratios of DOTAP (3 mice per group);

[0110] Figure 4 Figure 2D shows the percentage of spleen fluorescence intensity in total major organs fluorescence intensity at 6h post injection of different ratios of DOTAP (3 mice per group).

[0111] Figure 5 Figure 3A shows the particle size of Cy5@mLNP with different ratios of mannose measured by DLS;

[0112] Figure 5 Figure 3B shows the PDI of Cy5@mLNP with different ratios of mannose measured by DLS;

[0113] Figure 5 Figure 3C shows the percentage of Cy5-positive macrophages in total macrophages with different ratios of mannose Cy5@mLNP (3 mice per group);

[0114] Figure 5 Figure 3D shows the representative graph of the percentage of Cy5-positive macrophages with different ratios of mannose Cy5@mLNP.

[0115] Figure 6 Figure 4A shows the cell viability of Raw264.7 after 24h incubation with different concentrations of siSPP1-mIFNy@mLNP;

[0116] Figure 6 Figure 4B shows the cell viability of BMDM after 24h incubation with different concentrations of siSPP1-mIFNy@mLNP.

[0117] Figure 7 Figure 5A shows the SPP1 level in the supernatant of BMDM in each group detected by ELISA (3 samples per group);

[0118] Figure 7 Figure 5B shows the representative image of SPP1 expression in each group detected by Western blot.

[0119] Figure 8 Figure 6 shows the IFN-γ level in the supernatant of BMDM in each group detected by ELISA (3 samples per group).

[0120] Figure 9 Figure 2A shows the percentage of Ml type (CD86+CD206-F4 / 80+CDl lb+) macrophages out of total macrophages in each treatment group.

[0121] Figure 9 Figure 2A shows the percentage of Ml type (CD86+CD206-F4 / 80+CDl lb+) macrophages out of total macrophages in each treatment group.

[0122] Figure 9 Figure 2B shows the percentage of M2 type (CD86-CD206+F4 / 80+CDl lb+) macrophages out of total macrophages in each treatment group.

[0123] Figure 10 Figure 3A shows flow cytometry representative plots of BMDMs incubated with OVA-FITC (20 pg / mL) for 1 h in different mLNP treatment groups.

[0124] Figure 10 Figure 3B shows the FITC fluorescence intensity of BMDMs co-incubated with OVA-FITC in different treatment groups (3 samples per group).

[0125] Figure 11 Figure 4 shows the quantification of tumor fluorescence intensity at different time points (compared to the initial tumor fluorescence intensity).

[0126] Figure 12 Figure 5A shows the gross tumor pictures of different treatment groups.

[0127] Figure 12 Figure 5B shows the H&E staining of tumor tissues.

[0128] Figure 13 Figure 6A shows the statistics of tumor fluorescence intensity at different time points in each treatment group (5 mice per group).

[0129] Figure 13 Figure 6B shows the pictures of lung tumors in mice of different treatment groups.

[0130] Figure 13 Figure 6C shows the H&E staining of 4T-1 metastatic tumors in the lungs of different treated mice. Scale bar: 1 mm (left); 250 pm (right).

[0131] Figure 13 Figure 6D shows the concentration of SPP1 in the interstitial fluid of tumors, expressed in pg / mg protein (calculated by SPP1 [pg / mL] detected by ELISA divided by total protein [mg / mL] detected by BCA) (4 samples per group). DETAILED DESCRIPTION

[0132] TERMINOLOGY

[0133] The terms used herein have the meanings commonly understood by those of ordinary skill in the art, unless otherwise specified.

[0134] As used herein, "RNAi agent" refers to an agent that can elicit RNA interference (RNAi) effects, primarily for inhibiting the expression of a target gene. These agents are typically RNA molecules that are either artificially designed or of natural origin.

[0135] The RNAi agent herein targets and degrades secreted phosphoprotein-1 (SPP1), thereby silencing gene expression.

[0136] The RNAi agent used herein can be siRNA (small interfering RNA) or shRNA (small hairpin RNA).

[0137] As used herein, the term "siRNA or small interfering RNA" is a double-stranded RNA of about 21-23 nt that can be synthetic or cleaved from long dsRNA, which directly guides RISC to cleave the target mRNA.

[0138] As used herein, the term "shRNA or small hairpin RNA" is expressed in a cell, typically encoded by a vector, forms a hairpin structure after transcription in a cell, and is then processed into siRNA.

[0139] As used herein, the term "about" generally indicates a range of values that are close to the stated value within an acceptable error for the person skilled in the art. If not specifically defined, it is generally a range of ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, or even ±1%. A range of ±10% is preferred herein.

[0140] As used herein, the term "pulmonary metastatic cancer" refers to a secondary tumor formed by metastasis of primary tumor cells to the lung through the blood or lymphatic route.

[0141] Specifically, the pulmonary metastatic cancer includes, but is not limited to, breast cancer lung metastasis, colorectal cancer lung metastasis, kidney cancer lung metastasis, melanoma lung metastasis, osteosarcoma lung metastasis, liver cancer lung metastasis, endometrial cancer lung metastasis, prostate cancer lung metastasis, ovarian cancer lung metastasis, pancreatic cancer lung metastasis, soft tissue sarcoma lung metastasis, gastric cancer lung metastasis, bladder cancer lung metastasis, esophageal cancer lung metastasis, thyroid cancer lung metastasis, nasopharyngeal cancer lung metastasis, testicular tumor lung metastasis, and cervical cancer lung metastasis.

[0142] As used herein, the term "primary lung cancer" refers to a malignant tumor originating from the lung tissue itself, including cancers of bronchial, alveolar epithelial, or glandular epithelial within the lung parenchyma, etc. It is different from lung metastatic cancer, which is metastasized to the lung from other parts of the body.

[0143] Specifically, the primary lung cancer includes, but is not limited to, non-small cell lung cancer, for example, lung adenocarcinoma, squamous cell carcinoma, and large cell carcinoma; and small cell lung cancer.

[0144] As used herein, the term "simultaneous administration" refers to co-administration of a lipid nanoparticle and an immune checkpoint inhibitor to the same subject at the same time point or within a short time period, either by combination in the same formulation, or by separate formulations but within the same dosing window.

[0145] As used herein, the term "sequential administration" refers to administration of a lipid nanoparticle and an immune checkpoint inhibitor in a specific time order, the first drug in front, the second drug behind, the interval between the two can be hours, days, or even longer, depending on the treatment regimen.

[0146] As used herein, the term "separate administration" refers to administration of two drugs through different routes, different formulations or different treatment cycles, the administration of the two can be completely independent, but still within the same treatment regimen.

[0147] The present disclosure is further described in conjunction with the following examples, which do not limit the scope of the disclosure. Unless otherwise specified, the experimental methods in the embodiments of the present disclosure are generally carried out according to conventional conditions; or according to the conditions recommended by the manufacturer of the raw materials or commodities. Unless otherwise specified, the reagents used in the following examples are commercially available.

[0148] Example 1. Synthesis of siSPP1 and IFN-γ mRNA-encapsulated lipid nanoparticles

[0149] 1) Raw materials

[0150] (1) Ethanol phase: Distearoylphosphatidylcholine (DSPC), 1,2-dioleoyl-sn-glycero-3- phosphocholine (DOTAP), 4-(N,N-dimethylamino)butyric acid (dilinoleyl) methyl ester (D-Lin-MC3-DMA), Cholesterol, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine- polyethylene glycol 2000-mannose (DMG-PEG2k-mannose).

[0151] (2) Aqueous phase:

[0152] siRNA: siSPP1#1 and siSPP1#2 were used respectively; wherein the sequence of the siRNA from 5' to 3' end is shown in Table 1 below:

[0153] Table 1

[0154]

[0155] IFN-γ mRNA (5'-3'):

[0156] AUGAACGCCACCCACUGCAUCCUCGCCCUGCAGCUGUUCCUGAUGGCCGUGAGCGGCUGCUACUGCCACGGCACCGUGAUCGAGAGCCUGGAGAGCC UGAACAACUACUUCAACAGCAGCGGCAUCGACGUGGAGGAGAAGUCCCUGUUCCUGGACAUCUGGAGGAACUGGCAGAAGGACGGCGACAUGAAGAUCCUGCAGAGCCAGAUCAUCAGCUUCUACCUGAGACUGUUCGAGGUGCUGAAGGACAACCAGGCCAUCAGCAACAACAUCAGCGUGAUCGAGAGCCACCUGAUCACCACCUUCUUCAGCAACAGCAAGGCCAAGAAGGACGCCUUCAUGAGCAUCGCCAAGUUCGAGGUGAACAACCCCCAGGUGCAGAGACAGGCCUUCAACGAGCUGAUCAGAGUGGUGCACCAGCUGCUGCCCGAGAGCAGCCUGAGAAAGAGGAAGAGAAGCAGAUGCUGAUAA (SEQ ID NO: 5)

[0157] 2) Synthesis ratio

[0158] Lipid nanoparticles containing DOTAP and DMG-PEG2k-Mannose with different molar mass ratios were synthesized to perform a molarity exploration.

[0159] Table 2

[0160]

[0161] 3) Synthesis method

[0162] Synthesis of siSPP1-mIFNγ@mLNP:A 10 mM citric acid buffer solution with pH = 4 was prepared in a sterile and enzyme-free environment as a protective agent for mRNA and RNAi, and siRNA and mRNA were dissolved therein with a total concentration of 0.05 mg / mL as an aqueous phase. The mass concentration ratio of siRNA to mRNA was about 2.6:1, for example, 1 mL of the aqueous phase solution contained 0.05 mg of RNA, and the total concentration of siSPP1#1 and siSPP1#2 was 36 μg / mL, and the concentration of IFN-γ mRNA was 14 μg / mL.

[0163] The above table DLin-MC3-DMA, cholesterol, DSPC, DMG-PEG2k-Mannose, DOTAP were dissolved in anhydrous ethanol according to the proportions in the table as an ethanol phase.

[0164] The water phase and the ethanol phase were mixed at a volume ratio of 3:1 by a syringe pump, and the total flow rate was set to 4 mL / min. The liposomes were obtained by mixing, and were centrifuged at 6000 rpm for 15 min by a 1.5 kD ultrafiltration tube, and were supplemented with PBS, and the above steps were repeated for 3 times, and finally siSPP1-mIFNγ@LNP was obtained.

[0165] Synthesis of luci@mLNP: The above was prepared, and the concentration of firefly luciferase mRNA (3-O-Me-GAG, N1-Me-Pseudo UTP) (Yisen Biotech, Shanghai, China (17101ES60)) in the aqueous phase was 0.025 mg / mL, and the other synthesis conditions were the same.

[0166] Synthesis of Cy5@mLNP: The above was prepared, and the concentration of Cy5-labeled siNC in the aqueous phase was 0.025 mg / mL, and the other synthesis conditions were the same.

[0167] The siNC used herein is siRNA from Genmab, and has the following double-stranded structure:

[0168] 5'-3' sense strand: CUAGUCCUAGACCCUAAGATT (SEQ ID NO: 6);

[0169] Antisense strand: UCUUAGGGUCUAGGACUAGCU (SEQ ID NO: 7).

[0170] Example 2. Physicochemical properties of lipid nanoparticles

[0171] 1) Encapsulation efficiency detection

[0172] The encapsulation efficiency of luci@mLNP was determined by RiboGreen kit (Thermo R11490), encapsulation efficiency (%) = (total RNA - free RNA) / total RNA x 100%. The final calculation of the encapsulation efficiency of LNP was more than 97%, effectively protecting the nucleic acid from degradation in the body circulation.

[0173] 2). Physicochemical property detection

[0174] The morphology of luci@mLNP was taken by transmission electron microscopy and cryo-electron microscopy, double-layer membrane, oval shape, results see Figure 1 .

[0175] The results of particle size (Size), polydispersity index (Polydispersity index, PDI), Zeta potential (Zeta potential) of luci@mLNP under different DOTAP molar mass ratios (30%, 40%, 50%, 60%) are shown in Figure 2 .

[0176] 3). Lysosomal escape ability: One of the main bottlenecks of LNP delivery is that RNA-LNP cannot be effectively released from the endosomal pathway to the cytoplasm. Previous studies have shown that most RNA-LNP internalized by target cells are degraded by lysosomes, and only a small amount of RNA is effectively released to the cytoplasm to be encoded. In order to test the lysosomal escape ability of mLNP, Cy5@mLNP was co-incubated with bone marrow-derived macrophages (BMDM) for different times (0 min, 40 min, 1 h, 2 h), and its intracellular distribution was monitored by confocal microscopy. The co-localization of green lysosomes and red Cy5@mLNP peaked at 1 h and decreased at 2 h (results see Figure 3 ), indicating that mLNP has a time-dependent lysosomal escape ability.

[0177] 4). mLNP containing 40% DOTAP has the optimal lung targeting property

[0178] luci@mLNP containing 30%, 40%, 50%, 60% DOTAP was injected into the tail vein of healthy C57BL / 6J female mice, respectively, with a dose of 0.05 mg / kg. 6 h after injection, D-luciferin potassium salt (20 mg / mL, 50 μL / mouse) was injected intraperitoneally, and 5-10 minutes later, the mice were euthanized and their hearts, livers, spleens, lungs, and kidneys were taken for bioluminescence imaging. The proportion of lung fluorescence intensity in the total intensity of organs was calculated. The results showed that when the proportion of DOTAP was 40%, the specific targeting of mLNP to the lung was the strongest (results see Figure 4). Although 30% DOTAP mLNP also has a certain targeting to the lung, it also has similar targeting to the spleen, so 40% DOTAP is selected as the best lung-targeted delivery ratio.

[0179] Example 3. mLNP containing 2.4% molar ratio of mannose has the best macrophage targeting property

[0180] Cy5@mLNP containing different molar ratios of mannose (1.2%, 2.4%, 3.0%) and 40% DOTAP were injected into the tail vein of healthy C57BL / 6J female mice, and the mice were euthanized 6h after injection. The lungs were taken for flow cytometry analysis of the proportion of Cy5-positive macrophages in macrophages (Cy5 excitation light 650nm, emission light 670nm). The flow cytometry results show that the mLNP containing 2.4% molar ratio of mannose has the best targeting to macrophages (results see Figure 5 ). Therefore, 2.4% mannose and 40% DOTAP mLNP are selected as the final formulation ratio.

[0181] The liposome composition used in the following test examples is shown in Table 3 below:

[0182] Table 3

[0183]

[0184] Synthetic siSPP1-mIFNγ@mLNP loaded with different RNA concentrations, mass concentration ratio siSPP1:IFNγ mRNA ≈ 2.6:1.

[0185] Test Example 1. Safety verification of siSPP1-mIFNγ@mLNP

[0186] 1). In vitro safety verification

[0187] Synthetic siSPP1-mIFNγ@mLNP loaded with different RNA concentrations, mass concentration ratio siSPP1:IFNγ mRNA ≈ 2.6:1. Incubate different RNA concentrations of siSPP1-mIFNγ@mLNP with Raw264.7 cells and BMDM for 24h, and detect cell activity with CCK-8 reagent. The results show that Figure 6 ), that is, the use concentration reaches 8 times the normal use concentration, and the cell activity is maintained at more than 90%, indicating that siSPP1-mIFNγ@mLNP has high in vitro safety.

[0188] 2). In vivo safety verification

[0189] PBS, mLNP, siSPP1@mLNP, mIFNγ@mLNP, siSPP1-mIFNγ@mLNP were injected into the tail vein of healthy C57BL / 6J mice respectively, with the dosage of siSPP1 1.25 mg / kg, IFN-γ mRNA 0.5 mg / kg, and a total of 3 times of administration. The body weight of mice was detected continuously, and the body weight was measured every 2 days after the first administration. The mice were euthanized after 14 days, and their whole blood and serum were taken for blood physiology and blood biochemistry detection, and the main organs of heart, liver, spleen, lung and kidney were taken for H&E staining. After detection, it was found that the blood routine and blood biochemistry of mice in different administration groups were within the normal range, the body weight growth rate was normal and there was no obvious difference between groups, and H&E staining showed that there was no obvious pathological change in the main organs (results not shown). The above results showed that siSPP1-mIFNγ@mLNP had good biological safety.

[0190] Test Example 2. siSPP1-mIFNγ@mLNP reverses the polarization state of M2 macrophages in vitro

[0191] The test example first verifies the effect of siSPP1-mIFNγ@mLNPs on the secretion of SPP1 and IFN-γ. ELISA and Western Blot (WB) were used to detect the secretion of SPP1 in the supernatant of BMDM treated with siSPP1-mIFNγ@mLNPs. The results showed that after siSPP1-mIFNγ@mLNPs treatment, SPP1 secretion was significantly reduced (results see Figure 7 ), and IFN-γ secretion was significantly increased (results see Figure 8 ). These results confirmed that siSPP1-mIFNγ@mLNP successfully achieved SPP1 inhibition and IFN-γ mRNA translation in cells.

[0192] M2 type macrophages have pro-tumor effect, while M1-like macrophages have anti-tumor characteristics. Studies have shown that IFN-γ plays a crucial role in guiding the transformation of macrophages to M1 phenotype. In order to explore the effect of siSPP1-mIFNγ@mLNP on macrophage polarization, we first converted BMDM from M0 type to M2 type using IL-4. Subsequently, mLNPs, siSPP1@mLNPs, mIFNγ@mLNPs and siSPP1-mIFNγ@mLNPs were used to treat M2-like macrophages respectively. Flow cytometry detection found that after siSPP1-mIFNγ@mLNP treatment, the proportion of M1 type macrophages increased significantly (5.48 times higher than the PBS group), and the proportion of M2 type macrophages decreased significantly (23.01 times lower than the PBS group) (see Figure 9 ), indicating that it has good macrophage reprogramming ability.

[0193] Macrophages, as professional phagocytes, have the function of detecting, phagocytizing, eliminating harmful microorganisms, apoptotic cells and metabolic byproducts. To evaluate the phagocytic capacity of macrophages under different LNP treatments, we pre-treated BMDM with mLNPs, siSPP1@mLNPs, mIFNy@mLNPs or siSPP1-mIFNy@mLNPs for 48 h, and then added FITC-labeled ovalbumin (OVA-FITC, 20 pg / mL). The siSPP1-mIFNy@mLNP group had the highest FITC mean fluorescence intensity, indicating enhanced phagocytic capacity of macrophages (see Figure 10 ). This finding confirmed the enhancement of macrophage activity, which is necessary to initiate an adaptive immune response.

[0194] Test Example 3. siSPP1-mIFNγ@mLNP combined immunotherapy has an inhibitory effect on orthotopic lung cancer

[0195] In this test example, we investigated the therapeutic effect of siSPP1-mIFNy@mLNP when used in combination with a PD-1 antibody. The PD-1 antibody used was anti-mouse PD-1 (CD279) (Cat: BE0146, BioXcell InVivoMAb).

[0196] After establishing the orthotopic lung cancer model with LLC-OVA-Luc cells, the mice were randomly divided into 4 groups (5 mice per group) on the 7th day after inoculation and tumor formation. The mice in each group were injected with PBS (100 pL, intraperitoneal injection), siSPP1-mIFNy@mLNP (100 pL, tail vein injection), a-PD-1 (100 pL, intraperitoneal injection), or siSPP1-mIFNy@mLNP + a-PD-1 combination injection. Tumor growth was monitored every 5 days using bioluminescence imaging (BLI).

[0197] As shown in Figure 11 , the combination treatment of siSPP1-mIFNy@mLNP + a-PD-1 had the most significant inhibition of tumors, indicating that siSPP1-mIFNy@mLNP had a synergistic anti-tumor effect with a-PD-1.

[0198] To demonstrate the effectiveness of siSPP1 in reducing SPP1 secretion in tumor tissues, we measured the concentration of SPP1 in the interstitial fluid of each group of tumor tissues. The results showed that in the siSPP1-mIFNy@mLNP and siSPP1-mIFNy@mLNP + a-PD-1 groups, the concentration of SPP1 was significantly reduced, confirming the knockdown efficiency of siSPP1 in siSPP1-mIFNy@mLNP.

[0199] To evaluate the immune responses of different treatment regimens in vivo, we performed flow cytometry analysis on tumor tissues of LLC-OVA-Luc tumor-bearing mice. The proportion of M2 subpopulation macrophages (CD45+CD11b+F4 / 80+CD206+) decreased in the siSPP1-mIFNγ@mLNP, α-PD-1, and siSPP1-mIFNγ@mLNP+α-PD-1 groups compared to the control group, indicating that M2-like macrophages were inhibited. In contrast, the proportion of M1-like macrophages (defined as the CD45+CD11b+F4 / 80+CD86+ subpopulation) significantly increased (2.52-fold higher than the control group) in the siSPP1-mIFNγ@mLNP+α-PD-1 group.

[0200] Considering the importance of cytotoxic T lymphocyte (CTL) responses and tumor antigen-specific immunity in eliminating tumors, we further explored the proportion of CTLs and OVA-specific CD8+ T cells in different treatment groups. siSPP1-mIFNγ@mLNP+α-PD-1 treatment significantly activated the cytotoxic function of T cells, with upregulation of the proportions of IFN-γ+CD8+ T cells and TNF-α+CD8+ T cells. The percentage of tumor-specific OVA+CD8+ T cells in the siSPP1-mIFNγ@mLNP+α-PD-1 group was 9-fold higher than that in the control group, indicating that it strongly induced tumor antigen-specific immunity. The above findings suggest that the combination therapy has the ability to inhibit tumor growth and improve the immunosuppressive tumor microenvironment.

[0201] Test Example 4. siSPP1-mIFNγ@mLNP and α-PD-1 enhance T cell activation and immune memory induction

[0202] Improving the efficacy of immunotherapy depends on elucidating the responses within the tumor immune microenvironment. To evaluate the therapeutic effects of different cell-derived lung cancer models, we established a TC-1 lung cancer model in C57BL / 6J mice (5 mice per group) and performed grouping treatment. After reaching the experimental endpoint (40 days after tumor inoculation), the mice were euthanized and tumor tissues were collected. The siSPP1-mIFNγ@mLNP+α-PD-1 group had the least tumor in the lung ( Figure 12 A) H&E staining showed a large area of darkly stained tumor in the control group, while the siSPP1-mIFNγ@mLNP+α-PD-1 group had the smallest tumor focus ( Figure 12 B).

[0203] To further evaluate the impact of siSPP1-mIFNγ@mLNP+α-PD-1 on the TC-1 tumor immune microenvironment, we performed RNA transcriptome sequencing on tumor tissue samples collected on day 40. ImmuCellAI_mouse analysis of immune cell composition showed that, compared to the control group, the siSPP1-mIFNγ@mLNP+α-PD-1 treatment group had significantly enriched T cells and macrophages, indicating that synergistic therapy enhanced the anti-tumor immune status. Flow cytometry analysis of tumor tissue samples revealed that the combination therapy increased the infiltration of CD8+ T cells within the tumor (1.75-fold higher than the control group) and promoted their conversion to the effector memory CD8+ T phenotype (3.24-fold higher than the control group). In the siSPP1-mIFNγ@mLNP+α-PD-1 group, the proportion of effector memory CD4+ T cells (twice that of the control group) and the proportion of M1-like macrophages (three times that of the control group) also increased. The above results indicate that siSPP1-mIFNγ@mLNP+α-PD-1 treatment can induce a significant immune memory response.

[0204] Test Example 5. siSPP1-mIFNγ@mLNP + α-PD-1 synergistic therapy has an inhibitory effect on lung metastasis

[0205] Tumor metastasis accounts for 50%–90% of cancer-related deaths in patients with solid tumors, primarily because current treatments are ineffective against disseminated cancer cells. The lungs, with their rich vascular network and extracellular matrix, are a common site of metastasis for many extrathoracic malignancies. Lung metastases typically occur within 5 years of initial breast cancer diagnosis, significantly impacting the clinical prognosis of breast cancer patients. Therefore, exploring therapeutic targets for lung metastases is crucial for improving patient outcomes.

[0206] To evaluate the immunoprophylactic effect of siSPP1-mIFNγ@mLNP+α-PD-1 combination on lung metastasis, we established a breast cancer lung metastasis model by tail vein injection of 4T1-Luc cells. On day 7 post-tumor inoculation, mice were randomly divided into four groups (n=5 per group), receiving PBS (100 μL, ip), siSPP1-mIFNγ@mLNP (100 μL, iv), α-PD-1 (100 μL, ip), or siSPP1-mIFNγ@mLNP (100 μL, iv) + α-PD-1 (100 μL, ip), respectively.

[0207] Treatment efficacy was assessed by monitoring the average fluorescence intensity of 4T1-Luc lung metastases every 7 days using bioluminescence imaging. Figure 13 As shown in Figure A, siSPP1-mIFNγ@mLNP+α-PD-1 showed the most significant inhibition of metastatic tumor growth. In the combination therapy group, the number of metastatic tumor nodules was the lowest.Figure 13 (B).

[0208] H&E staining showed numerous deeply stained tumor sites in the lung tissue of the control group, while such tumor foci were rarely seen in the siSPP1-mIFNγ@mLNP+α-PD-1 group. Figure 13 The study (C) confirmed the synergistic therapeutic effect of siSPP1-mIFNγ@mLNP+α-PD-1 on lung metastases of breast cancer.

[0209] Furthermore, when mice were treated with siSPP1-mIFNγ@mLNP+α-PD-1, the concentration of SPP1 in the interstitial fluid of tumor tissue was significantly reduced. Figure 13 (D).

[0210] Successful suppression of lung metastases can be attributed to the systemic immune response induced by the combination therapy regimen. Therefore, we assessed the tumor immune microenvironment using flow cytometry. The combination therapy resulted in an increased proportion of M1-like macrophages (3.06-fold higher than the control group) and a decreased proportion of M2-like macrophages (1.96-fold lower than the control group), indicating that the combination therapy reprogrammed macrophages to an anti-tumor phenotype. Simultaneously, the proportion of CD4+ T cells was highest in the siSPP1-mIFNγ@mLNP+α-PD-1 group (mean 9.29%), and also increased in the α-PD-1 group (mean 8.02%). Furthermore, the frequency of CD8+ T cells was significantly increased in the siSPP1-mIFNγ@mLNP+α-PD-1 group, increasing 12.81-fold compared to the untreated group. A moderate increase was also observed in the α-PD-1 group, with levels 9.08-fold higher than the untreated group (results not shown).

[0211] In summary, these data indicate that siSPP1-mIFNγ@mLNP combined with α-PD-1 can induce an effective immune response and prevent lung metastasis of breast cancer.

[0212] Immunotherapy has achieved unprecedented success in the treatment of non-small cell lung cancer (NSCLC); however, it only produces substantial clinical benefits for a small proportion of patients. Tailoring immunotherapy strategies for NSCLC patients to effectively mobilize the host immune response against tumors remains a key challenge. SPP1+ macrophages exert adverse effects on the efficacy of immunotherapy for NSCLC by limiting T cell infiltration and promoting exhaustion, among other ways, necessitating effective and precise countermeasures. The SORT strategy provides an effective platform for achieving organ-specific mRNA delivery, although it still lacks cell-specific targeting ability. Based on the SORT formula, we designed mannose-modified SORT LNPs to co-encapsulate siSPP1 and IFN-γ mRNA (siSPP1-mIFNγ@mLNP) to target and reprogram SPP1-high-expressing M2-like macrophages. SiSPP1-mIFNγ@mLNP selectively accumulated in lung SPP1-expressing M2-like macrophages, where SPP1 downregulation and IFN-γ co-expression synergistically inhibited the pro-tumor activity of SPP1+ macrophages. NSCLC patients with high SPP1+ macrophage infiltration in the clinic may benefit more from this personalized immunotherapy.

[0213] In summary, our study demonstrated that the combination of siSPP1-mIFNγ@mLNP and α-PD-1 can effectively reduce primary lung tumors and lung metastases, making potential progress in improving the efficacy of immunotherapy.

[0214] References

[0215] [1] A. A. Thai, B. J. Solomon, L. V. Sequist, J. F. Gainor, R. S. Heist, Lung cancer. The Lancet, 2021, 398 (10299), 535-554.

[0216] [2] I. Otano, A. C. Ucero, J. Zugazagoitia, L. Paz-Ares, At the crossroads of immunotherapy for oncogene-addicted subsets of NSCLC. Nature Reviews Clinical Oncology, 2023, 20 (3), 143-159.

[0217] [3] P. Chen, Y. Liu, Y. Wen, C. Zhou, Non-small cell lung cancer in China. Cancer Communications, 2022, 42(10), 937-970.

[0218] [4] D. B. Doroshow, M. F. Sanmamed, K. Hastings, K. Politi, D. L. Rimm, L. Chen, I. Melero, K. A. Schalper, R. S. Herbst, Immunotherapy in Non–Small Cell Lung Cancer: Facts and Hopes. Clinical Cancer Research, 2019, 25(15), 4592-4602.

[0219] [5] D. Uprety, S. J. Mandrekar, D. Wigle, A. C. Roden, A. A. Adjei, Neoadjuvant Immunotherapy for NSCLC: Current Concepts and Future Approaches. Journal of Thoracic Oncology, 2020, 15(8), 1281-1297.

[0220] [6] S. P. L. Saw, B.-H. Ong, K. L. M. Chua, A. Takano, D. S. W. Tan, Revisiting neoadjuvant therapy in non-small-cell lung cancer. The Lancet Oncology, 2021, 22(11), e501-e516.

[0221] [7] G. Mountzios, J. Remon, L. E. L. Hendriks, R. C. Rolfo, P. Van Schil, P. M. Forde, B. Besse, V. Subbiah, M. Reck, J.-C. Soria, S. Peters, Immune-checkpoint inhibition for resectable non-small-cell lung cancer— opportunities and challenges. Nature Reviews Clinical Oncology, 2023, 20(10), 664-677.

[0222] [8] Z. Liu, Z. Yang, J. Wu, W. Zhang, Y. Sun, C. Zhang, G. Bai, L. Yang, H. Fan, Y. Chen, L. Zhang, B. Jiang, X. Liu, X. Ma, W. Tang, C. Liu, Y. Qu, L. Yan, D. Zhao, Y. Wu, S. He, L. Xu, L. Peng, X. Chen, B. Zhou, L. Zhao, Z. Zhao, F. Tan, W. Zhang, D. Yi, X. Li, Q. Gao, G. Zhang, Y. Wang, M. Yang, H. Fu, Y. Guo, X. Hu, Q. Cai, L. Qi, Y. Bo, H. Peng, Z. Tian, Y. She, C. Zou, L. Zhu, S. Cheng, Y. Zhang, W. Zhong, C. Chen, S. Gao, Z. Zhang, A single-cell atlas reveals immune heterogeneity in anti-PD-1-treated non-small cell lung cancer. Cell, 2025, 188(11), 3081-3096.e19.

[0223] [9] N. K. Altorki, G. J. Markowitz, D. Gao, J. L. Port, A. Saxena, B. Stiles, T. McGraw, V. Mittal, The lung microenvironment: an important regulator of tumor growth and metastasis. Nature Reviews Cancer, 2018, 19(1), 9-31.

[0224]

[10] A. Mantovani, F. Marchesi, D. Di Mitri, C. Garlanda, Macrophage diversity in cancer dissemination and metastasis. Cellular & Molecular Immunology, 2024, 21(11), 1201-1214.

[0225]

[11] A. Christofides, L. Strauss, A. Yeo, C. Cao, A. Charest, V. A. Boussiotis, The complex role of tumor-infiltrating macrophages. Nature Immunology, 2022, 23(8), 1148-1156.

[0226]

[12] A. Mantovani, P. Allavena, F. Marchesi, C. Garlanda, Macrophages as tools and targets in cancer therapy. Nature Reviews Drug Discovery, 2022, 21(11), 799-820.

[0227]

[13] C. Wang, Q. Yu, T. Song, Z. Wang, L. Song, Y. Yang, J. Shao, J. Li, Y. Ni, N. Chao, L. Zhang, W. Li, The heterogeneous immune landscape between lung adenocarcinoma and squamous carcinoma revealed by single-cell RNA sequencing. Signal Transduction and Targeted Therapy, 2022, 7(1).

[0228]

[14] A. Yim, C. Smith, A. M. Brown, Osteopontin / secreted phosphoprotein-1 harnesses glial-, immune-, and neuronal cell ligand-receptor interactions to sense and regulate acute and chronic neuroinflammation. Immunological Reviews, 2022, 311(1), 224-233.

[0229]

[15] X. Pang, K. Gong, X. Zhang, S. Wu, Y. Cui, B.-Z. Qian, Osteopontin as a multifaceted driver of bone metastasis and drug resistance. Pharmacological Research, 2019, 144, 235-244.

[0230]

[16] Y. Liu, Z. Xun, K. Ma, S. Liang, X. Li, S. Zhou, L. Sun, Y. Liu, Y. Du, X. Guo, T. Cui, H. Zhou, J. Wang, D. Yin, R. Song, S. Zhang, W. Cai, F. Meng, H. Guo, B. Zhang, D. Yang, R. Bao, Q. Hu, J. Wang, Y. Ye, L. Liu, Identification of a tumour immune barrier in the HCC microenvironment that determines the efficacy of immunotherapy. Journal of Hepatology, 2023, 78(4), 770-782.

[0231]

[17] J. Qi, H. Sun, Y. Zhang, Z. Wang, Z. Xun, Z. Li, X. Ding, R. Bao, L. Hong, W. Jia, F. Fang, H. Liu, L. Chen, J. Zhong, D. Zou, L. Liu, L. Han, F. Ginhoux, Y. Liu, Y. Ye, B. Su, Single-cell and spatial analysis reveal interaction of FAP+ fibroblasts and SPP1+ macrophages in colorectal cancer. Nature Communications, 2022, 13(1).

[0232]

[18] P. W. Ruben Bill, Marius Messemaker, Whijae Roh, Beatrice Zitti, Florent Duval, Máté Kiss, Jong Chul Park, Talia M. Saal, Jan Hoelzl, David Tarussio, Fabrizio Benedetti, Stéphanie Tissot, Lana Kandalaft, Marco Varrone, Giovanni Ciriello, Thomas A. McKee, Yan Monnier, Maxime Mermod, Emily M. Blaum, Irena Gushterova, Anna L. K. Gonye, Nir Hacohen, Gad Getz, Thorsten R. Mempel, Allon M. Klein, Ralph Weissleder, William C. Faquin, Peter M. Sadow, Derrick Lin, Sara I. Pai, Moshe Sade-Feldman, Mikael J. Pittet, CXCL9: SPP1 macrophage polarity identifies a network of cellular programs that control human cancers. Science, 2023, 381, 515-524.

[0233]

[19] M. Cao, Y. Deng, Q. Hao, H. Yan, Q.-L. Wang, C. Dong, J. Wu, Y. He, L.-B. Huang, X. Xia, Y. Gao, H.-N. Chen, W.-H. Zhang, Y.-J. Zhang, X. Zhuo, L. Dai, H. Hu, Y. Peng, F. Zhang, Z. Liu, W. Huang, H. Zhang, L. Yang, Y. Shu, W. Zhang, Y. Zhang, H. Xu, Single-cell transcriptomic analysis reveals gut microbiota-immunotherapy synergy through modulating tumor microenvironment. Signal Transduction and Targeted Therapy, 2025, 10(1).

[0234]

[20] H. He, S. Chen, Z. Fan, Y. Dong, Y. Wang, S. Li, X. Sun, Y. Song, J. Yang, Q. Cao, J. Jiang, X. Wang, W. Wen, H. Wang, Multi-dimensional single-cell characterization revealed suppressive immune microenvironment in AFP-positive hepatocellular carcinoma. Cell Discovery, 2023, 9(1).

[0235]

[21] Y. Zong, Y. Lin, T. Wei, Q. Cheng, Lipid Nanoparticle (LNP) Enables mRNA Delivery for Cancer Therapy. Advanced Materials, 2023, 35(51).

[0236]

[22] X. Hou, T. Zaks, R. Langer, Y. Dong, Lipid nanoparticles for mRNA delivery. Nature Reviews Materials, 2021, 6(12), 1078-1094.

[0237]

[23] P. R. Cullis, P. L. Felgner, The 60-year evolution of lipid nanoparticles for nucleic acid delivery. Nature Reviews Drug Discovery, 2024, 23(9), 709-722.

[0238]

[24] Q. Cheng, T. Wei, L. Farbiak, L. T. Johnson, S. A. Dilliard, D. J. Siegwart, Selective organ targeting (SORT) nanoparticles for tissue-specific mRNA delivery and CRISPR-Cas gene editing. Nature Nanotechnology, 2020, 15(4), 313-320.

[0239]

[25] S. A. Dilliard, Y. Sun, M. O. Brown, Y.-C. Sung, S. Chatterjee, L. Farbiak, A. Vaidya, X. Lian, X. Wang, A. Lemoff, D. J. Siegwart, The interplay of quaternary ammonium lipid structure and protein corona on lung-specific mRNA delivery by selective organ targeting (SORT) nanoparticles. Journal of Controlled Release, 2023, 361, 361-372.

Claims

1. A lipid nanoparticle comprising: a) a nucleic acid mixture, said nucleic acid mixture comprising: i) at least one RNAi agent targeting secretory phosphoprotein-1 (SPP1), and ii) IFN-γ mRNA; and b) A lipid material, said lipid material comprising: 1,2-Dioleoyl-sn-glycerol-3-phosphorylcholine (DOTAP) and 1,2-Dioleoyl-sn-glycerol-3-phosphorylethanolamine-polyethylene glycol 2000-mannose (DMG-PEG2k-mannose); in, The nucleic acid mixture is encapsulated in the lipid material, and the lipid nanoparticles have an average particle size of less than 500 nm, preferably less than 400 nm, less than 350 nm, less than 300 nm, less than 250 nm, and most preferably less than 200 nm.

2. The lipid nanoparticles according to claim 1, wherein... The molar ratio of DOTAP in the lipid material is about 30% to about 40%, preferably about 40%; and The molar ratio of DMG-PEG2k-mannose in the lipid material is from about 1.2% to about 3.0%, preferably about 2.4%.

3. The lipid nanoparticles according to claim 1 or 2, wherein... The lipid material further comprises: Distearate phosphatidylcholine (DSPC) 4-(N,N-dimethylamino)butyric acid (dilinyl)methyl ester (D-Lin-MC3-DMA), and cholesterol; Preferably, The molar ratio of DSPC in the lipid material is from about 1% to about 50%. The molar ratio of D-Lin-MC3-DMA in the lipid material is from about 10% to about 50%. The molar ratio of cholesterol in the lipid material is from about 5% to about 50%; More preferably, The lipid material comprises: DSPC with a molar ratio of 5.90%, DOTAP with a molar ratio of 40%, D-Lin-MC3-DMA with a molar ratio of 29.4% Cholesterol with a molar ratio of 22.3%, and DMG-PEG2k-mannose with a molar ratio of 2.4%.

4. The lipid nanoparticles according to any one of claims 1-3, wherein... The RNAi agent targeting SPP1 comprises a sense strand and an antisense strand forming a double-stranded region, wherein: The sense strand comprises at least 19 consecutive nucleotides of the nucleotide sequence shown in SEQ ID NO: 1, and the antisense strand comprises at least 19 consecutive nucleotides of the nucleotide sequence shown in SEQ ID NO: 2, or The sense strand comprises at least 19 consecutive nucleotides in the nucleotide sequence shown in SEQ ID NO: 3, and the antisense strand comprises at least 19 consecutive nucleotides in the nucleotide sequence shown in SEQ ID NO:

4.

5. The lipid nanoparticles according to any one of claims 1-4, wherein... The mass concentration ratio of the RNAi agent to IFN-γ mRNA is 1:1 to 5:1; The preferred ratio is approximately 2.6:

1.

6. A nucleic acid mixture, said nucleic acid mixture comprising: i) at least one RNAi agent targeting SPP1, and ii) IFN-γ mRNA; The RNAi agent targeting SPP1 comprises a sense strand and an antisense strand forming a double-stranded region, wherein: The sense strand comprises at least 19 consecutive nucleotides of the nucleotide sequence shown in SEQ ID NO: 1, and the antisense strand comprises at least 19 consecutive nucleotides of the nucleotide sequence shown in SEQ ID NO: 2, and / or The sense strand comprises at least 19 consecutive nucleotides of the nucleotide sequence shown in SEQ ID NO: 3, and the antisense strand comprises at least 19 consecutive nucleotides of the nucleotide sequence shown in SEQ ID NO: 4; and The IFN-γ mRNA has the nucleotide sequence shown in SEQ ID NO: 5; Preferably, the mass concentration ratio of the RNAi agent to IFN-γ mRNA is 1:1 to 5:1; more preferably about 2.6:

1.

7. An RNAi agent targeting SPP1, comprising a sense strand and an antisense strand forming a double-stranded region, wherein: The sense strand comprises at least 19 consecutive nucleotides of the nucleotide sequence shown in SEQ ID NO: 1, and the antisense strand comprises at least 19 consecutive nucleotides of the nucleotide sequence shown in SEQ ID NO: 2, and / or The sense strand comprises at least 19 consecutive nucleotides in the nucleotide sequence shown in SEQ ID NO: 3, and the antisense strand comprises at least 19 consecutive nucleotides in the nucleotide sequence shown in SEQ ID NO:

4.

8. A delivery system for lung-targeted delivery of RNAi agents and / or nucleic acid mixtures, said delivery system comprising: i) The molar ratio is about 30% to about 40%, preferably about 40% of 1,2-dioleoyl-sn-glycerol-3-phosphorylcholine (DOTAP), and ii) The molar ratio is about 1.2% to about 3.0%, preferably about 2.4% of 1,2-dioleoyl-sn-glycerol-3-phosphorylethanolamine-polyethylene glycol 2000-mannose (DMG-PEG2k-mannose); Preferably, The delivery system further comprises distearylphosphatidylcholine (DSPC), methyl 4-(N,N-dimethylamino)butyrate (D-Lin-MC3-DMA), and cholesterol; More preferably, The delivery system includes: DSPC with a molar ratio of approximately 1% to approximately 50%, The molar ratio is about 30% to about 40%, preferably about 40% DOTAP. D-Lin-MC3-DMA with a molar ratio of approximately 10% to approximately 50%, Cholesterol with a molar ratio of approximately 5% to approximately 50%, and The molar ratio is from about 1.2% to about 3.0%, preferably about 2.4% DMG-PEG2k-mannose; Most preferably, The delivery system includes: DSPC with a molar ratio of 5.90%, DOTAP with a molar ratio of 40%, D-Lin-MC3-DMA with a molar ratio of 29.4% Cholesterol with a molar ratio of 22.3%, and DMG-PEG2k-mannose with a molar ratio of 2.4%.

9. Use of the lipid nanoparticles according to any one of claims 1-5, the nucleic acid mixture according to claim 6, or the RNAi agent targeting SPP1 according to claim 7 in the preparation of a medicament for treating cancer; Preferably, the cancer is lung cancer; More preferably, the lung cancer is selected from metastatic lung cancer and primary lung cancer; More preferably, the cancer is selected from: Lung metastases from breast cancer, colorectal cancer, kidney cancer, melanoma, osteosarcoma, liver cancer, endometrial cancer, prostate cancer, ovarian cancer, pancreatic cancer, soft tissue sarcoma, gastric cancer, bladder cancer, esophageal cancer, thyroid cancer, nasopharyngeal cancer, testicular tumors, cervical cancer, lung adenocarcinoma, squamous cell carcinoma, large cell carcinoma, and small cell lung cancer.

10. A drug combination for treating lung cancer, comprising: i) lipid nanoparticles according to any one of claims 1-5, nucleic acid mixtures according to claim 6, or SPP1-targeting RNAi agents according to claim 7, and ii) One or more immune checkpoint inhibitors, Preferably, the immune checkpoint inhibitor is selected from: PD-1 inhibitors, PD-L1 inhibitors, and CTLA-4 inhibitors Preferably, The immune checkpoint inhibitors are selected from: PD-1 inhibitors, PD-L1 inhibitors, and CTLA-4 inhibitors, More preferably, the lung cancer is selected from: Lung metastases from breast cancer, colorectal cancer, kidney cancer, melanoma, osteosarcoma, liver cancer, endometrial cancer, prostate cancer, ovarian cancer, pancreatic cancer, soft tissue sarcoma, gastric cancer, bladder cancer, esophageal cancer, thyroid cancer, nasopharyngeal cancer, testicular tumors, cervical cancer, lung adenocarcinoma, squamous cell carcinoma, large cell carcinoma, and small cell lung cancer.

Images