Gene therapy nose drop for preventing and / or treating coronavirus as well as preparation and application of gene therapy nose drop

Abstract

The invention discloses a gene therapy nose drop for preventing and / or treating coronavirus as well as preparation and application of the gene therapy nose drop, and belongs to the technical field of biological medicines. The nose drop comprises a reagent A and a reagent B. The reagent A is a nano-gene therapy drug solution connecting a self-assembled composite nano-material carrier and a targeted nucleic acid cleavage system through a click reaction, and the cleavage system comprises endonuclease molecules and an hpDNA oligonucleotide probe set. The hpDNA probe can target a coronavirus N gene conserved sequence and a host cell CtslmRNA at the same time through stem-loop structural design, can cut virus RNA to inhibit replication of the virus RNA, and can block the activation process of virus spike protein; the reagent B is an inhalable preparation of an anti-inflammatory chemical drug, and the drug absorption efficiency is remarkably improved by regulating inflammatory reaction. The nose drop can efficiently prevent and treat coronavirus infection and respiratory tract complications caused by the coronavirus infection through a triple mechanism of'gene editing-host regulation-anti-inflammatory treatment 'in combination with the advantage of nasal local administration, and has the obvious characteristics of high bioavailability and low system toxicity.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a gene therapy type nasal drop for treating coronavirus and preparation and application thereof. BACKGROUND

[0002] Since the Spanish flu in 1918, three major epidemics caused by the coronavirus family (SARS-CoV, MERS-CoV, SARS-CoV-2) have caused global public health crises. Among them, the economic loss caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is more than 1.6 trillion US dollars, and the number of deaths is more than 13 million.

[0003] In response to the threat of coronavirus, certain treatment methods have been developed. For example, small molecule drugs such as Molnupiravir interfere with genome replication by specifically inhibiting viral RNA polymerase activity, while Nirmatrelvir targets 3-chymotrypsin-like protease (3CLpro) to block viral polyprotein processing. In terms of neutralizing antibody therapy, Bamlanivimab, Etesevimab and Imdevimab effectively block the binding of viruses to host cell receptors by recognizing the receptor binding domain (RBD) of the viral nucleocapsid protein. However, the development of such traditional therapies often requires several years of clinical validation period, and the development speed is difficult to match the high mutation frequency of RNA viruses, resulting in the risk of clinical failure of drugs.

[0004] Gene editing technology provides a new direction for antiviral therapy, and its application has covered both DNA and RNA viruses. The CRISPR-Cas9 system has shown significant effect in DNA virus clearance, including precise intervention on herpes simplex virus 1 (HSV-1), human cytomegalovirus (HCMV) and hepatitis B virus (HBV); while the CRISPR-Cas13 system has achieved breakthrough in direct targeting and clearance of RNA viruses (such as SARS-CoV-2, lymphocytic choriomeningitis virus LCMV, influenza A virus IAV, etc.), verifying the universality value of the virus genome editing strategy.

[0005] However, the technology still faces three key challenges: first, the high cost of RNA probe synthesis and modification limits the multi-target coverage capability; second, there are technical bottlenecks in simultaneously targeting viral genes and host essential genes; third, the low bioavailability of nanocarriers in the inflammatory microenvironment leads to attenuation of in vivo delivery efficiency, which together restricts the clinical translation effect. Current research needs to make breakthroughs in probe design optimization, delivery system improvement and off-target risk control, etc.

[0006] Chinese patent CN 113975398 A discloses a therapeutic composition that integrates a nano-carrier with a gene editing component, which carries a targeting peptide, an endonuclease molecule (FEN1), and a specifically designed stem-loop structure oligonucleotide probe (hpDNA) through self-assembled composite nanomaterials, achieving a triple-precision treatment mechanism for liver fibrosis. However, the hpDNA probe design of this system is only targeted at the TIMP1 mRNA sequence related to liver fibrosis, and cannot identify the coronavirus genome. Moreover, its liver targeting properties are significantly different from the treatment needs of respiratory infections.

[0007] The development of respiratory tract-targeted gene therapy nasal drops is becoming an important breakthrough in the research and development of anti-coronavirus drugs. This technical system needs to focus on solving two key scientific problems: in terms of carrier construction, a multifunctional nano-carrier capable of simultaneously carrying a respiratory tract-specifically modified HpSGN gene editing system and a nuclease substrate small molecule needs to be developed; in terms of targeted delivery, surface ligand modification needs to be used to achieve efficient targeting of the carrier to the lung tissue, ensuring that the drug forms a persistent therapeutic concentration in the respiratory mucosa. This dual-action mechanism of "gene editing-drug synergy" can not only specifically degrade viral RNA, but also block key links in viral replication, and with the local delivery advantage of nasal administration, the systemic toxicity can be greatly reduced. If this technical platform is successfully established, it will not only provide an immediate prevention and treatment solution for the current coronavirus variants, but more importantly, it will build a modular technical reserve system that can quickly respond to newly emerging respiratory infectious diseases. SUMMARY

[0008] The purpose of the present application is to provide a gene therapy type nasal drop for preventing and / or treating coronavirus, which simultaneously achieves triple treatment functions by using a composite nano-carrier: the carrier surface is covalently connected with a nuclease having viral RNA cleavage activity and a hpDNA hairpin probe specifically recognizing the conserved region of the coronavirus genome and the host gene mRNA, achieving precise "recognition-cleavage" function; anti-inflammatory chemical drugs (such as baicalein) promote the effective absorption of drugs by regulating the inflammatory response. After nasal administration of this multi-modal nano-drug, it can be targeted to accumulate in the lung tissue, directly inhibiting viral replication and blocking viral invasion through gene editing, and reducing the phagocytosis of immune cells by the slow-release chemical drugs, significantly improving the drug uptake efficiency of lung epithelial cells. This preparation is particularly suitable for the prevention and treatment of complications such as respiratory lesions, lung inflammation, and immune disorders caused by coronavirus infection, and its local administration significantly improves the bioavailability and reduces the risk of systemic side effects.

[0009] The specific technical solution of the present application is: a gene therapy type nasal drop for preventing and / or treating coronavirus, comprising:

[0010] Reagent A: nanogene therapy drug solution, which is covalently connected with the self-assembled composite nanomaterial carrier and the targeted nucleic acid cutting system through a click chemistry reaction;

[0011] Reagent B: inhalable suspension or solution of anti-inflammatory chemical drugs;

[0012] The targeted nucleic acid cutting system comprises:

[0013] 1) an endonuclease molecule having the nucleotide sequence shown in SEQ ID NO. 2, and the encoded amino acid sequence is shown in SEQ ID NO. 3;

[0014] 2) an hpDNA oligonucleotide probe group composed of a targeting segment and a stem loop structure segment, the targeting segment specifically binds to the mRNA of the coronavirus gene and the mRNA of the host gene.

[0015] Further, the endonuclease molecule can recognize the nucleic acid secondary structure of the oligonucleotide probe and bind to the probe, and cut the target nucleic acid substrate.

[0016] Further, when used, reagent A and reagent B are separately used for nasal instillation. The amount of reagent A is 10-100 mg / kg, and the amount of reagent B is 10-300 mg / kg

[0017] Further, the hpDNA targets the mRNA sequence of at least one of the following genes:

[0018] 1) coronavirus genes: nucleocapsid protein gene (Nucleocapsid Protein, N), spike glycoprotein gene (Spike Glycoprotein, S);

[0019] 2) host genes: Cathepsin L (Cathepsin L, CTSL), Angiotensin Converting Enzyme 2 (Angiotensin Converting Enzyme 2, ACE2), Recombinant Transmembrane Protease Serine 2 (Recombinant Transmembrane Protease Serine 2, TMPRSS2), RAS Oncogene Family Member RAB7A (Member RAS Oncogene Family), DEAD-box helicase 3, X-linked protein (DEAD-box helicase 3, X-linked, DDX3X), Eukaryotic Translation Initiation Factor 2-alpha Kinase 2 (Eukaryotic Translation Initiation Factor 2-alpha Kinase 2, EIF2AK2).

[0020] As preferred, the hpDNA oligonucleotide probe set specifically comprises:

[0021] (1) The probe set targeting coronavirus CoV-N gene mRNA comprises nucleotide sequences shown in SEQ ID NO. 32, SEQ ID NO. 33, SEQ ID NO. 34 and SEQ ID NO. 35;

[0022] (2) The probe targeting host Ctsl mRNA comprises nucleotide sequence shown in SEQ ID NO. 27.

[0023] Further, the composite nanomaterial carrier is formed by self-assembly of the following components:

[0024] (a) Alkoxysilane compound: selected from tetraethyl orthosilicate, dimethyldiethoxysilane or a combination thereof;

[0025] (b) Ethylene oxide-propylene oxide-ethylene oxide triblock copolymer with a molecular weight of 14-16 KDa.

[0026] Further, the anti-inflammatory chemical drug is any one or a combination of at least two of quercetin, apigenin, genistein, kaempferol, rutin, baicalein, wogonin, isorhamnetin, xanthohumol, resveratrol and curcumin.

[0027] Further, the dosage form of the anti-inflammatory chemical drug is one of suspension or solution.

[0028] Further, the solvent of the nasal drop is selected from any one or a mixture of at least two of water, physiological saline and ethanol with a mass concentration of 5%-25%.

[0029] The preparation method of the above-mentioned gene therapy type nasal drop for preventing and / or treating coronavirus is as follows:

[0030] 1) Mix the alkoxysilane compound with the ethylene oxide-propylene oxide-ethylene oxide triblock copolymer, and obtain the composite nanomaterial carrier by self-assembly;

[0031] 2) Covalently connect the composite nanomaterial carrier with the target nucleic acid cleavage system through click reaction (azide-alkyne reaction and / or thiol-double bond reaction) to obtain a nanometer gene therapy drug solution;

[0032] 3) Prepare the inhalable suspension or solution of the anti-inflammatory chemical drug;

[0033] 4) The nanometer gene therapy drug solution prepared in step 2) is used as reagent A, and the inhalable suspension or solution of the anti-inflammatory chemical drug prepared in step 3) is used as reagent B, both of which are packaged separately, and are used for nasal instillation respectively.

[0034] Further, the targeting nucleic acid cleavage system comprises an endonuclease molecule and a hpDNA oligonucleotide probe set, and the molar ratio of the endonuclease molecule to the hpDNA oligonucleotide probe is 1:1-10.

[0035] The gene therapy nasal drops can be applied to the preparation of a medicine for inhibiting coronavirus infection, and the coronavirus is selected from at least one of the following: SARS virus, SARS-CoV-2 virus, MERS virus, variants and mutant strains thereof.

[0036] Compared with the prior art, the present application has the following advantages:

[0037] 1. The present application proposes a multi-target gene therapy strategy delivered by intranasal instillation, which co-delivers FEN1 nuclease and hairpin DNA probe (hpDNA) using self-assembled lipid nanoparticles (SCLMs), and cooperates with the anti-inflammatory effect of chemical drugs (such as quercetin, baicalein, etc.), to achieve efficient and safe treatment of coronavirus infection; the strategy blocks viral infection through double mechanisms: on the one hand, hpDNA specifically targets the coronavirus nucleocapsid (N) gene (covering more than 99% of viral strains), guides FEN1 to cut viral RNA, and achieves direct inhibition of replication; in vivo experiments show that the viral N gene mRNA levels in the nose, trachea and lung tissues of infected mice are reduced by 87.5%, 89.5% and 50.0% respectively, and viral protein expression is significantly reduced; on the other hand, it simultaneously targets the host cathepsin L (Ctsl) mRNA to inhibit the activation of viral spike protein (Ctsl mRNA and protein expression in mouse lung tissue are reduced by 52.1% and 68.7% respectively), and blocks viral invasion;

[0038] 2. Compared with traditional siRNA / sgRNA, the hpDNA probe can maintain high stability (serum half-life of 48h) without complex chemical modification, and the synthesis cost is reduced by more than 50%. It relies on the recognition characteristics of FEN1 to the spatial structure, breaks through the PAM / PFS sequence restriction, can flexibly target the virus conservative region and the host key gene, and avoids target escape caused by virus mutation;

[0039] 3. The nano-carrier SCLMs make the drug highly enriched in lung tissue, and the fluorescence intensity in the lung within 24 hours is 5-10 times that in other organs; baicalein reduces the phagocytosis of immune cells to nanoparticles by inhibiting inflammatory factors, so that the drug uptake efficiency of lung epithelial cells is significantly improved;

[0040] 4. The intranasal instillation dosage form (liquid preparation / suspension) supports self-administration of patients, does not require professional equipment, and is especially suitable for post-exposure prophylaxis, and can quickly establish a defense barrier in the early stage of viral invasion;

[0041] 5、The hpDNA probe used in the present application has high coverage (>99%) for various subtypes of coronavirus (including 5054 randomly screened subtypes of new coronavirus), can cope with variants and mutant strains of the virus, and is compatible with other coronavirus prevention and treatment such as SARS / MERS;

[0042] 6、The dose range of the nanogene therapy drug and the chemical drug for nasal administration is optimized scientifically to ensure the balance between efficacy and safety;

[0043] 7、The nanoparticle has strong stability and low production cost, and has significant progress in target coverage, stability, toxicity, and administration convenience compared with the prior art, thereby providing an innovative solution for the prevention and treatment of coronavirus and respiratory virus infection. BRIEF DESCRIPTION OF DRAWINGS

[0044] Figure 1 Subfigure a is the SDS-PAGE Coomassie blue staining result of NES-FEN1-NES protein; subfigure b is the structural schematic diagram of hpDNA probe; subfigure c is the denaturing gel electrophoresis diagram of catalytic cleavage experiment of target 5'FAM-ssRNA mediated by different concentrations of NES-FEN1-NES protein; subfigure d is a representative 100x confocal microscope image of HEK293T cells co-transfected with His-FEN1 and Cy5-hpDNA at different transfection times; subfigure e shows the influence on cleavage efficiency; subfigure f shows the influence of different proportions of FEN1 and hpDNA on knockdown efficiency; and subfigure g shows the influence of different doses on cleavage efficiency at the cell level. 2+ Subfigure a is the SDS-PAGE Coomassie blue staining result of NES-FEN1-NES protein; subfigure b is the structural schematic diagram of hpDNA probe; subfigure c is the denaturing gel electrophoresis diagram of catalytic cleavage experiment of target 5'FAM-ssRNA mediated by different concentrations of NES-FEN1-NES protein; subfigure d is a representative 100x confocal microscope image of HEK293T cells co-transfected with His-FEN1 and Cy5-hpDNA at different transfection times; subfigure e shows the influence on cleavage efficiency; subfigure f shows the influence of different proportions of FEN1 and hpDNA on knockdown efficiency; and subfigure g shows the influence of different doses on cleavage efficiency at the cell level.

[0045] Figure 2 The RT-qPCR results normalized based on FEN1 protein / hpDNA complex (labeled as FEN1 in the figure) are shown, and the silencing efficiency of CRISPR-Cas13d RNP (Cas13d) and siRNA in different cell lines and genomes for specific target genes is compared; wherein, subfigure a is the knockdown effect of KRAS, PPIB and CXCR4 mRNA in HEK293T cells, subfigure b is the knockdown effect of KRAS, PPIB and CXCR4 mRNA in HepG2 cells, and subfigure c respectively presents the expression changes of CTSL, STAT3 mRNA in A549 cells and Timp1 mRNA in LLC cells, and all results are normalized and analyzed based on the non-targeted (NT) control;

[0046] Figure 3 The cell survival rate comparison data after treatment with FEN1 protein / hpDNA complex, FEN1 plasmid / hpDNA, CRISPR-Cas13d-RNP (Cas13d) and siRNA;

[0047] Figure 4 Scatter plot of differential gene expression levels of CTSL mRNA in A549 cells targeted by FEN1 protein / hpDNA complex for RNA-seq;

[0048] Figure 5 TEM images and particle size diagrams of SCLMs and SCLMs-FEN1 protein / hpDNA complex (referred to as S@F) nanoparticles, wherein subgraph a is the TEM image of SCLMs; subgraph b is the TEM image of S@F nanoparticles (scale = 50 nm); subgraph c is the particle size diagram of SCLMs; subgraph d is the particle size diagram of S@F nanoparticles;

[0049] Figure 6 Subgraph a is the hydrated size diagram of SCLMs and S@F nanoparticles; subgraph b is the intranasal administration schematic diagram; subgraph c is the ex vivo imaging of the major organs of the mouse, including heart, liver, lung, spleen, stomach, intestine and kidney, after intranasal administration for 2, 12, 24, 48, 72, 96, 120 and 168 h; subgraph d is the average fluorescence intensity of the major organs of the mouse over time; subgraph e is the cell distribution of SCLMs in the lung, with blue fluorescence representing DAPI-labeled cell nuclei and red fluorescence representing Cy5.5-SCLMs, scale = 20 μm;

[0050] Figure 7 Subgraph a is the effect of different guide sequences on the relative expression of Ctsl mRNA in LLC cells; subgraph b is the change in the relative expression of Ctsl mRNA in the lung tissue of the mouse after intranasal administration of S@F at different doses; subgraph c is the Western blot diagram of the down-regulation of Ctsl protein expression in the lung tissue of the S@F-40 treatment group; subgraph d is the quantitative result of the down-regulation of Ctsl protein expression in the lung tissue of the S@F-40 treatment group; subgraph e is a representative image of Ctsl immunostaining in the lung tissue, with the left side being the untreated group (NC) and the right side being the S@F-40 treatment group, scale = 100 μm; subgraph f is the quantitative result of Ctsl immunostaining in the lung tissue;

[0051] Figure 8 Subgraph a is the Ctsl mRNA expression level in the liver, spleen and kidney of the mouse in the S@F-40 treatment group; subgraph b is the mRNA level of Ctsd, Ctsb and Ctss in the lung tissue of the mouse in the S@F-40 treatment group; subgraph c is the histological analysis (H&E staining) result of the mouse after S@F-40 treatment, scale = 20 μm; subgraph d is the ALT level of the mouse after S@F-40 treatment; subgraph e is the AST level of the mouse after S@F-40 treatment; subgraph f is the BUN level of the mouse after S@F-40 treatment; subgraph g is the CR level of the mouse after S@F-40 treatment;

[0052] Figure 9 Panel a shows the effect of baicalein treatment on the mRNA expression levels of Tnf, Il-6 and Il-1b in LPS-induced lung inflammation mice; Panel b shows the improvement of lung tissue pathology in LPS-induced lung inflammation mice by baicalein treatment, scale = 50 pm; Panel c is the percentage of co-localization of Cy5.5 positive markers with endothelial cells, immune cells and epithelial cells in each treatment group; Panel d is a representative tissue immunofluorescence image of Cy5.5-SCLMs positive expression in immune cells (CD45) and epithelial cells (EpCAM);

[0053] Figure 10 Panel a is a schematic diagram of the synergistic treatment verification experiment of baicalein and target N gene, Ctsl mRNA probe; Panel b is the relative mRNA expression level of SARS-CoV-2 virus CoV-N gene in the nasal tissue of mice after S@F-baicalein combined treatment; Panel c is the relative mRNA expression level of SARS-CoV-2 virus CoV-N gene in the tracheal tissue of mice after S@F-baicalein combined treatment; Panel d is the relative mRNA expression level of SARS-CoV-2 virus CoV-N gene in the lung tissue of mice after S@F-baicalein combined treatment; Panel e is the spatial distribution characteristics of SARS-CoV-2 virus nucleocapsid protein (CoV-N) in the lung tissue of mice after immunohistochemical staining (IHC); Panel f is the quantitative results of SARS-CoV-2 virus nucleocapsid protein (CoV-N) in the lung tissue of mice after immunohistochemical staining (IHC);

[0054] Figure 11 Panel a is the mRNA expression level of SARS-CoV-2 nucleocapsid protein gene (CoV-N) in the brain tissue of mice after S@F-baicalein combined treatment; Panel b is the spatial distribution characteristics of SARS-CoV-2 virus nucleocapsid protein (CoV-N) in the brain tissue of mice after immunohistochemical staining (IHC), scale = 200 pm; Panel c is the quantitative results of SARS-CoV-2 virus nucleocapsid protein (CoV-N) in the brain tissue of mice after immunohistochemical staining (IHC); Panel d is the effect of S@F-baicalein combined treatment on the mRNA expression of brain injury marker Cxcl10 in the brain tissue of mice; Panel e is the effect of S@F-baicalein combined treatment on the mRNA expression of brain injury marker Ccl2 in the brain tissue of mice; Panel f is the effect of S@F-baicalein combined treatment on the mRNA expression of brain injury marker Ccl5 in the brain tissue of mice. DETAILED DESCRIPTION

[0055] The technical solution of the present invention will be further described below with reference to the accompanying drawings, but it is not limited thereto. Any modifications or equivalent substitutions to the technical solution of the present invention that do not depart from the spirit and scope of the technical solution of the present invention should be covered within the protection scope of the present invention.

[0056] Example 1

[0057] This embodiment is mainly used to pre-verify whether the FEN1 protein / hpDNA complex can be used as a precise nucleic acid cleavage tool. The verification process is as follows:

[0058] 1) Construction and purification of NES-FEN1-NES protein expression plasmid

[0059] To achieve the localization and efficient expression of the FEN1 nuclease in the cytoplasm, the FEN1 open reading frame of *A. fulgidus* was first synthesized. Nuclear export signal (NES) sequences (LYPERLRRILT, SEQ ID NO. 1) were introduced at the N-terminus and C-terminus, respectively. The target gene was then inserted into the pET28a(+) vector using NdeI and NotI double digestion enzymes to construct the pET28a(+)-NES-FEN1-NES recombinant plasmid. The nucleotide sequence of the NES-FEN1-NES protein is shown in SEQ ID NO. 2, and the encoded amino acid sequence is shown in SEQ ID NO. 3. After sequencing verification, the protein was transformed into *E. coli* BL21(DE3) competent cells. FEN1 protein expression was induced using a prokaryotic expression system under low temperature conditions. After cell lysis, the NES-FEN1-NES protein (referred to as FEN1 protein) was purified by Ni-affinity chromatography.

[0060] like Figure 1 As shown in neutron diagram a, FEN1 protein was exogenously overexpressed in E. coli BL21(DE3), with its N-terminus fused with a His tag to support affinity purification and its C-terminus fused with an NES tag to achieve extranuclear localization. After purification, the protein sample was separated by SDS-PAGE and stained with Coomassie brilliant blue. The electrophoresis results showed that the molecular weight of FEN1 protein was approximately 38 kDa, providing a highly active protein raw material for subsequent gene editing function verification.

[0061] 2) Verify the ability of NES-FEN1-NES protein to cleave substrate RNA in vitro.

[0062] The ssRNA substrate (sequence: 5'-CAGCAGUUUGGCCCGCCCAAAAUCUGUGAUC UUGACAUG-3', SEQ ID NO.4) was designed and synthesized, and a FAM fluorescent group was modified at its 5' end. The corresponding hpDNA was designed for the ssRNA (sequence: 5'-AAGATCACAGATTTTGGGCGAGAGTCGGCCTTTTGGCCGAC TCTC-3', SEQ ID NO.5). The hpDNA consists of a guide sequence complementary to the target nucleic acid and a fixed stem-loop structure. The structure is referred to as Figure 1 Neutron diagram b, which functions to guide the FEN1 protein to cleave the target RNA. Different concentrations of FEN1 protein were set to test the efficiency of the enzyme in cleaving the substrate.

[0063] Reaction system: 10 μL system was prepared, 10 pmol of hpDNA probe, 5 pmol of ssRNA substrate and MOPS (10 mM), 0.05% Tween-20, 0.01% nonidet P-40, MgCl2 (7.50 mM) were fully mixed, different concentrations of FEN1 protein were added, and the volume was made up to 10 μL with ultrapure water, and then the reaction was carried out at 37°C for 2 h. The reaction products were separated using 20% denatured polyacrylamide gel and 1x TBE buffer, and the results were analyzed using a multifunctional gel imaging instrument Amersham Imager600 (GE Healthcare). The results are shown in Figure 1 Neutron diagram c, in which the left arrow mark "Uncleaved ssRNA" represents the uncut single-stranded RNA (ssRNA) target substrate, and the arrow mark "Cleaved product" represents the product cleaved by the enzyme. The substrate is a single-stranded RNA (ssRNA) labeled with FAM fluorescence at the 5' end. Whether or not the hpDNA is added is used to verify the specificity of the enzyme to the substrate in the subsequent step (the "+" in the "hpDNA" column in the figure indicates that the hpDNA is added, and the underline " / " indicates that the hpDNA is not added); the concentration of NES-FEN1-NES protein (in pmol) is 0, 0, 0.5, 0.5, 1, 5, and 10, respectively. As can be seen from the figure, the NES-FEN1-NES protein has the ability to cleave the substrate RNA in vitro, and 5 pmol of FEN1 protein can complete the cleavage process of the substrate single-stranded RNA (ssRNA) with FAM at the 5' end under the guidance of hpDNA.

[0064] 3) Verify that the FEN1 protein is located in the cytoplasm and can down-regulate the target mRNA under a variety of combined conditions

[0065] To verify the cell transfection efficiency of NES-FEN1-NES / hpDNA complex, the experiment selected HEK293T cell line for standardized culture: 8x10 4 cells / well were seeded in 24-well plates (containing polylysine-coated slides) 24 hours in advance, and fresh medium was replaced 1 hour before transfection. The experimental group used a gradient transfection system (7.5 mM Mg 2+ , FEN1 protein and Cy5-hpDNA complex) and was transduced by Trans Intro TM EL Transfection Reagent (Beijing Quanshijin Biotechnology Co., Ltd., FT201-01) for 30 minutes at room temperature, then added to the well plate, and the medium was replaced 8 hours later. An untransfected group was set up as a blank control.

[0066] Standardized immunofluorescence (IF) detection was performed 24h, 48h and 72h after transfection: ① fixation: 4% paraformaldehyde room temperature fixation for 20 minutes; ② permeabilization: 0.3% Triton X-100 (4°C) treatment for 20 minutes; ③ blocking: 3% BSA (prepared in PBS) blocking for 1 hour; ④ antibody incubation: His-Tag primary antibody 4°C overnight, green fluorescent secondary antibody incubated for 1 hour in the dark; ⑤ nuclear staining: DAPI mounting, then image acquisition by laser confocal microscope. Pay attention to light protection operation and gentle washing (PBS rinse 3x5 minutes / step) throughout the process.

[0067] The results of immunofluorescence (IF) analysis are shown in subfigure d of Figure 1 After FEN1 protein was recognized by His-Tag antibody and combined with green fluorescent secondary antibody, it showed green signal, Cy5-labeled hpDNA showed red fluorescence, and DAPI staining made the cell nucleus appear blue. The merged image (Merge) showed that the FEN1 protein and Cy5-hpDNA complex successfully entered the cells after transfection and formed obvious aggregation in the extranuclear region. This result confirmed the co-localization characteristics of FEN1 protein and exogenous DNA in cells.

[0068] According to the experimental results in subfigures e-g, Figure 1 by systematically adjusting the incubation conditions (including the presence or absence of Mg 2+ , FEN1 and hpDNA molar ratio gradient setting (2:1, 1:1, 1:2, 1:4, 1:9) and protein dose gradient (10-50 pmol)), it was observed that all experimental groups could significantly down-regulate the expression of target mRNA.

[0069] 4) Comparison of knockdown efficiency of FEN1 protein / hpDNA complex (DNP), Cas13d-RNP and siRNA

[0070] The knockdown efficiency of the deoxyribonucleoprotein complex to the target RNA was compared with two RNA targeting knockdown tools, CRISPR-Cas13d-RNP and siRNA, in which CRISPR-Cas13d is one of the existing CRISPR systems without the need for PFS sequences. In the experiment, KRAS, PPIB and CXCR4 mRNA in HEK293T and HepG2 cell lines were targeted respectively, CTSL in A549 cell line, STAT3 mRNA and Timp1 mRNA in LLC cell line were targeted. The knockdown efficiency of DNP, RNP and siRNA was compared.

[0071] hpDNA sequence see Table 1

[0072] Table 1, hpDNA probe sequence

[0073]

[0074]

[0075] Transfection of RNP complex, siRNA: HEK293T cells were seeded in 24-well plates at a density of 8x10 4 cells / well 24h in advance. Fresh medium was replaced 1h before transfection. Transfection of RNP sample: CRISPR Cas13d protein, corresponding sgRNA probe (sgRNA probe sequence see Table 2) and 7.5mM Mg 2+ were added in 50μL serum-free medium at room temperature, and 2.5μL Trans Intro TM EL Transfection Reagent was added after 15min incubation, and mixed gently. Incubate at room temperature for 15min, and then the transfection mixture was added to the 24-well plate. Fresh medium was replaced after 8h. Transfection of siRNA sample: siRNA (siRNA sequence see Table 3) 50pmol was added in 50μL serum-free medium at room temperature, and 2.5μL Trans Intro TM EL Transfection Reagent was added, and mixed gently. Incubate at room temperature for 15min, and then the transfection mixture was added to the 24-well plate. Fresh medium was replaced after 8h.

[0076] Table 2, sgRNA probe sequence

[0077]

[0078]

[0079] Table 3, siRNA sequence

[0080] Name Sequence (5'-3') si-KRAS AAAUCAUUUGAAGAUAUUCACCAUUAUA (SEQ ID NO. 20) si-PPIB UCUUCAUCACGACAGUCAAGA (SEQ ID NO. 21) si-CXCR4 AGAUAACUACACCGAGGAAAU (SEQ ID NO. 22) si-CTSL GAGUCCUUCCUGUUCUAUAAA (SEQ ID NO. 23) si-STAT3 CCUGAGUUGAAUUAUCAGCUU (SEQ ID NO. 24) si-Timp1 AAGAGUUUCUCAUCACGGGCC (SEQ ID NO. 25)

[0081] Quantitative PCR analysis was performed on cDNA using AceQ qPCR SYBR Green Master Mix (Vazyme, Q131) and specific primers listed in the table.

[0082] The efficiency of DNP complex was compared with CRISPR Cas13d-RNP and siRNA at the same site, and the results are shown in FIGS. a-c of Figure 2 The knockdown efficiency of DNP complex is comparable to or even higher than that of the two commonly used RNA knockdown tools, as shown in FIGS. a-c of

[0083] 5) Verification of the cytotoxicity of FEN1 protein / hpDNA complex (DNP)

[0084] After transfection, the survival rate of cells was inhibited. To investigate the effect of DNP on cell survival, CCK-8 experiments were performed on DNP, plasmid transfection, RNP and siRNA to investigate the cell survival.

[0085] The results are shown in FIGS. a-c of Figure 3 As can be seen from the figure, the effect of FEN1 protein / hpDNA complex on cell survival is smaller than that of plasmid transfection and siRNA, which is consistent with the observation of cell growth state.

[0086] 6) Comparison of the targeting specificity of FEN1 protein / hpDNA complex (DNP)

[0087] The off-target effect of DNP system was analyzed by whole transcriptome sequencing (RNA-seq) Figure 4 The results show that, compared with the negative control group (NT), only 44 genes were significantly up-regulated (red dots) and 107 genes were significantly down-regulated (green dots) in the target group, and the number of differentially expressed genes was significantly lower than the typical off-target level of the reported CRISPR or siRNA system. The X / Y axis in the figure represents the gene expression (log value of TPM) in the two groups of samples, and the data distribution is concentrated and the dispersion is low, which further indicates that the DNP system has higher targeting specificity.

[0088] The comprehensive experimental results show that: NES-FEN1-NES protein can effectively cut RNA in vitro and has the ability to down-regulate target mRNA in the cytoplasm (equivalent to Cas13d-RNP / siRNA efficiency), which confirms that the FEN1 protein / hpDNA complex can be used as a precise nucleic acid cutting tool. Its unique advantages-low cytotoxicity, high target specificity and sensitivity to sequence mismatches-lay a molecular foundation for the development of new gene drugs. Based on this, the subsequent examples further construct a nasal dosage form of nanogene drug: the nucleases FEN1 and hairpin structure probes hpDNA are co-loaded in the nanocarrier, and an anti-inflammatory small molecule drug is integrated, aiming to realize the dual treatment strategy of viral nucleic acid targeted clearance and local inflammation synergistic regulation.

[0089] Example 2

[0090] 1) Preparation of nanocarrier silicon cross-linked micelles (SCLMs)

[0091] SCLMs are composed of Pluronic triblock copolymer micelles and silica shells of cross-linked micellar hydrophobic cores, and the specific preparation process is as follows: take F-108 (hereinafter referred to as F108, F108 is a triblock copolymer of ethylene oxide-propylene oxide-ethylene oxide PEO-PPO-PEO, PEO is hydrophilic, PPO is hydrophobic, Mw, 14.6KDa, 0.25g) is dissolved in an HCl (7.5mL, 2.0M) solution at room temperature, and stirred for 15min to make it fully dissolved. Add 240μL of cyclohexane, ultrasonic for 2min, mix thoroughly until the solution appears milky white, continue to stir at room temperature for 0.5h, make it fully dissolved. Add 268μL of tetraethyl silicate, stir at room temperature for 4h, add 40μL of dimethyldiethoxysilane DEDMs. After 24h of reaction, collect the solution and dialyze in deionized water overnight using a dialysis membrane with a molecular weight of 20000D to remove impurities.

[0092] The obtained composite nanomaterial is placed in a rotary evaporator and evaporated at 50℃, 150mbar for 30min to remove cyclohexane. After rotary evaporation, centrifuge at 5000rpm / min for 10min, take the supernatant to obtain SCLMs, and after assembly, PPO becomes the hydrophobic core.

[0093] 2) Synthesis of composite nanomaterials connected with HpSGN (FEN1+hpDNA)

[0094] FEN1 (nucleotide sequence as shown in SEQ ID NO. 2, the encoded amino acid sequence as shown in SEQ ID NO. 3) was dissolved in a non-amine buffer solution (pH = 8.0), 0.1-5 mM EDTA was added to the buffer solution to chelate divalent metals in the solution to prevent thiol oxidation. According to the size and concentration of FEN1 and the required thiolation level, 2-20 molar excess of 2-iminothiolane hydrochloride was added to the solution, incubated at room temperature for 1 hour to obtain FEN1-SH.

[0095] The thiol group at the 5' end of the hpDNA probe (GCCGTGCTGCCCGTTGCTGTATTCCCCGTTAGAGTCGGCCTTTTGGCCGACTCTC, SEQ ID NO. 27) was modified to obtain hpDNA-SH.

[0096] FEN1-SH (400 pmol) and hpDNA-SH (3600 pmol) were added to SCLMs (0.78 mg) and reacted at room temperature for 2 h to obtain a solution, which was FEN1-hpDNA-SCLMs (S@F).

[0097] The morphology of the material was observed by transmission electron microscopy (TEM), and the hydration size was measured by dynamic light scattering (DLS). The colloidal stability of SCLMs was evaluated by monitoring the size change of SCLMs in PBS within 7 days.

[0098] TEM images show that the obtained S@F nanoparticles are monodisperse spherical nanoparticles with a hollow structure. Figure 5 DLS measurement confirmed that the obtained S@F nanoparticles are monodisperse spherical nanoparticles with a hollow structure. Figure 6 Neutron diagram a), and its hydration size is 45.2 ± 2.5 nm. The nanocarrier showed good colloidal stability in PBS within 7 days, and its size remained consistent during this period. It is shown that SCLMs is a stable nanocarrier suitable for in vivo delivery of FEN1 protein / hpDNA complexes.

[0099] 3) Nasal drop SCLMs nanomaterials

[0100] SCLMs were labeled with Cy5.5 fluorescent dye for tracking their biodistribution. The labeled SCLMs were administered to mice through intranasal administration. At different time points (2, 12, 24, 48, 72, 96, 120 and 168 h) after administration, ex vivo fluorescence imaging of major organs (Heart (H), Liver (Li), Lung (Lu), Spleen (Sp), Stomach (St), Intestines (I) and Kidney (K)) was performed and quantified. Meanwhile, lung tissue sections were examined to observe the cellular distribution of SCLMs.

[0101] Ex vivo imaging and fluorescence intensity data Figure 6 Neuron graphs c, d) showed that after intranasal administration, SCLMs were mainly confined to the pulmonary system and did not significantly spread to other organs within the first 24 hours. Immunohistochemistry (IHC) results of lung tissue sections showed that Cy5.5-labeled SCLMs exhibited apparent localization around the cell nucleus, indicating that they were successfully taken up by lung cells. Intranasal administration can lead to more precise accumulation of drugs in the cytoplasm Figure 6 Neuron graph e).

[0102] The above data show that intranasal instillation of SCLMs nanomaterials has the ability to target lung tissue distribution under normal physiological conditions, and clearly demonstrates the organ specificity of SCLMs nanomaterials in respiratory tract administration and the effect of inflammation environment on targeting efficiency, indicating that SCLMs nanomaterials have high lung targeting ability when administered through the nasal cavity.

[0103] 4) Therapeutic effect verification of SCLMs nanomaterials carrying targeted Ctsl probes

[0104] Experimental setup: First, six hpDNA candidate probes targeting mouse Ctsl mRNA were screened in the mouse LLC lung cancer cell line to determine the most effective probe, which were:

[0105] hp-Ctsl-L1: CCTCATTACCGCTACCCATCAATTCACGACAGAGTCGGCCTTTTGGCCGACTCTC (SEQ ID NO. 26);

[0106] hp-Ctsl-L2: GCCGTGCTGCCCGTTGCTGTATTCCCCGTTAGAGTCGGCCTTTTGGCCGACTCTC (SEQ ID NO. 27);

[0107] hp-Ctsl-L3: TTGCCTTGAGCGTGAGAACAGTCCACAAGGAGAGTCGGCCTTTTGGCCGACTCTC (SEQ ID NO. 28);

[0108] hp-Ctsl-L4: CACAGCGAACTCGGCTCTGTATTTACAAGAAGAGTCGGCCTTTTGGCCGACTCTC (SEQ ID NO. 29);

[0109] hp-Ctsl-S1: GCTACCCATCAATTCACGACAGAGTCGGCCTTTTGGCCGACTCTC (SEQ ID NO. 30);

[0110] hp-Ctsl-S2: CCGTTGCTGTATTCCCCGTTAGAGTCGGCCTTTTGGCCGACTCTC (SEQ ID NO. 31);

[0111] Referring to Figure 7 Neutron diagram a, hp-Ctsl-L2 probe showed the highest Ctsl mRNA knockdown efficiency in LLC cells, with a decrease of 52.9%, so hp-Ctsl-L2 was used as the preferred probe for subsequent experiments.

[0112] hp-Ctsl-L2 was combined with FEN1 protein and encapsulated into SCLMs to form S@F nanodrugs according to the foregoing method.

[0113] S@F nanodrugs were administered to C57BL / 6 mice by intranasal administration at doses of 25 mg / kg, 40 mg / kg and 60 mg / kg (corresponding to S@F-25 treatment group, S@F-40 treatment group and S@F-60 treatment group). After 48 h of administration, the lung tissues of mice were collected, Ctsl mRNA levels were quantified by RT-qPCR, and protein levels were detected by Western blot (WB) and immunohistochemistry (IHC).

[0114] In vivo efficacy (mRNA level): S@F administered by intranasal administration significantly reduced the lung Ctsl mRNA level. Among them, the S@F-40 treatment group showed the highest efficiency 48 h after administration, and the Ctsl mRNA expression was reduced by 52.11% (P < 0.01) compared with the control group. Figure 7 Neutron diagram b).

[0115] In vivo efficacy (protein level): Correspondingly, Western blot analysis showed that the Ctsl protein level in the lung tissue of the S@F-40 treatment group was reduced by 68.66% (P < 0.01) compared with the control group. Figure 7Neutron graph c, d). IHC staining also further demonstrated that the S@F-40 treatment group significantly reduced the expression of Ctsl protein in the lung tissue of mice, which further confirmed the inhibitory effect of S@F on the expression of Ctsl protein Figure 7 Neutron graph e, f).

[0116] Further detection of Ctsl mRNA levels in other tissues (liver, spleen, kidney) of S@F-40 treated mice and mRNA levels of other tissue protease family members (Ctsb, Ctsd, Ctss) in the lungs to evaluate the specificity of the knockdown (Ctsd, Ctsb and Ctss are family genes of Ctsl with certain similarity). At the same time, the safety was evaluated by monitoring the body weight of mice and liver and kidney function indicators (ALT, AST, BUN, CR).

[0117] Specificity: S@F treatment had no effect on Ctsl mRNA levels in the liver, spleen or kidney Figure 8 Neutron graph a). In addition, the mRNA levels of other tissue protease family members (Ctsb, Ctsd, Ctss) in the lungs also did not change Figure 8 Neutron graph b).

[0118] Safety: The body weight of mice remained stable after S@F treatment. Histological analysis (H&E staining) showed that there was no significant inflammatory response or pathological changes in each organ (heart, liver, spleen, lung, kidney) Figure 8 Neutron graph c). Liver and kidney function indicators: alanine aminotransferase (ALT), aspartate aminotransferase (AST), urea nitrogen (BUN), creatinine (CR) also maintained normal levels Figure 8 Neutron graph d-g).

[0119] The above results collectively demonstrate that SCLMs carrying FEN1 protein / hpDNA complex targeting Ctsl can efficiently down-regulate the expression level of Ctsl in lung tissue, and no obvious systemic toxicity reaction is observed, confirming that the delivery system has both therapeutic specificity and biological safety.

[0120] 5) Verification of Baicalein's Anti-inflammatory Effect and Facilitation of SCLMs into Epithelial Cells

[0121] Experimental setup: An acute pneumonia mouse model was established by lipopolysaccharide (LPS) induction to simulate the inflammatory environment caused by viral infection. Mice were treated with Baicalein inhalation suspension, and the expression levels of inflammatory factors (Tnf, Il-6 and Il-1β mRNA) were measured. H&E staining of lung tissue was also performed to observe inflammation.

[0122] Baicalein treatment significantly inhibited LPS-induced inflammatory response in mice, which was manifested by Figure 9 The mRNA expression levels of key pro-inflammatory cytokines (Tnf, Il-6 and Il-1β) shown in Fig. 6a were significantly down-regulated. This result confirmed that baicalein has a significant anti-inflammatory effect. The H&E staining results further confirmed the anti-inflammatory effect of baicalein Figure 9 Fig. 6b).

[0123] Pulmonary epithelial cells are the main target cells of SARS-CoV-2 infection. The cellular uptake of Cy5.5-labeled SCLMs in different lung cell types (macrophages, endothelial cells and epithelial cells) with or without co-administration of baicalein was evaluated by immunofluorescence technique.

[0124] Baicalein treatment significantly changed the distribution pattern of Cy5.5-SCLMs nanomaterials in mice. In the LPS-induced inflammatory state, Cy5.5-SCLMs were mainly phagocytosed by immune cells or taken up by endothelial cells. After baicalein intervention, the number of Cy5.5-positive immune cells decreased significantly, while the accumulation of SCLMs nanomaterials in epithelial cells increased significantly. This indicates that baicalein effectively reduces the non-specific uptake of nanomaterials by the immune system through its anti-inflammatory effect, thereby promoting the targeted delivery of SCLMs to epithelial cells Figure 9 Fig. 6c).

[0125] Biodistribution: Baicalein administration had no negative impact on the tissue-level delivery of Cy5.5-SCLMs. The research results showed that baicalein, as an effective adjuvant, helps to significantly improve the bioavailability of S@F nanomedicines in pulmonary epithelial cells by reducing the inflammatory response and reducing the uptake of nanoparticles by immune cells Figure 9 Fig. 6d).

[0126] 6) Verification of the synergistic therapeutic effect of baicalein and hpDNA probe group

[0127] Experimental setup: The experiment used 6-8 week old mRosa26-PGK-hACE2 / IOZ mouse models, and established infection by intranasal inoculation of SARS-CoV-2 (WH-09) strain.

[0128] This experiment designed to screen four hpDNA probes targeting mouse CoV-N gene mRNA, combined with hpDNA probe hp-Ctsl-L2 (SEQ ID NO. 27) targeting mouse Ctsl mRNA for experiment;

[0129] The probe sequence targeting CoV-N gene mRNA is:

[0130] hp-CoV-N-1: TTGAATCTGAGGGTCCACCAAAAGAGTCGGCCTTTTGGCCGACTCTC (SEQ ID NO. 32);

[0131] hp-CoV-N-2: CCCCACTGCGTTCTCCATTCTGAGAGTCGGCCTTTTGGCCGACTCTC (SEQ ID NO. 33);

[0132] hp-CoV-N-3: TGAACCAAGACGCAGTATTATTAGAGTCGGCCTTTTGGCCGACTCTC (SEQ ID NO. 34);

[0133] hp-CoV-N-4: AACGCCTTGTCCTCGAGGGAATAGAGTCGGCCTTTTGGCCGACTCTC (SEQ ID NO. 35);

[0134] The covalent connection of FEN1 and five hairpin structure DNA (hpDNA) probes is also completed by using the above-mentioned thiol-double bond click chemistry reaction to form a target nucleic acid cleavage system with sequence specificity, and then through the directional coupling of the surface active groups of SCLMs and hpDNA, a three-dimensional functional complex FEN1-hpDNA-SCLMs (S@F) is finally formed. The subsequent experimental process is based on the S@F prepared in this step.

[0135] The treatment group is divided into three groups (see the specific scheme in Figure 10 Neutron diagram a): 1) combined intervention group (S@F + baicalein), S@F nanomedicine (40 mg / kg / time) was given twice in the nasal cavity on the 1st and 3rd day after infection, and baicalein inhalation suspension (50 mg / kg / time) was given daily from the 1st to 4th day after infection for treatment; 2) single drug group (S@F group), S@F nanomedicine (40 mg / kg / time) was given at the same period; 3) baicalein group (baicalein group), baicalein inhalation suspension (50 mg / kg / time) was given daily from the 1st to 4th day after infection. The control group is set as the virus infection group without drug administration (NC-V). All groups are evaluated for effect on the 5th day after infection, and the synergistic antiviral effect of S@F nanomedicine and baicalein is systematically analyzed by comparing the viral load, inflammation index and other data of each group.

[0136] Viral load was assessed by quantifying CoV-N gene expression in mouse Nasal, Trachea, Lung tissues by RT-qPCR. Cellular localization and expression levels of SARS-CoV-2 nucleocapsid protein (CoV-N) were quantitatively analyzed by lung tissue immunohistochemistry (IHC) staining.

[0137] Viral gene knockdown: by Figure 10 As can be seen from the bar graphs b-d, the combined intervention group showed significant viral inhibition effect in different segments of the mouse respiratory tract compared with the NC-V group, S@F group and Baicalein group: the CoV-N gene expression in the nasal, tracheal and lung tissues was down-regulated by 87.5%, 89.5% and 50.0%, respectively.

[0138] Protein level reduction: immunohistochemistry (IHC) quantitative analysis showed that the expression level of SARS-CoV-2 nucleocapsid protein (CoV-N) in the lung tissue of the S@F-Baicalein combined intervention group of mice was significantly lower than that of the control group, and also significantly lower than that of the S@F group and the Baicalein group, which verified the antiviral effect of the synergistic therapy from the protein level Figure 10 Bar graphs e, f).

[0139] The survival rate of mice was monitored, and the expression level of brain injury markers (Cxcl10, Ccl2 and Ccl5 mRNA) was measured.

[0140] Brain protection: the S@F-Baicalein combined intervention group achieved a CoV-N clearance efficiency of 62.3% in the brain tissue Figure 11 Bar graph a). By immunohistochemistry (IHC) quantitative analysis, the expression level of SARS-CoV-2 nucleocapsid protein (CoV-N) in the brain tissue of the S@F-Baicalein combined treatment group of mice was significantly lower than that of the control group Figure 11 Bar graphs b, c). In addition, the combined treatment significantly down-regulated the mRNA expression of brain injury-related markers (Cxcl10, Ccl2 and Ccl5) Figure 11 Bar graphs d-f), suggesting that it has a protective effect on both direct neural injury and inflammation-mediated indirect injury caused by SARS-CoV-2 infection.

[0141] Experimental studies have shown that the covalent connection of viral RNA cleavage enzyme FEN1 and two specific hpDNA hairpin probes (targeting the coronavirus conserved genome and mouse Ctsl mRNA, respectively) to the surface of nanocarriers, combined with anti-inflammatory drugs, can construct a multi-modal nanomedicine system that exhibits significant coronavirus prevention and treatment effects. The gene therapy nasal drops constructed on this basis exhibit precise lung tissue targeting and enrichment characteristics after intranasal administration, and their mechanism of action has a dual synergistic effect: on the one hand, it directly inhibits viral replication and blocks the host cell invasion pathway through gene editing technology, and on the other hand, it effectively reduces the immune system's clearance of nanoparticles by taking advantage of the slow-release properties of baicalein, thereby significantly improving the drug internalization efficiency of lung epithelial cells. This innovative strategy of integrating gene therapy and chemotherapy provides a new technical path for the prevention and treatment of respiratory viral infections

[0142] The specific preparation process of the gene therapy nasal drops for preventing and / or treating coronavirus is as follows:

[0143] 1) Covalently link the composite nanomaterial carrier SCLMs to the target nucleic acid cleavage system (FEN1 + hpDNA) through click reaction to obtain a nanogene therapy drug solution:

[0144] The hpDNA hairpin probes used include two types of specific probes: one type targets the coronavirus conserved genome CoV-N gene mRNA, specifically including four probes: hp-CoV-N-1 (SEQ ID NO. 32), hp-CoV-N-2 (SEQ ID NO. 33), hp-CoV-N-3 (SEQ ID NO. 34), and hp-CoV-N-4 (SEQ ID NO. 35); the other type targets Ctsl mRNA, and the corresponding probe is hp-Ctsl-L2 (SEQ ID NO. 27).

[0145] 2) Preparation of baicalein inhalation suspension: ① Prepare the auxiliary solution: weigh 17 mg of sodium chloride, 0.56 mg of citric acid, 1.0 mg of sodium citrate, and 2 mg of polysorbate 80 (a surfactant that increases the infiltration of baicalein), and dissolve them in 2 mL of physiological saline to serve as the auxiliary solution; ② Weigh 0.5 g of micronized baicalein (using airflow pulverization, with powder D50 controlled at 1-5 μm), add 25 mL of the auxiliary solution, and disperse for 120 min under high shear to obtain a uniform suspension, resulting in a 20 mg / mL baicalein inhalation suspension;

[0146] 3) The gene therapy nasal drops are composed of two independent components: Reagent A is the nano-gene therapy drug solution prepared in step 1), and Reagent B is the forsythia suspending solution prepared in step 2), which are separately packaged and stored. When used, nasal instillation is performed separately, wherein the recommended administration dose of Reagent A is 10-100 mg / kg, and the recommended administration dose of Reagent B is 10-300 mg / kg. The two-component design enhances the therapeutic effect through synergistic effect, and at the same time provides flexible dose adjustment space to adapt to individualized treatment needs.

[0147] The above description is only an embodiment of the present application, and does not limit the patent scope of the present application. Any equivalent structure or equivalent process transformation using the content of the specification and drawings, or direct or indirect application in other related technical fields, is also included in the protection scope of the present application.

Claims

1. A gene therapy nasal drop for the prevention and / or treatment of coronaviruses, characterized in that, include: Reagent A: Nanogene therapy drug solution, which is formed by covalently linking a self-assembled composite nanomaterial carrier with a targeted nucleic acid cleavage system through a click chemistry reaction; Reagent B: Inhalable suspension or solution of anti-inflammatory chemical drugs; The targeted nucleic acid cleavage system includes: 1) Endonuclease molecule: having the nucleotide sequence shown in SEQ ID NO.2, the amino acid sequence encoded by which is shown in SEQ ID NO.3; 2) hpDNA oligonucleotide probe set: It consists of a target segment and a stem-loop structure segment. The target segment specifically binds to the mRNA of the coronavirus gene and the mRNA of the host gene.

2. A gene therapy nasal drop for the prevention and / or treatment of coronavirus as described in claim 1, characterized in that, When using these medications, reagent A and reagent B should be administered separately via nasal drops. The dosage of reagent A is 10-100 mg / kg, and the dosage of reagent B is 10-300 mg / kg.

3. The gene therapy nasal drops for the prevention and / or treatment of coronaviruses as described in claim 1, characterized in that, The hpDNA targets the mRNA sequence of at least one of the following genes: 1) Coronavirus genes: nucleocapsid protein gene, spike protein gene; 2) Host genes: cathepsin L, angiotensin-converting enzyme 2, transmembrane serine protease 2, RAS oncogene family member RAB7A, DEAD-box helicase 3X chromosome-associated protein, eukaryotic translation initiation factor 2α kinase 2.

4. The gene therapy nasal drops for the prevention and / or treatment of coronavirus as described in claim 3, characterized in that, The hpDNA oligonucleotide probe set specifically includes: (1) A probe set targeting coronavirus CoV-N gene mRNA, comprising the nucleotide sequences shown in SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34 and SEQ ID NO.35; (2) A probe targeting host CtslmRNA containing the nucleotide sequence shown in SEQ ID NO.

27.

5. The gene therapy nasal drops for the prevention and / or treatment of coronavirus as described in claim 1, characterized in that, The composite nanomaterial carrier is formed by self-assembly of the following components: (a) Alkoxysilane compounds: selected from tetraethyl silicate, dimethyldiethoxysilane or combinations thereof; (b) Ethylene oxide-propylene oxide-ethylene oxide triblock copolymers with a molecular weight of 14-16 kDa.

6. The gene therapy nasal drops for the prevention and / or treatment of coronavirus as described in claim 1, characterized in that, The anti-inflammatory chemical drug is any one or a combination of at least two of the following: quercetin, apigenin, genistein, kaempferol, rutin, baicalin, wogonin, isoglycyrrhizin, xanthohumol, resveratrol, and curcumin.

7. The gene therapy nasal drops for the prevention and / or treatment of coronavirus as described in claim 1, characterized in that, The solvent for the nasal drops is selected from any one or a mixture of at least two of the following: water, physiological saline, and ethanol with a mass concentration of 5%-25%.

8. A method for preparing a gene therapy nasal drop for the prevention and / or treatment of coronavirus as described in any one of claims 1-7, characterized in that, The specific preparation method is as follows: 1) Alkoxysilane compounds were mixed with ethylene oxide-propylene oxide-ethylene oxide triblock copolymers and self-assembled to obtain composite nanomaterial carriers; 2) The composite nanomaterial carrier and the targeted nucleic acid cutting system are covalently linked via click reaction to obtain a nanogene therapy drug solution; 3) To prepare inhalable suspensions or solutions of anti-inflammatory chemical drugs; 4) Use the nanogene therapy drug solution prepared in step 2) as reagent A, and the inhalable suspension or solution of the anti-inflammatory chemical drug prepared in step 3) as reagent B. Package them separately and administer them separately via nasal drops.

9. The method for preparing a gene therapy nasal drop for the prevention and / or treatment of coronavirus as described in claim 8, characterized in that, The targeted nucleic acid cleavage system includes endonuclease molecules and hpDNA oligonucleotide probes, with a molar ratio of endonuclease molecules to hpDNA oligonucleotide probes of 1:1 to 10.

10. The use of the gene therapy nasal drops as described in claim 1 in the preparation of a medicament for inhibiting coronavirus infection, characterized in that, The coronavirus is selected from at least one of the following: SARS virus, SARS-CoV-2 virus, MERS virus, its variants and mutant strains.

Images