Saccharomyces cerevisiae INM3205 with high yield of vitamin B6 and application thereof

Abstract

The invention provides saccharomyces cerevisiae INM3205 with high yield of vitamin B6 and application of the saccharomyces cerevisiae INM3205, the strain is saccharomyces cerevisiae INM3205, the strain is preserved in the Guangdong Microbial Culture Collection Center on July 16, 2025, the preservation number is GDMCC No: 66697, and the preservation address is the fifth floor, No. 59 building, No. 100 Courtyard, Xianlie Middle Road, Guangzhou City, Guangdong Province. The method has the advantages that the method has the capability of generating a flavor substance 2, 4-decadienal, so that the baked product is richer in flavor during the storage period.

Description

Technical Field

[0001] This invention relates to a high-vitamin B6-producing brewer's yeast strain INM3205 and its applications. Background Technology

[0002] Saccharomyces cerevisiae was the first eukaryote to have its genome sequenced, with the sequencing completed in 1996. It is also one of the most commonly used fermentation organisms. Saccharomyces cerevisiae possesses advantages such as a short growth cycle, strong fermentation capacity, ease of large-scale cultivation, and rich nutritional components including various proteins, amino acids, vitamins, and bioactive substances. It has long been a primary subject of basic and applied research and has wide applications in the food and pharmaceutical industries. Saccharomyces cerevisiae is also used for the fermentation of other industrially valuable metabolites.

[0003] Vitamin B6, also known as pyridoxine, is an important water-soluble B vitamin. It exists in the body in the forms of pyridoxine (PN), pyridoxal (PL), pyridoxamine (PM), pyridoxine phosphate (PLP), pyridoxal phosphate (PNP), and pyridoxamine phosphate (PMP), participating in key biochemical processes such as amino acid metabolism and neurotransmitter synthesis. It is an essential micronutrient for maintaining healthy growth and normal physiological functions, possessing anti-inflammatory, antioxidant, neuromodulatory, and anti-tumor physiological functions, and is crucial for maintaining a healthy nervous system, healthy skin, and immune function.

[0004] 2,4-Decanadienal possesses a strong lipophilic, green, and citrus aroma. It has a boiling point of 104℃ [933 Pa (7 mmHg)], a flash point above 100℃, and is soluble in ethanol and most non-volatile oils, but insoluble in water. It is naturally found in orange peel, bitter orange, lemon, strawberry, and roasted chicken. It is a yellow to pale orange translucent liquid, belonging to both natural and artificial flavorings, primarily used in the formulation of chicken flavorings, and in potato chips, fried foods, and spicy foods. my country's food additive standard GB2760-2014 stipulates that 2,4-decadienal can be used as a synthetic flavoring agent for food.

[0005] Currently, research on vitamin B6 is diverse. Patent CN1153823, "Fermentation Production of Vitamin B6," discloses a method for producing vitamin B6, including culturing microorganisms belonging to the Rhizobium genus that can produce vitamin B6 in a culture medium under aerobic conditions. The strains used in this patent do not belong to the Yeast genus. Patent CN1232875, "Enzymatic Production of Vitamin B6," provides high yields of vitamin B6 essential for animal, plant, and microbial nutrition and usable as a pharmaceutical or food additive; the strains used include Yeast. However, the synthesis reaction in this patent involves various chemical substrates, and direct addition of the produced vitamin B6 to food may cause unpleasant flavors to the final product; furthermore, the patent does not mention the production of aroma compounds. Patent CN109757427A, "A Method for Producing Eggs High in Vitamin B6," discloses a method for producing eggs high in vitamin B6, but does not involve the application of vitamin B6 in baked goods. Patent: A method for determining the content of vitamin B6 in food - CN109060991A. This invention discloses a method for determining the content of vitamin B6 in food. Currently, no patents involve the application of 2,4-decadienal in the field of baked goods.

[0006] The above patents focus on product nutrition, covering vitamin B6 preparation, vitamin B6 detection, and product applications of vitamin B6. However, they neglect the enhancement of nutritional components and flavor in baked goods. Dough fermentation, involving yeast and lactic acid bacteria, produces acidic substances, and organic acids strongly influence the overall flavor structure of the product. Therefore, in product development, considering both flavor and nutrition will better cater to the market. Research shows that the physiological function of vitamin B6 mainly involves transamination, decarboxylation, mesoamylation of amino groups, and the metabolism of tryptophan and unsaturated fatty acids in the form of coenzymes. Vitamin B6 is readily soluble in water and alcohol, and slightly soluble in lipid solvents. In acidic solutions, all three types of vitamin B6 are relatively heat-stable, but pyridoxal is easily destroyed by heating in alkaline solutions. In solution, all three types of vitamin B6 are sensitive to light, with ultraviolet radiation causing significant damage.

[0007] 1) Adding vitamin B6 alone can negatively impact the texture of bread; 2) The extraction of vitamin B6 involves chemical solvents, which consumers find objectionable. These factors directly affect consumer acceptance of the product. Therefore, it is necessary to develop a strain that can produce vitamin B6 while simultaneously harmonizing the flavor. Summary of the Invention

[0008] To address the above problems, this invention provides a high-vitamin B6-producing brewer's yeast strain INM3205 and its applications.

[0009] The objective of this invention is achieved through the following method: a high-vitamin B6-producing strain of *Saccharomyces cerevisiae*, wherein the strain is *Saccharomyces cerevisiae* (…). Saccharomyces cerevisiaeThe strain INM3205 was deposited on July 16, 2025, at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No:66697, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province.

[0010] Application of a high-vitamin B6-producing brewer's yeast in dough.

[0011] Application of a high-vitamin B6-producing brewing yeast: Following the bread-making process, add brewing yeast... (Saccharomyces cerevisiae) Fermentation liquid.

[0012] A fermentation agent prepared from a high-vitamin B6-producing brewing yeast.

[0013] Advantages of the present invention: (1) The brewing yeast (Saccharomyces cerevisia) has the ability to produce flavor substance 2,4-decadienal, which can effectively increase the content of 2,4-decadienal after fermentation of sourdough, making the baked goods more flavorful during storage.

[0014] (2) The brewing yeast (Saccharomyces cerevisia) of the present invention has the ability to increase the vitamin B6 content of bread, effectively increase the vitamin B6 content of bread after baking, improve the nutritional value of bread, and make the nutritional components of baked products more comprehensive.

[0015] (3) The brewing yeast (Saccharomyces cerevisia) described in this invention has the characteristic of improving the aroma and taste of the product. Attached Figure Description

[0016] Figure 1 10 7 Total ion chromatogram of methylthiopropionaldehyde for bread making at the inoculation concentration.

[0017] Figure 2 For brewing yeast ( Saccharomyces cerevisiae (Diagram of culture medium morphology)

[0018] Figure 3 For brewing yeast ( Saccharomyces cerevisiae Gram staining microscopic image. Detailed Implementation

[0019] The present invention will be further described below with reference to specific embodiments: Unless otherwise specified, the experimental methods used in the following implementation examples are all conventional methods; the materials and reagents used are all commercially available unless otherwise specified.

[0020] Example 1, see attached document Figure 1-3 A high-vitamin B6-producing strain of *Saccharomyces cerevisiae*, strain of which is *Saccharomyces cerevisiae* (Saccharomyces cerevisiae). Saccharomyces cerevisiae The strain INM3205 was deposited on July 16, 2025, at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No:66697, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province.

[0021] By fermenting flour with this bacterium to create sourdough and a low pH environment, it not only contains abundant vitamin B6, but also, when added to dough, has no adverse effect on gluten formation. The resulting bread exhibits excellent sensory evaluation and stable vitamin B6 content during storage. It achieves a perfect balance between nutritional value and sensory appeal without affecting the product's internal structure.

[0022] Application of a high-vitamin B6-producing brewer's yeast in dough.

[0023] A fermentation agent prepared from a high-vitamin B6-producing brewing yeast.

[0024] Application of a high-vitamin B6-producing brewing yeast: According to the bread-making process, fermentation liquid fermented with brewing yeast (Saccharomyces cerevisiae) for 48 hours was added, with the addition amount being 10% of the total wheat content. The content of vitamin B6, 2,4-decadienal, and bread taste were tested.

[0025] Experimental steps: 1. Raw material processing Take 100g of flour and add 100g of purified water to make a sourdough dough. Let it ferment at 28℃ for 48 hours. Dilute the sourdough dough by 10... 1 -10 7 The bacterial suspension was evenly spread on PDA medium and the colony morphology was observed. Colonies with different morphologies were picked out and further isolated and purified on PDA, numbered S1-S10. The flour was Xiangxue Japanese bread flour (bread wheat flour), purchased from COFCO International (Beijing) Co., Ltd.

[0026] 2. Preliminary screening of bacterial strains The 10 bacterial strains were inoculated into malt extract medium at a 1% inoculum concentration and cultured at 28°C for 48 hours. The final bacterial cell density reached 10⁻⁶. 7 CFU / mL. Bacterial culture was taken from each tube and inoculated into sourdough at a 1% inoculum concentration. After incubation at 28℃ for 48 h, the mixture was centrifuged at 8000 r / min for 10 min, and the supernatant was used as the sample for physicochemical analysis. The results are shown in Table 1.

[0027] Vitamin B6 content: 1) Standard preparation: Accurately weigh 0.010 g of vitamin B6 reference standard into a 50 mL volumetric flask, dissolve and dilute to the mark with the mobile phase, and shake well to prepare the reference standard stock solution; prepare standard working solutions of 0.05, 0.1, 0.2, 0.5, and 1.0 μg / 100 g using vitamin B6 standard for determination.

[0028] 2) Sample preparation: Accurately weigh 1g of sample into a 100mL volumetric flask, add 0.01mol / L hydrochloric acid solution (containing 0.1% metaphosphoric acid by mass) to dilute to the mark, shake well, and filter to obtain the sample.

[0029] 3) Chromatographic column: Waters C18 (4.6mm×250mm, 5μm), detection wavelength: 274nm, flow rate: 1.0mL / min, mobile phase: acetonitrile-sodium heptanesulfonate solution (0.32g sodium heptanesulfonate, dissolved in 800mL water, 2mL triethylamine, 10mL glacial acetic acid, diluted with water to 1000mL) (volume ratio 7:93), column temperature: 40℃, injection volume: 10μL.

[0030] 2,4-Decadienal content: The extraction method used was a 50 / 30µm, DVB / CAR / PDMS, Stableflex solid-phase microextraction head. 5g of sample was placed in a 30mL headspace vial and extracted in a 60℃ water bath for 40min.

[0031] Gas chromatography-mass spectrometry (GC-MS) was used for detection, employing an HP-Innowax (30 m × 250 μm, 0.25 μm) capillary column.

[0032] The GC conditions were as follows: helium was used as the carrier gas, the carrier gas flow rate was set to 1 mL / min, splitless injection was performed, and the injection port temperature was 250℃.

[0033] MS conditions were: ion source temperature 230℃, MS quadrupole temperature 150℃, electron energy 70eV, mass spectrometry scan range 15~500, and full scan mode.

[0034] The column oven heating program is as follows: hold at 43℃ for 0 min, increase to 150℃ at 10℃ / min, then increase to 230℃ at 5℃ / min and hold for 0 min.

[0035] Table 1. Analysis of Vitamin B6 and 2,4-decadienal produced during fermentation

[0036] Compounds were identified using a mass spectrometry database method. Each peak was compared to the NIST Library mass spectrometry database using a computer, and a match greater than 800 was used as the qualitative criterion. Internal standard quantification method: A certain amount of 2,4-decadienal standard was accurately added to an ethanol solution to form standard solutions of 0, 20, 40, 60, 80, and 100 μg / 100g. The content of 2,4-decadienal was calculated based on the peak area ratio.

[0037] Strains S4, S7, and S10, which have low pH and high levels of vitamin B6 and 2,4-decadienal, were selected for secondary screening.

[0038] 3. Secondary screening of strains The three yeast strains S4, S7, and S10 selected in the initial screening were reactivated and cultured until the cell concentration reached 10⁻⁶. 7 At a concentration of CFU / mL, 1% of the starter dough was inoculated into the sourdough starter and fermented at 28°C for 48 hours. The fermented sourdough starter was then added to the starter dough at 10% of the total wheat content. Bread was made according to the national standard GB / T 14612-2008, and sensory evaluation and vitamin B6 content testing were conducted. The results are shown in Table 2.

[0039] Table 2 Sensory analysis and hardness of fermented bread

[0040] As shown in Table 2, bread made from S10 had the highest average sensory score and the highest vitamin B6 content. As the target strain, the morphological observation of this strain on PDA plates is as follows: Figure 2 As shown, the colonies are 1.0–5.0 mm in diameter, white, oval, with a smooth, moist, raised surface and regular edges. Gram staining followed by microscopic observation yields the following results: Figure 3 As shown.

[0041] The S10 strain obtained from the above screening was identified by 16S rDNA sequencing. Comparative analysis showed that the 16S region sequence of the strain obtained in this invention was similar to that of *Saccharomyces cerevisiae* (Saccharomyces cerevisiae). Saccharomyces cerevisiae The similarity reached 100%, confirming that the strain is a brewer's yeast. Saccharomyces cerevisiae This strain, which can be used in the food fermentation industry, is named *Saccharomyces cerevisiae* INM3205. This strain was deposited at the Guangdong Provincial Microbial Culture Collection Center on July 16, 2025, with accession number GDMCCNo66697. Therefore, in this application, *Saccharomyces cerevisiae* (…) Saccharomyces cerevisiae INM3205 and S10 refer to the same strain. The S2 strain of this invention has been genetically identified, and its gene sequence is as follows: GGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACA CTGTGGAGTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTC GCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAA CTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTTACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATG Example 2: Saccharomyces cerevisiae ( Saccharomyces cerevisiae Genetic stability testing of INM3205 The brewing yeast from Example 1 ( Saccharomyces cerevisiae INM3205 was passaged 10 times on malt extract broth. The 1st, 5th, and 10th generation strains were then cultured at a concentration of 10... 7 CFU / mL, 1% inoculum was added to the sourdough starter and fermented at 28℃ for 48 hours. The sourdough starter was then added to the starter at 10% of the total wheat content. Bread was made according to the national standard GB / T14612-2008, and physicochemical indicators were tested, including vitamin B6 content and 2,4-decadienal content, using the method described in Example 1. Sensory evaluation was also performed to determine its passage stability; specific data are shown in Table 3.

[0042] Table 3. Results of the passaging stability test

[0043] Table 3 shows that different generations of brewing yeast ( Saccharomyces cerevisiae The fermentation performance of strain INM3205 was normal, and the content of 2,4-decadienal and vitamin B6 varied within 10%. The strain has good genetic stability and meets the requirements for production and use.

[0044] Example 3, brewing yeast ( Saccharomyces cerevisiae INM3205 for making bread rich in Vitamin B6 brewing yeast ( Saccharomyces cerevisiae INM3205, inoculated at concentrations of 10 4 -10 8 CFU / mL was inoculated into the sourdough starter at a 1% inoculation rate and fermented at 28℃ for 48 hours. The fermented sourdough starter was then added to the starter at 10% of the total wheat content. Bread was made according to the national standard GB / T 14612-2008, and its physicochemical properties were tested, including vitamin B6 content, 2,4-decadienal content, and bread hardness. The method was the same as in Example 1. S1 was used as the control strain. The results are shown in Tables 4 and 5.

[0045] Table 4. Vitamin B6 and 2,4-decadienal content in bread

[0046] Table 5 Sensory evaluation results of bread

[0047] Note: Each assessment item is worth 10 points, with a scoring interval of 0.1. The overall score is the sum of all scores. As shown in Tables 4 and 5, the results indicate that the yeast (Saccharomyces cerevisiae) Saccharomyces cerevisiae Fermentation with INM3205 significantly increases the content of 2,4-decadienal and vitamin B6 in bread, and the higher the inoculum size, the higher the content of 2,4-decadienal and vitamin B6; however, the fermentation with brewer's yeast ( Saccharomyces cerevisiae Too high or too low an inoculum concentration of INM3205 will affect the sourness, sweetness, and texture of the bread. The optimal inoculum concentration is 1.0 × 10⁻⁶. 7 CFU / mL, this concentration provides sufficient vitamin B6 while also enhancing the flavor and texture of whole-grain bread, such as... Figure 1 The figure shows the total ion chromatogram of 2,4-decadienal used in bread making at this inoculation concentration.

[0048] Example 4, brewer's yeast ( Saccharomyces cerevisiae Making toast with INM3205 brewing yeast ( Saccharomyces cerevisiae INM3205, inoculated at concentrations of 10 7 CFU / mL was inoculated into the sourdough starter at a 1% inoculation rate and fermented at 28°C for 48 hours. The fermented sourdough starter was then added to the starter at 10% of the total wheat content. Toast was prepared according to the national standard GB / T 14612-2008. S1 served as the control group, and toast was prepared in the same manner. After fermentation, the content of 2,4-decadienal and vitamin B6 was measured after 1, 4, and 7 days of storage using the method described in Example 1. A professional evaluator also conducted a sensory evaluation of the toast flavor, and the results are recorded in Table 6.

[0049] Table 6. Results of Vitamin B6 and 2,4-decadienal detection and sensory evaluation of toast.

[0050] Note: Each sensory evaluation item is worth 10 points, with a scoring interval of 0.1. The overall score is the sum of all items. As shown in Table 6, after 10 days of vaccination... 7 CFU / mL Saccharomyces cerevisiae ( Saccharomyces cerevisiae INM3205 can significantly increase the content of 2,4-decadienal and vitamin B6 in toast. In addition, it can improve the sensory evaluation of toast, increase its aroma, enhance its flavor and texture, and make it fragrant and delicious.

[0051] Example 5, brewer's yeast ( Saccharomyces cerevisiae INM3205 for making dinner rolls brewing yeast ( Saccharomyces cerevisiae INM3205, inoculated at concentrations of 10 7 CFU / mL was inoculated into the sourdough starter at a 1% inoculation rate and fermented at 28℃ for 48 hours. The fermented sourdough starter was then added to the starter at 10% of the total wheat content. Dinner rolls were prepared according to the national standard GB / T 14612-2008. S1 served as the control group, and dinner rolls were prepared in the same manner. After fermentation, the contents of 2,4-decadienal and vitamin B6 were measured after 1, 4, and 7 days of storage, as described in Example 1. A professional evaluator also conducted a sensory evaluation of the flavor of the dinner rolls, and the results are recorded in Table 7.

[0052] Table 7. Results of Vitamin B6, 2,4-decadienal Detection and Sensory Evaluation of the Bread Buns

[0053] Note: Each sensory evaluation item is worth 10 points, with a scoring interval of 0.1. The overall score is the sum of all items. As shown in Table 7, after 10 days of vaccination... 7 CFU / mL Saccharomyces cerevisiae ( Saccharomyces cerevisiae INM3205 can significantly increase the content of 2,4-decadienal and vitamin B6 in fermented dough when used to make dinner rolls; in addition, it can improve the sensory evaluation of dinner rolls, increase aroma, and enhance flavor and texture.

[0054] Example 6, Saccharomyces cerevisiae ( Saccharomyces cerevisiae INM3205 for making European-style bread brewing yeast ( Saccharomyces cerevisiae INM3205, inoculated at concentrations of 10 7 CFU / mL was inoculated into the sourdough starter at a 1% inoculation rate and fermented at 28°C for 48 hours. The fermented sourdough starter was then added to the starter at 10% of the total wheat content. European-style bread was prepared according to the national standard GB / T 14612-2008. S1 served as the control group, and European-style bread was prepared in the same manner. After fermentation, the content of 2,4-decadienal, vitamin B6, and firmness were tested after storage for 1, 4, and 7 days, as described in Example 1. A professional evaluator also conducted a sensory evaluation of the bread's flavor, and the results are recorded in Table 8.

[0055] Table 8. Results of Vitamin B6, 2,4-decadienal Detection and Sensory Evaluation of European Bread

[0056] Note: Each sensory evaluation item is worth 10 points, with a scoring interval of 0.1. The overall score is the sum of all items. As shown in Table 8, the results indicate that after 10 days of vaccination... 7 CFU / mL Saccharomyces cerevisiae ( Saccharomyces cerevisiae INM3205 can significantly increase the content of vitamin B6 and 2,4-decadienal when used to make European-style bread; in addition, it can also improve the flavor and texture of European-style bread.

[0057] Based on the results of the above embodiments, the brewing yeast provided by the present invention ( Saccharomyces cerevisiae INM3205 is used in the production of toast, dinner rolls, and European-style bread. Without changing the existing process, it can significantly increase the content of vitamin B6 and 2,4-decadienal in the relevant products, while also improving the aroma and taste of the products, thus significantly enhancing the product quality.

[0058] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, which fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention patent should be determined by the appended claims.

Claims

1. A brewing yeast strain that produces high levels of vitamin B6, characterized by: The strain is Saccharomyces cerevisiae (Saccharomyces cerevisiae) Saccharomyces cerevisia The strain INM3205 was deposited on July 16, 2025, at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No:66697, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province.

2. The application of a high-vitamin B6-producing brewer's yeast as described in claim 1 in dough.

3. Production application of a high-vitamin B6-producing brewing yeast as described in claim 1: According to the bread-making process, add brewing yeast... (Saccharomycescerevisia) Fermentation liquid.

4. A fermentation agent prepared from a high-vitamin B6-producing brewing yeast.

Images