Botrytis cinerea mitochondrial inner membrane Mic60 protein and application thereof

Abstract

The invention belongs to the technical field of agricultural biology, and particularly relates to botrytis cinerea mitochondrial inner membrane Mic60 protein and application thereof. The invention finds that the mitochondrial inner membrane gene Mic60 from botrytis cinerea can regulate and control the pathogenicity of the botrytis cinerea. The Mic60 protein can be degraded by combining with the Mic60 protein, so that the harm of pathogenic bacteria to plants is inhibited. Therefore, the Mic60 can be used as a bactericide target and a key protein of a disease pathogenic mechanism, and has a wide application prospect in prevention and control research of plant pathogenic fungal diseases and pesticide development.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of agricultural biotechnology, and in particular, the present application relates to a Botrytis cinerea mitochondrial inner membrane Mic60 protein and its application. BACKGROUND

[0002] Botrytis cinerea is a typical necrotrophic plant pathogenic fungus, which mainly invades through air transmission. The pathogen has a wide host range and can infect more than 1400 species of plants including cruciferous plants, solanaceous plants, chrysanthemum plants and leguminous plants, causing serious gray mold. Notably, B. cinerea has high genetic variability and population diversity, which makes gray mold one of the most widely distributed, most harmful and most difficult to control plant diseases. Currently, the long-term reliance on chemical control strategies targeting a single site has led to rapid development of drug resistance in pathogenic fungi, significantly reducing the control effect of existing fungicides. Therefore, it is urgent to identify new key pathogenic factors or growth and development regulatory factors to provide potential molecular targets for the development of new fungicides with high efficiency and low drug resistance risk.

[0003] The main bottleneck in current pesticide research and development is the severe shortage of available specific targets. According to statistics, of the 862 registered pesticides worldwide, only 52, 26 and 20 molecular targets correspond to antibacterial agents, insecticides and herbicides, respectively, according to the action target. Traditional broad-spectrum chemical pesticides not only have the problem of low utilization rate, about 99% of the applied pesticides cannot act on the target organisms, but also pose potential threats to the ecological environment and human health. Under the background of increasing demand for agricultural green development and ecological safety, it is imperative to develop new control strategies with high efficiency, low dosage, high selectivity, low cost and environmental friendliness. Natural products have become an important resource for green pesticide research and development due to their biodegradability, good environmental compatibility and unique action mechanism. Target identification and molecular design based on natural products can effectively expand the available target library and provide new ideas for solving the problem of drug resistance. By analyzing the three-dimensional structure information of target protein-small molecule complex, not only can it promote the rational design of targeted fungicides, but also will promote the deep integration of receptor structure biology and green pesticide research and development. This target-oriented pesticide innovation strategy not only meets the major needs of China's agricultural green development, but also provides a new solution for the sustainable management of plant diseases worldwide. SUMMARY

[0004] Mitochondrial inner membrane protein Mic60 is widely present in various organisms, including fungi, bacteria, protozoa and plants, and plays an important role in mitochondrial function. Through long-term research, the present application obtains a mitochondrial inner membrane gene (named BcMic60) from Botrytis cinerea, finds that it is related to the pathogenicity of Botrytis cinerea, thereby comprehensively understanding the pathogenic mechanism of Botrytis cinerea, providing important data for the prevention and control of Botrytis cinerea diseases and the research and development of fungicides, and thus completing the present application. The technical scheme of the present application is as follows: In a first aspect of the present application, the present application provides a mitochondrial inner membrane protein of Botrytis cinerea, which is derived from Botrytis cinerea and is named Mic60 in the present application. The nucleotide sequence of the protein gene is as shown in SEQ ID NO. 1 or SEQ ID NO. 2, and the encoded amino acid sequence is as shown in SEQ ID NO. 3.

[0005] In a second aspect of the present application, the present application provides the application of Mic60 gene, which includes: regulating the pathogenicity of Botrytis cinerea, regulating the sensitivity of Botrytis cinerea to triazole fungicides. By regulating the pathogenicity of Botrytis cinerea, the infection mechanism and mutual influence between Botrytis cinerea infection and plants can be studied.

[0006] In an embodiment, the application is to regulate the sensitivity of Botrytis cinerea to carbendazim and propiconazole.

[0007] In an embodiment, the pathogenicity of Botrytis cinerea is reduced and the sensitivity of Botrytis cinerea to carbendazim and propiconazole is reduced. After knocking out the Mic60 gene in Botrytis cinerea, the pathogenicity of Botrytis cinerea is reduced, and the sensitivity of Botrytis cinerea to carbendazim and propiconazole is also reduced.

[0008] In an embodiment, the Mic60 gene can be knocked out or silenced by gene editing or homologous recombination to obtain a transgenic Botrytis cinerea, which has reduced pathogenicity and reduced sensitivity to carbendazim and propiconazole.

[0009] In a third aspect of the present application, the Mic60 protein is used for designing and screening drugs against plant fungal diseases; preferably, the fungal disease is caused by Botrytis cinerea infection, and the Mic60 protein is encoded by the Mic60 gene.

[0010] In an embodiment, the drug is a triazole fungicide.

[0011] In an embodiment, it is found through bioinformatics and drug molecule docking analysis that the amino acids at positions D477, T518 and Q618 in the Mic60 protein are drug target binding sites.

[0012] In one embodiment, the present application provides the use of myclobutanil as a fungicide component in the prevention and treatment of diseases caused by Botrytis cinerea. The present application finds that myclobutanil interacts with Mic60 protein, and the two have strong binding affinity. The binding of myclobutanil and Mic60 protein makes Mic60 protein degrade, thereby achieving the inhibition of the damage of the pathogenic bacteria to the plants. Advantages

[0013] (1) The present application finds that the mitochondrial inner membrane gene Mic60 derived from Botrytis cinerea can regulate the pathogenicity of Botrytis cinerea.

[0014] (2) The present application finds that the binding with Mic60 protein can make Mic60 protein degrade, thereby inhibiting the damage of the pathogenic bacteria to the plants. Therefore, Mic60 can be used as a fungicide target and a key protein in the pathogenic mechanism of diseases, and has a wide application prospect in the prevention and treatment of plant pathogenic fungal diseases and the development of pesticides. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 The colony growth of Botrytis cinerea wild type B05.10 and ΔBcMic60 mutant on PDA plate; Figure 2 The pathogenicity of Botrytis cinerea wild type B05.10 and ΔBcMic60 mutant mycelium to tomato leaves; Figure 3 The sensitivity of Botrytis cinerea wild type B05.10 and ΔBcMic60 mutant to myclobutanil and propiconazole; Figure 4 The inhibition rate analysis diagram of myclobutanil, propiconazole and pyraclostrobin on Botrytis cinerea wild type B05.10 and ΔBcMic60 mutant; Figure 5 The BcMic60 overexpression strain is located in the mitochondria; Figure 6 Myclobutanil can promote the degradation of BcMic60 protein; Figure 7 The binding of myclobutanil and BcMic60 promotes the thermal stability of BcMic60 protein; Figure 8 The binding of myclobutanil and BcMic60 improves the resistance of BcMic60 to protease hydrolysis. DETAILED DESCRIPTION

[0016] In order to make the purpose, technical scheme and advantages of the present application more clear, the present application is further described in detail below with examples. The equipment and reagents used in each example and test example are commercially available unless otherwise specified. The reagents used in the present application are all analytical grade reagents. The specific examples described herein are only used to explain the present application and do not limit the present application.

[0017] Material source: The wild strain B05.10 of Botrytis cinerea in the present application was provided by the Fungus Laboratory of Qingdao Agricultural University. The genomic DNA sequence of the Mic60 gene in the strain is shown as SEQ ID No. 1, the CDS sequence is shown as SEQ ID No. 2, and the amino acid sequence of the Mic60 protein encoded by the gene is shown as SEQ ID No. 3. Sequence alignment shows that the gene belongs to the mitochondrial inner membrane gene.

[0018] Example 1: Obtaining of Botrytis cinerea gene knockout mutant ΔBcMic60 1.1. Construction of Botrytis cinerea BcMic60 knockout mutant After analysis and testing, the BcMic60 gene related information was obtained. The coding sequence (CDS) of the gene is 2001 bp long, and the sequence is shown as SEQ ID No. 2. The gene encodes 667 amino acids, and the amino acid sequence is shown as SEQ ID No. 3. The sequence of about 1000 bp upstream and downstream of the BcMic60 coding region was selected, and the genomic DNA of B05.10 was used as the template to amplify the upper and lower homologous arm fragments by PCR with primers BcMic60ko-LF-1 / BcMic60ko-LF-2 and BcMic60ko-RF-1 / BcMic60ko-RF-2, respectively. A 1346 bp hygromycin phosphotransferase gene (HPH) fragment was amplified from the vector pCX62 template. Then, the BcMic60 upper and lower homologous arm fragments and the hygromycin phosphotransferase gene (HPH) fragment obtained in the previous step were used as templates, and the HPH fragment and the upper and lower homologous arms were sequentially connected by Overlap PCR with primers BcMic60ko-LF / BcMic60ko-RF. Finally, a LF-HPH-RF fusion fragment with a size of about 3056 bp was obtained, which can be used for gene knockout. The primer sequences are as follows: BcMic60ko-LF-1: CGATTTAGTTACGGAGCAACC (SEQ ID No. 4) BcMic60ko-LF-2: GACCTCCACTAGCTCCAGCCAAGCCAAGCCGATGATAGAAACTAAAAGG (SEQ ID No. 5) BcMic60ko-RF-1 : ATAGAGTAGATGCCGACCGCGGGTTGGCGATGATTTAGTGCC (SEQ ID No. 6) BcMic60ko-RF-2: GAGGGATTTGAGAAGGAAGC (SEQ ID No. 7) BcMic60ko-LF: GCAGGACAGGAGAGATACAAG (SEQ ID No. 8) BcMic60ko-RF: GCAGGAGAATCAAGGTATTGG (SEQ ID No. 9)

[0019] 1.2 Obtaining of the BcMic60 knockout mutant of Botrytis cinerea BcMic60 gene was knocked out by PEG-mediated protoplast transformation technology. Spores of wild-type B. cinerea strain B05.10 cultured for about 5-7 days were collected, filtered and added to a 100 mL YEPD flask; 25°C, 180 rpm shaking incubation for 14-20 h; fresh mycelium was collected; washed with KCl buffer for 3 times; transferred to Lysing enzymes enzyme solution, 30°C, 120 rpm shaking incubation for 2-3 h; the enzyme solution was filtered into a new 50 ml centrifuge tube, 10°C, 5000 rpm centrifugation for 10 min; the supernatant was discarded, and the precipitate was washed with ice KCl buffer for 2 times; resuspended the precipitate with 1 mL STC buffer, 10°C, 5000 rpm centrifugation for 2 min; resuspended the precipitate in 800 uL STC buffer, added 200 ul SPTC solution dropwise, and inverted to mix; added 60-120 uL target gene, 5 uL 5mM spermidine solution, inverted gently several times, and mixed thoroughly; placed on ice for 30 min; added 500 uL SPTC solution, 25°C, dark for 20 min; the above mixture was added to a flask containing 20 mL SH buffer; 25°C, 120 rpm shaking incubation in the dark overnight; the protoplasts were added to the corresponding resistant 100 mL PDA medium with a suitable temperature, mixed, and poured into a 9 mm culture dish; 25°C, inverted culture for 3-4 d, and then a few mycelium blocks were picked from the plate and transferred to a CM plate containing the same resistance for further verification. The single colony was picked from the plate and inoculated on a new PDA plate containing hygromycin, which was the positive transformant. The transformant genome was extracted, and the presence of the target gene BcMic60 in the transformant was verified by PCR technology. The target gene could be detected in the wild-type strain B05.10, but the band replaced by homologous replacement was detected in the transformant, indicating that the BcMic60 gene was successfully knocked out.

[0020] Example 2: Growth and development and pathogenicity analysis of B. cinerea BcMic60 deletion strain The selected transformants were cultured on PDA medium without antibiotics, and the colony growth of the transformants was observed and counted, and the results are shown in Figure 1 After 3 days of culture, the colony diameter of the wild type (B05.10) was smaller than that of the BcMic60 deletion strain (ΔBcMic60).

[0021] The B. cinerea strains were cultured on PDA medium without antibiotics for about 3 days, and then the mycelium discs were punched on the edge of the colony with a puncher and added to the center of tomato leaves. The inoculated leaves were placed in a culture box and incubated at 25°C for 2 days. Then the leaves were photographed and the lesion diameters were measured. The results are shown in Figure 2 Figure 2. Among them, B05.10 can normally infect tomato leaves to form obvious lesions. The lesion diameters of the leaves infected by the knock-out transformant ABcMic60 are significantly smaller. This indicates that the pathogenicity of B. cinerea is significantly inhibited after the Mic60 gene is knocked out.

[0022] The wild type WT and knock-out mutant AMic60 of B. cinerea were inoculated on PDA medium with different fungicides, carbendazim (4 ug / mL), propiconazole (1 ug / mL) and pyraclostrobin (1 ug / mL), and incubated at 25°C in the dark. The colony diameters were measured by cross method at 4d, and the colony morphology was observed. Five replicates were set for each treatment. The results are shown in Figure 3 Figure 3 and Figure 4 The inhibition rates of carbendazim and propiconazole on the wild type of B. cinerea are significantly higher than those on the knock-out mutant ABcMic60, indicating that the knock-out of BcMic60 gene reduces the sensitivity of the strain to carbendazim and propiconazole.

[0023] Example 3: Obtaining of BcMic60 overexpression strain The complementation vector pYF11-BcMic60-GFP was constructed. First, the vector pYF11-GFP was linearized by restriction endonuclease Xho I, and the specific steps are described in the instruction manual of NEB company. The BcMic60 fragment with a size of 4500 bp was amplified from the genomic DNA of Guy11 using primers pYF11-BcMic60-F / pYF11BcMic60-R. The vector was transformed into the corresponding knock-out mutant by PEG-mediated protoplast transformation method, and the complementation transformants were preliminarily screened by blasticidin. Then, the complementation transformants were further determined by resistance, GFP fluorescence tag and related phenotypes. The results are shown in Figure 5 Figure 4. After staining with mitochondrial marker dye Mito-tracker, it was found that BcMic60 was located on the mitochondria.

[0024] pYF11-BcMic60-F: CCATCACATCACAATCGATCCAACCATGCTGCGAGTTGGTCTTCG (SEQ ID No. 10) pYF11-BcMic60-R: TACTTACCTCACCCTTGGAAACCATTTCAACTCTCAAACTTTGTAATC (SEQ ID No. 11)

[0025] Example 4. Test of BcMic60 degradation promoted by prochloraz BcMic60 overexpression strain was cultured on PDA plate for 7 days, and conidia were collected. The collected conidia were placed in liquid YEPD medium and cultured at 25°C on a shaker at 120 rpm for 48 hours. The germinated conidia were equally divided into two parts, one part was added with DMSO, and the other part was added with prochloraz. The culture was continued for 4 hours, and then the protein was extracted for Western blot detection using GFP antibody. As shown in Figure 6 , BcMic60 of the BcMic60-GFP strain added with prochloraz was degraded, while BcMic60 of the BcMic60-GFP strain added with DMSO was not degraded.

[0026] Example 5. Prochloraz can bind to BcMic60 5.1 CETSA verifies that prochloraz can bind to BcMic60 BcMic60 overexpression strain was cultured on PDA plate for 7 days, and conidia were collected. The collected conidia were placed in liquid YEPD medium and cultured at 25°C on a shaker at 120 rpm for 48 hours. The germinated conidia were equally divided into 10 parts, 5 parts were added with DMSO, and 5 parts were added with prochloraz. DMSO and prochloraz were placed at different temperatures (40°C, 44°C, 48°C, 52°C, 56°C, 60°C) respectively, and the culture was continued for 4 hours. Then the protein was extracted for Western blot detection. As shown in Figure 7 , with the increase of temperature, the amount of BcMic60 in the DMSO group gradually decreased, while prochloraz could increase the stability of the protein by forming a ligand protein complex with BcMic60, and significantly increased the thermal tolerance of BcMic60 in the temperature range tested (40-60°C). The results showed that compared with the control group, prochloraz increased the stability of BcMic60 with the increase of temperature. The above results showed that the CETSA experiment results further confirmed that prochloraz can directly target and bind to BcMic60 protein.

[0027] 5.2, DARTS verifies that prochloraz can bind to BcMic60 In order to further confirm whether BcMic60 is the direct action target of prochloraz, DARTS verification analysis was used. As shown in Figure 8As shown, after incubation of total protein of Botrytis cinerea with DMSO or 4 μg / mL myclobutanil, the BcMic60 protein treated with DMSO was significantly degraded with the increase of the concentration of chain protease E (0.25 mg / mL, 0.5 mg / mL, 1 mg / mL), while the BcMic60 protein treated with myclobutanil was increased with the increase of the concentration of chain protease E, and the protein level was significantly higher than that of the DMSO control group, and this effect was also proved to be dose-dependent. The above results show that the DARTS experiment results confirm that myclobutanil can directly target and bind to BcMic60 protein. Further, bioinformatics and drug molecule docking analysis found that the amino acids D477, T518 and Q618 in the Mic60 protein are the drug target binding sites.

[0028] The above is a further detailed description of the present application in combination with the specific embodiments, and cannot be considered as limiting the specific embodiments of the present application to these descriptions. For ordinary skilled persons in the technical field to which the present application belongs, without departing from the concept of the present application, a number of simple deductions or substitutions can be made, which should be considered as belonging to the protection scope determined by the claims submitted by the present application.

Claims

1. A mitochondrial inner membrane protein of *Botrytis cinerea*, characterized in that, The protein is derived from Botrytis cinerea and named Mic60. The nucleotide sequence of the protein gene is shown in SEQ ID NO. 1 or SEQ ID NO. 2, and the encoded amino acid sequence is shown in SEQ ID NO.

3.

2. The application of the *Botrytis cinerea* mitochondrial inner membrane protein according to claim 1, characterized in that, The application involves using the Mic60 protein gene to regulate the pathogenicity of Botrytis cinerea and its sensitivity to triazole fungicides.

3. The application according to claim 2, characterized in that, The regulation involved knocking out the Mic60 gene in Botrytis cinerea, which reduced the pathogenicity of the spores and decreased their sensitivity to cyazofamid and propiconazole.

4. The application according to claim 3, characterized in that, Transgenic Botrytis cinerea can be obtained by knocking out or silencing the Mic60 gene through gene editing or homologous recombination.

5. The use of the Mic60 protein, a mitochondrial inner membrane protein of *Botrytis cinerea* according to claim 1, in the design and screening of drugs against plant fungal diseases.

6. The application according to claim 5, characterized in that, The fungal disease is caused by infection with Staphylococcus aureus.

7. The application according to claim 5, characterized in that, The drug is a triazole fungicide.

8. In the application according to claim 6, amino acids T264, T265 and E306 of the Mic60 protein serve as drug target binding sites.

Images