Csarf4 gene, coding sequence and application thereof

Abstract

This invention discloses a gene for regulating the growth of Cymbidium goeringii. CsARF4 Its coding sequence and applications belong to the field of plant molecular biology. This invention's analysis revealed that... CsARF4 The highest expression was observed in the roots of Cymbidium goeringii; it was also observed at different flower development stages in Cymbidium goeringii. CsARF4 The expression trend is a gradual decrease; in the tissue parts of mature Cymbidium flowers, CsARF4 The expression is highest in the petals. This invention, through genetic engineering technology, discovered that the aforementioned gene regulating the growth and development of *Cymbidium goeringii* is overexpressed in *Cymbidium sinense*, altering plant growth traits, resulting in increased rhizomes and rapid growth. Therefore, this gene and its encoded protein can be used to study growth and development regulation pathways such as rhizome proliferation, increased budding rate, and promotion of rapid plant growth, as well as for improving growth traits.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology, specifically relating to a growth-regulating gene of Cymbidium goeringii. CsARF4 Its encoding sequence and applications. Background Technology

[0002] Auxin-responsive factor (ARF) genes play a central role in regulating plant bud proliferation, tillering, and rapid growth. Studies have shown that MONOPTEROS (MP, also known as ARF5) is a key transcription factor mediating auxin transcriptional responses, and MP expression is controlled by an auxin-dependent autoactivation mechanism. Locally active MP autonomously directs PIN1 polar noncellularly, promoting the formation of local auxin maxima and organogenesis. Furthermore, ARF genes finely regulate tillering by integrating a multi-hormone signaling network: on the one hand, they induce the expression of strigolactone synthesis genes (MAX3, MAX4) and activate downstream repressors BRC1 / TB1, indirectly inhibiting axillary bud germination; on the other hand, they inhibit the expression of the key cytokinin synthesis gene IPT, reducing cytokinin concentration in the axillary buds of the main stem. During rapid growth, tomato SlARF5 drives cell division and expansion by coordinating the auxin-gibberellin signaling pathway, while Arabidopsis thaliana AtARF3 directly binds to the AtIPT5 promoter to inhibit its expression, regulating new bud regeneration.

[0003] Orchids native to my country, particularly small-flowered terrestrial species, are collectively known as Chinese orchids (or Cymbidium goeringii), one of my country's ten traditional famous flowers. These orchids mainly include nine categories: Cymbidium sinense, Cymbidium faberi, Cymbidium faberi, Cymbidium ensifolium, Cymbidium kanran, Cymbidium sinense, and Cymbidium faberi. Most Chinese orchids have long growth cycles. Despite breakthroughs in tissue culture technology, the inherent characteristics of slow propagation and long growth cycles remain unresolved. From sowing to germination, sprouting, seedling formation, and rooting, it typically takes 2-3 years, resulting in a long production cycle and high costs. How to achieve rapid growth through genetic modification using modern molecular biotechnology has become a key issue for the industry's development. Summary of the Invention

[0004] In order to overcome the shortcomings and deficiencies of the existing technology, the purpose of this invention is to provide a Cymbidium goeringii growth regulating gene. CsARF4 Its encoding sequence and applications.

[0005] This invention overcomes the problems of long production cycles and high costs in traditional Cymbidium production. By using molecular biology methods, this invention explores gene resources that can be used to improve growth traits, thereby achieving rapid growth.

[0006] The objective of this invention is achieved through the following technical solution:

[0007] This invention provides a gene for regulating the growth of Cymbidium goeringii. CsARF4It is derived from Cymbidium sinense, a typical representative of Chinese orchids. Cymbidium sinense The cDNA was isolated from the leaves of the cultivar 'Xiao Xiang'. Its nucleotide sequence consists of 2043 bases, as shown in SEQ ID NO: 1, and it is named... CsARF4 .

[0008] A second objective of this invention is to provide a protein encoded by the aforementioned Cymbidium goeringii growth-regulating gene, consisting of 680 amino acid residues, as shown in SEQ ID NO: 2.

[0009] The third object of the present invention is to provide a product containing CsARF4 Gene expression cassettes, recombinant plant expression vectors, transforming bacteria, or transgenic materials.

[0010] The expression vector can be any binary vector that can be used for Agrobacterium-mediated transformation of plants or a vector that can be used for plant micro-projectile attack, such as the pCAMBIA series vectors, pBI series vectors, pBin series vectors, or Gateway™ series vectors. The present invention uses the overexpression vector pCAMBIA series plasmids.

[0011] The starting strain of the transforming bacteria is Agrobacterium; preferably Agrobacterium EHA105.

[0012] The fourth object of the present invention is to provide CsARF4 Genes, encoded proteins, containing CsARF4 The application of gene expression cassettes, recombinant plant expression vectors, transforming bacteria, or transgenic materials is one of the following applications:

[0013] (a) Application in improving Chinese orchid varieties;

[0014] (b) Applications in regulating plant growth;

[0015] Preferred, overexpression CsARF4 After the gene is introduced, it causes the plant to proliferate rapidly and sprout, increasing the sprouting rate.

[0016] Preferably, the plant is Cymbidium goeringii, and more preferably Cymbidium sinense.

[0017] The fifth object of the present invention is to provide a method for promoting plant growth, comprising the following steps: [The text abruptly ends here, likely due to an incomplete sentence or missing information.] CsARF4 Genes are introduced into plant cells, tissues, or organs, and then the transformed plant cells, tissues, or organs are cultivated into plants, enabling the aforementioned... CsARF4 Genes are expressed in plants to achieve rapid plant proliferation and budding, and / or increase the budding rate. More preferably, the... CsARF4 It is introduced into plant cells, tissues or organs through plant expression vectors.

[0018] Preferably, the plant is Cymbidium goeringii, and more preferably Cymbidium sinense.

[0019] This invention, through genetic engineering technology, discovered that the growth and development regulatory gene of Cymbidium goeringii is overexpressed in Cymbidium sinense, which can alter plant growth traits, resulting in increased rhizomes and rapid growth. Therefore, this gene and its encoded protein can be used to study growth and development regulation pathways such as rhizome proliferation, increased budding rate, and promotion of rapid plant growth, as well as for the improvement of growth traits.

[0020] The present invention has the following advantages and effects compared with the prior art:

[0021] This invention isolates key growth genes from the flower bud cDNA of the Cymbidium sinense cultivar 'Xiao Xiang'. ARF4 and named CsARF4 Spatiotemporal expression pattern analysis revealed that, CsARF4 The highest expression was observed in the roots of Cymbidium goeringii; it was also observed at different flower development stages in Cymbidium goeringii. CsARF4 The expression trend is a gradual decrease; in the tissue parts of mature Cymbidium flowers, CsARF4 Expression was highest in petals. In Cymbidium orchids, transient overexpression was observed to accelerate rhizome proliferation, increase budding rate, and promote rapid plant growth. Attached Figure Description

[0022] Figure 1 In Embodiment 1 of the present invention, CsARF4 Gene homologous sequence alignment.

[0023] Figure 2 In Embodiment 1 of the present invention, CsARF4 Phylogenetic analysis of proteins.

[0024] Figure 3 In Embodiment 2 of the present invention, CsARF4 Expression pattern analysis in different organs of *Cymbidium goeringii*; where A: phenotypes of different organs; B: CsARF4 Expression level analysis chart.

[0025] Figure 4 In Embodiment 2 of the present invention, CsARF4 Expression pattern analysis at different flower development stages of Cymbidium goeringii; where A: phenotypes at different flower development stages S1–S5; B: CsARF4 Expression level analysis chart.

[0026] Figure 5 In Embodiment 2 of the present invention, CsARF4 Analysis of expression patterns in different floral tissues of Cymbidium goeringii; where A: phenotypes of different floral tissues; B: CsARF4 Expression level analysis chart.

[0027] Figure 6In embodiment 3 of the present invention, CsARF4 Screening and phenotypic analysis of transgenic Cymbidium goeringii. Note: A: Schematic diagram of Cymbidium goeringii transient overexpression recombinant vector; B: CsARF4 Transgenic Cymbidium goeringii PCR screening and identification; C: CsARF4 Expression level detection of transgenic Cymbidium goeringii; D: CsARF4 Statistical analysis of the number of shoots emerging from transgenic rhizomes; E: CsARF4 Statistics on the germination days of transgenic rhizomes; F: CsARF4 Phenotypes that promote rhizome proliferation and budding in transgenic Cymbidium goeringii. Detailed Implementation

[0028] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the embodiments described in this specification are merely for explaining the invention and are not intended to limit the invention. The parameters, proportions, etc., of the embodiments can be selected according to local conditions without substantially affecting the results.

[0029] Example 1 CsARF4 Gene cloning and sequence analysis

[0030] 1. RNA extraction

[0031] Take 2g of tender leaves of the Cymbidium goeringii cultivar 'Xiao Xiang', extract total RNA using the "Fastpure Universal Plant Total RNA Isolation Kit", and reverse transcribe it into cDNA (HiScript III 1st Strand cDNASynthesis Kit (+gDNA wiper)).

[0032] 2. Target gene CsARF4 The acquisition

[0033] by CsARF4 -F(SEQ ID NO:3,ATGGCAATCGATCTGAATACGGT) and CsARF4-R (SEQ ID NO: 4, TTAGAGAGAAAACTCGAGCTTTCC) was used as the primer. Using the cDNA obtained in the previous step as a template, PCR was performed using a high-fidelity enzyme (2x PhantaFlash Master Mix (Dye Plus)) under the following conditions: 95℃ for 30 seconds, then 35 cycles (95℃ for 10 seconds, 58℃ for 5 seconds, 72℃ for 5 seconds), and finally 72℃ for 10 minutes. The PCR product was detected by agarose gel electrophoresis, showing a clear and single band, approximately 2000 bp in size. The target band was excised and recovered, and the recovered product was ligated into a cloning vector (5 min TA / Blunt-Zero Cloning Kit) and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Sequencing analysis revealed that the amplified fragment contained the target gene. CsARF4 The complete CDS sequence, consisting of 2043 bases, is shown in SEQ ID NO: 1, and is named the Cymbidium goeringii growth regulatory gene. CsARF4 Genes, using SnapGene software CsARF4 The nucleotide sequence was translated into a protein sequence (as shown in SEQ ID NO: 2), which encodes a protein with an amino acid sequence of 680 amino acid residues, named the *Cymbidium goeringii* growth regulatory protein CsARF4. The obtained protein contains... CsARF4 The Escherichia coli is currently preserved at the Institute of Environmental Horticulture, Guangdong Academy of Agricultural Sciences.

[0034] 3. CsARF4 Gene sequence analysis

[0035] Analysis of the conserved domains of the CsARF4 protein using the Conserved Domain Search function in the NCBI database revealed that CsARF4 possesses typical domains of the ARF gene family, mainly including three key regions: the DNA-binding domain (DBD), the middle region (MR), and the dimerization domain (C-Terminal Domain, CTD).

[0036] Ink Orchid CsARF4 The gene was searched for homologous sequences in NCBI, and the coding amino acids of the homologous sequences were compared using the MEGA software. Figure 1 ), and construct an evolutionary tree ( Figure 2 The results showed that... CsARF4It shares 75.74% homology with *Dendrobium nobile* XP_020700958.1, 75.18% homology with *Dendrobium chrysanthum* KAH0468493.1, 72.35% homology with *Dendrobium chrysanthum* KAI0524417.1, 61.12% homology with *Cymbidium trifurcation* WHN37866.1, and 62.08% homology with *Phalaenopsis davidii* XP_020595811.1. It shares 60.29% homology with Dendrobium nobile KAL0906146.1, 59.42% homology with Orchidia shenzhenensis PKA59100.1, 60.84% ​​homology with Orchidia purpurea KAK8955021.1, 58.61% homology with Oncidium fanleaf WDA53371.1, and 58.17% homology with Vanilla beetle KAG0454553.1.

[0037] The phylogenetic results show that CsARF4 clusters together with orchids due to their close kinship.

[0038] Example 2 CsARF4 Expression patterns in the Mexican

[0039] 1. RNA extraction

[0040] Two g samples were taken from different organs (roots, stems, leaves, flowers, and fruits), different flower development stages (S1-S5), and different tissue parts (sepia, petals, lip, and column) of the Cymbidium goeringii cultivar 'Xiao Xiang'. Total RNA was extracted from these samples using the plant "Fastpure Universal Plant Total RNA Isolation Kit". Two μL of the extracted RNA was reverse transcribed into cDNA using the ThermoScientific RevertAid First Strand cDNASynthesis Kit.

[0041] 2. Quantitative PCR

[0042] Using primers CsARF4 -RT-F (SEQ ID NO: 5, GCTGAGGATTGCGACTTGTCTG) and CsARF4 -RT-R (SEQ ID NO: 6, TGCTGCGTGTGTGGATGGAA) was used to detect different organs, different flower development stages, and different tissue parts of mature flowers in Cymbidium goeringii. CsARF4 Gene expression levels were detected using real-time quantitative PCR. CsActin -RT-F (SEQ ID NO: 7, CAATGAGCTTCGTGTTGCCC) and CsActin-RT-R (SEQ ID NO: 8, GATACGAACCAGTTGTGCGG) was used as primer, and Actin was amplified as an internal control. The following procedure was followed: pre-denaturation at 95℃ for 30 seconds, followed by 40 cycles (95℃ for 10 seconds, 60℃ for 30 seconds, 95℃ for 15 seconds), and extension at 72℃ for 10 minutes. Amplification was performed using the iCycler IQ Real-time PCR Detection System (Bio-Rad, USA), following the instructions for the Taq Pro Universal SYBR qPCR Master Mix kit.

[0043] 3. Expression Analysis

[0044] The PCR results were analyzed using iCycler real-time detection system software (version 7.0). The results showed... CsARF4 The gene was expressed most highly in the roots of Cymbidium goeringii, followed by the stem. Figure 3 ); in different stages of the development of Cymbidium goeringii, CsARF4 Expression was concentrated in the early stages of flower development, with the highest expression level in S1, followed by a gradual decrease, and reaching its lowest level in S5. Figure 4 In different floral tissues of Cymbidium goeringii, CsARF4 The highest expression was observed in the petals, and the lowest in the column. Figure 5 ).

[0045] Example 3: In Cymbidium goeringii CsARF4 Gene functional analysis

[0046] 1. Construction of a transient overexpression vector for Cymbidium goeringii

[0047] The overexpression vector 35S3301-RUBY was double-digested (NcoI and BstEII restriction sites, Takara Bio Engineering (Dalian) Co., Ltd.), and the resulting linear vector was purified. Based on the sequence of the double restriction sites, a design was developed. CsARF4 Homologous recombination primers that are seamlessly linked to pCAMBIA3301 CsARF4 -pCAM3301-F (SEQ ID NO: 9, acgggggactcttgaccatggATGGCAATCGATCTGAATACGG) and CsARF4The target fragment was obtained by recovering and purifying pCAM3301-R (SEQ ID NO: 10, ggggaaattcgagctggtcaccTTAGAGAGAAAACTCGAGCTTTCCC). Homologous recombination of the linear vector and the target fragment was performed using the CloneExpressUltraOneStepClosing Kit. After sequencing verification, the plasmid was named pCAMBIA3301-CsARF4.

[0048] The starting vector for vector 35S3301-RUBY is pCAMBIA3301 vector; vector 35S3301-RUBY is disclosed in the literature “CN120173950A, A promoter and its application in orchid plants”.

[0049] 2. Transformation of Cymbidium goeringii plants

[0050] 2.1 Transformation of Agrobacterium EHA105

[0051] Competent Agrobacterium EHA105 cells were removed from a -80℃ freezer and thawed on ice. After 5 min, 1 µL of pCAMBIA3301-CsARF4 plasmid was added, followed by incubation on ice for 5 min, in liquid nitrogen for 5 min, in a 37℃ water bath for 5 min, and in an ice bath for 5 min. Then, 700 μL of antibiotic-free LB medium was added to a clean bench and mixed thoroughly by pipetting. The mixture was then incubated at 28℃ and 200 rpm in a shaking incubator. After 2 h, the cells were collected by centrifugation (5000 rpm, 1 min). The supernatant was removed in a clean bench, and the remaining approximately 100 μL of bacterial culture was spread onto LB solid medium containing Kana+Rif antibiotics and incubated upside down at 28℃ for 2-3 days. Similarly, the empty vector control pCAMBIA3301 and the labeled control 35S3301-RUBY plasmid were transformed into Agrobacterium using the same method.

[0052] Two days later, single colonies were picked and transferred to LB medium containing 50 mg / L Kan and 25 mg / L Rif antibiotics. The culture was incubated at 28°C and 200 rpm for one day. 50 µL of the correct bacterial culture was then transferred to 50 mL of LB medium containing 50 mg / L Kan antibiotics and incubated at 28°C and 200 rpm until the OD value reached 1.0–1.2. The bacterial culture was centrifuged at 4°C (5000 rpm, 7 min), the supernatant was discarded, and the bacterial clumps were collected. The culture was then resuspended and diluted with a buffer containing 100 mol / L MES, 100 mol / L MgCl2, and 200 μmol / L AS (acetylsyleugenol) to the appropriate OD value. 600 All values ​​are 0.8. Let stand at room temperature for 5-6 hours before use.

[0053] 2.2 Agrobacterium infection of Cymbidium rhizomes

[0054] Rhizomes of *Cymbidium goeringii* were placed in 250 mL sterile Erlenmeyer flasks, and approximately 100 mL of *Agrobacterium* infection solution was added. Using a vacuum negative pressure method, robust *Cymbidium* rhizomes were infected with *Agrobacterium* resuspension containing the empty vector control pCAMBIA3301, the labeled control 35S3301-RUBY, and the experimental group pCAMBIA3301-CsARF4, respectively, to obtain transgenic *Cymbidium goeringii* rhizomes, designated as the empty vector group (Empty-vetor), the labeled group (Ruby), and the experimental group (35S:...). CsARF4 -OE).

[0055] 2.3 Agrobacterium infection of Cymbidium rhizomes and co-culture

[0056] Remove the rhizomes of Cymbidium goeringii, absorb the surface solution with sterile filter paper, and dry them under a clean bench for about 15 minutes. Place them on a co-culture medium and incubate in the dark at 28°C for two days.

[0057] 2.4 Recovery and Screening Culture of Positive Adventitious Buds of Cymbidium goeringii

[0058] After two days of cultivation, the rhizomes were washed in a sterile solution, then rinsed with sterile water, dried, and then cultured in recovery medium (½ MS + 0.1 mg / L NAA + 4 mg / L 6-benzylaminopurine (6-BA) + 0.6% (w / v) agar, pH 5.4) for 14 days. After that, they were cultured in selection medium (½ MS + 0.1 mg / L NAA + 4 mg / L 6-benzylaminopurine (6-BA) + 0.6% (w / v) agar + 500 mg / L cefotaxime + 0.5 mg / L glutfosinate-ammonium, pH 5.4) for about 15 days.

[0059] 2.5 Phenotypic Observation

[0060] Weekly observations were conducted, and newly sprouted buds were selected from the infected rhizomes. The experimental group showed an increase in the number of newly sprouted buds. These results indicate that the transient overexpression vector can function normally within the Cymbidium orchid plant.

[0061] 2.6 Detection of transient gene overexpression effects

[0062] DNA was extracted from the rhizomes of the transgenic plants, and gene overexpression was examined using primers pCAM3301-F (SEQ ID No: 11, GAGAACACGGGGGACTCTTG) and pCAM3301-R (SEQ ID No: 12, TAATCATCGCAAGACCGGCA). Rhizomes of the empty vector control pCAMBIA3301 and the labeled control 35S3301-RUBY were used as controls. PCR products were added to the wells of a gel for electrophoresis. If a DNA band of the expected size was observed, the plant was identified as a positive plant, indicating that the target DNA fragment had been successfully inserted into the plant genome. Three transgenic positive lines (35S: CsARF4 -OE1#、35S: CsARF4 -OE2#、35S: CsARF4 -OE3#) Plant PCR product and expression level detection, etc. RNA was extracted from transgenic rhizomes and analyzed using primers. CsARF4 -RT-F and CsARF4 -RT-R was used to perform real-time quantitative PCR detection of the transient overexpression effect of the recombinant expression vector on CsARF4 expression level in Cymbidium goeringii. The PCR detection method and analysis are as described in Example 2. CsARF4 expression was obtained using... Actin -RT-F and Cs -RT-R was used as a primer, and Actin was used as an internal control for amplification.

[0063] Studies have found that using Ruby marker genes and Agrobacterium-mediated transient overexpression technology, the expression of Ruby marker genes in Orchid rhizomes can be effectively controlled. Actin Overexpression was performed, with the empty vector control pCAMBIA3301 and the labeled control 35S3301-RUBY as controls. Phenotypic results were recorded after one week, and the phenotypes observed after 30 days of treatment showed that pCAMBIA3301- CsARF4 The number of newly sprouted buds from the rhizomes increased in the experimental group. CsARF4 (D and F in the text); and the bud germination time was significantly earlier than that of the empty control and the marker control, about 7 days earlier (in the text). Figure 6 (E in the text). Subsequently, PCR detection confirmed that the target gene had been successfully introduced into the plant. Figure 6 (B in the text), and furthermore, through qRT-PCR detection results, we found that at 35S: Figure 6 In -OE plants, the expression level of CsARF4 was significantly upregulated, more than 1.8-fold. CsARF4 Figure 6 (C in the text). Therefore, we hypothesize that CsARF4 may be involved in regulating the rapid proliferation and budding of Cymbidium rhizomes.

[0064] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. CsARF4, a growth regulatory protein of Cymbidium goeringii, is characterized by: Its amino acid sequence is shown in SEQ ID NO:

2.

2. A Cymbidium growth regulatory gene encoding the Cymbidium growth regulatory protein CsARF4 as described in claim 1. CsARF4 .

3. The Cymbidium goeringii growth regulating gene according to claim 2 CsARF4 Its features are: Its nucleotide sequence is shown in SEQ ID NO:

1.

4. The biomaterial related to the Cymbidium goeringii growth regulatory protein CsARF4 as described in claim 1, characterized in that, It can be any one or more combinations of the following biological materials: (1) Contains the gene described in claim 2 or 3 CsARF4 The expression box; (2) Contains the gene described in claim 2 or 3 CsARF4 Recombinant plant expression vectors; (3) A recombinant plant expression vector containing the expression cassette described in (1); (4) Contains the gene described in claim 2 or 3 CsARF4 Transforming bacteria; (5) Transforming bacteria containing the expression cassette described in (1); (6) Transforming bacteria containing the recombinant plant expression vector described in (2) or (3).

5. The biomaterial according to claim 4, characterized in that: The originating bacteria of the transforming bacteria is Agrobacterium.

6. The Cymbidium goeringii growth regulatory protein CsARF4 as described in claim 1, and the Cymbidium goeringii growth regulatory gene as described in any one of claims 2 to 3. CsARF4 Or the application of the biomaterials described in any one of claims 4 to 5 in the improvement of Cymbidium varieties, characterized in that: overexpression CsARF4 After the gene was introduced, it caused Cymbidium goeringii to proliferate and sprout rapidly, increasing the sprouting rate.

7. The Cymbidium goeringii growth regulatory protein CsARF4 as described in claim 1, and the Cymbidium goeringii growth regulatory gene as described in any one of claims 2 to 3. CsARF4 Or the application of the biomaterial according to any one of claims 4 to 5 in regulating the growth of Cymbidium goeringii, characterized in that: overexpression CsARF4 After the gene was introduced, it caused Cymbidium goeringii to proliferate and sprout rapidly, increasing the sprouting rate.

8. A method for promoting plant growth, characterized in that, Includes the following steps: taking the gene according to any one of claims 2 to 3 CsARF4 The transformed plant cells, tissues, or organs are introduced and then cultured into plants, allowing the genes to be transferred. CsARF4 Overexpression in plants to achieve rapid plant proliferation and budding and / or increase plant budding rate; the plant is Cymbidium goeringii.

Images