Ps4CLL1 gene segment and application thereof
By overexpressing the Ps4CLL1 gene fragment and its protein in plants, the problems of difficult adventitious root induction and low rooting rate in peony tissue culture were solved, resulting in a significant increase in root length and number, and promoting rooting and adventitious root development in peonies.
Patent Information
- Application Number
- CN202511211112.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-27
- Publication Date
- 2025-11-21
AI Technical Summary
In existing technologies, the tissue culture regeneration system for peony suffers from problems such as difficulty in inducing adventitious roots, low rooting rate, poor quality of adventitious roots, and low transplant survival rate, which affect its industrialization development.
Using the Ps4CLL1 gene fragment and its expressed protein, an expression vector was constructed and the gene was overexpressed in plants to promote root elongation and increase the number of adventitious roots.
It significantly increases the root length and number of roots in plants, and is especially beneficial to the development of adventitious roots, thereby improving the rooting rate and the number of adventitious roots.
Smart Images

Figure CN120989102A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant physiology and molecular biology applications, and particularly relates to a... Ps4CLL1 Gene fragments and their applications. Background Technology
[0002] peony( Paeonia suffruticosa Peony (Andr.) is a deciduous subshrub belonging to the genus Paeonia in the family Paeoniaceae. It possesses extremely high ornamental and medicinal value and significant market potential. However, current propagation methods for peonies primarily rely on grafting, which is time-consuming and inefficient, hindering large-scale production. Tissue culture propagation could effectively circumvent these problems. Currently, a mature peony tissue culture regeneration system has not yet been successfully established, facing challenges such as difficulty in inducing adventitious roots, low rooting rates, poor adventitious root quality, and low transplant survival rates, severely impacting the industrialization of peonies.
[0003] Therefore, studying the root development mechanism is of great significance for peony tissue culture. Currently, there is no research on... Ps4CLL1 Reports on the role of genes in promoting rooting. Summary of the Invention
[0004] In view of the problems existing in the prior art, the present invention provides a Ps4CLL1 Gene fragments and their applications.
[0005] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: This invention provides Ps4CLL1 Gene fragment, including the nucleotide sequence shown in SEQ ID NO.1.
[0006] The present application studies and finds that the above-mentioned gene is beneficial to the elongation of plant root system and the increase of adventitious roots.
[0007] The present application provides a Ps4CLL1 protein, which is a protein expressed by the above-mentioned Ps4CLL1 gene fragment.
[0008] Further, the amino acid sequence of the Ps4CLL1 protein comprises the amino acid sequence shown in SEQ ID NO. 2.
[0009] MTQNSTSRMIDPKSGFCCSDSIFYSKRRPIPLPQNQSIDVATFISSHPHNGKTAFIDATSGRHLSFSELWRAVDSVATCLSDIGIRKGHVILLLSPNSIFFPVICLAVMSLGAIITTTNPLNTVREIAKQIADSKPVLAFTIKALLPKLAGSNLPVVLMDSSNSKSPTEAKIVTTLEEMMKKEPSQKRIGDRVNQDDTASLLYSSGTTGASKGVVSSHKNLIAMVKTIINRFRLDETRDPIFICTVPMFHIYGLAAFAMGLLASGSTVVVLSKFEMDEMLSVIQKYRATHLPLVPPILVALLNGADRIKAKYDLGSLQSVLSGGAPLSKEVIEGFVEKYPTVEILQGYGLTESTGIGASTDTLEESRRYGTAGMLSPSMEAKIVDPESGDALPVNRTGELWLRGPTIMKGYFSNEEATASTLDSAGWLRTGDLCYIDEDGFIFVVDRLKELIKYKGYQVPPAELEALLLTHPEIADVAVIPFPDKEVGQFPMAYVVRKAGSNLSDKEVMEFVTKQVAPYKRVRRVAFVASIPKNPSGKILRKDLIKLATSKL (SEQ ID NO. 2).
[0010] The present application provides a primer for amplifying Ps4CLL1 a gene fragment, comprising the nucleotide sequence shown in SEQ ID NO. 7 and the nucleotide sequence shown in SEQ ID NO. 8.
[0011] The present application provides an expression vector comprising the above-mentioned Ps4CLL1 gene fragment.
[0012] The present application provides a strain comprising Ps4CLL1 a gene fragment, comprising the above-mentioned expression vector.
[0013] The application also provides the above-mentioned Ps4CLL1 application of the gene fragment, the expression vector in promoting plant rooting.
[0014] The application provides the above-mentioned Ps4CLL1 application of any one of the gene fragment, the Ps4CLL1 protein, the primer, the expression vector, the strain in promoting plant root length increase.
[0015] The application provides the above-mentioned Ps4CLL1 application of any one of the gene fragment, the Ps4CLL1 protein, the primer, the expression vector, the strain in promoting plant root number increase.
[0016] The application provides the above-mentioned Ps4CLL1 application of any one of the gene fragment, the Ps4CLL1 protein, the primer, the expression vector, the strain in promoting adventitious root growth.
[0017] The application provides a method for promoting plant rooting, comprising the following steps: expressing Ps4CLL1 a gene in a plant.Preferably, the gene can be overexpressed in the form of a plasmid or other forms. Ps4CLL1
[0018] The application finds through experiments that the use of Ps4CLL1 a gene can significantly increase root length and root number, and is especially beneficial to the development of adventitious roots. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 For Ps4CLL1 bioinformatics analysis, a) is conservative domain analysis, b is signal peptide prediction, c) is tertiary structure prediction, d) is transmembrane domain prediction, and e) is secondary structure prediction.
[0020] Figure 2 For Ps4CLL1 subcellular localization map, from left to right, it is superimposed (membrane localization maker+Ps4CLL1-GFP+bright field), membrane localization maker, Ps4CLL1-GFP, and bright field.
[0021] Figure 3 For adventitious roots of Ps4CLL1 overexpressing Arabidopsis, a) is T1 generation positive detection of Ps4CLL1 overexpressing Arabidopsis, b) is phenotype diagram of main lateral roots of Ps4CLL1 overexpressing Arabidopsis, c) is relative expression amount of Ps4CLL1 overexpressing Arabidopsis, d) is main root length of Ps4CLL1 overexpressing Arabidopsis, e) is adventitious root phenotype diagram of Ps4CLL1 overexpressing Arabidopsis, f) is adventitious root number of Ps4CLL1 overexpressing Arabidopsis, and g) is average maximum root length of Ps4CLL1 overexpressing Arabidopsis.
[0022] Figure 4 Paeonia suffruticosa seed hypocotyls overexpressing Ps4CLL1, wherein a) is the phenotype of seed hypocotyls overexpressing Ps4CLL1, b) is the relative expression of seed hypocotyls overexpressing Ps4CLL1, c) is the number of adventitious roots of seed hypocotyls overexpressing Ps4CLL1, and d) is the average maximum root length of seed hypocotyls overexpressing Ps4CLL1.
[0023] Figure 5 Paeonia suffruticosa seed hypocotyls silencing Ps4CLL1, wherein a) is the phenotype of seed hypocotyls silencing Ps4CLL1, b) is the relative expression of seed hypocotyls silencing Ps4CLL1, c) is the average maximum root length of seed hypocotyls silencing Ps4CLL1, and d) is the number of adventitious roots of seed silencing Ps4CLL1.
[0024] Figure 6 Paeonia suffruticosa seed hypocotyls overexpressing Ps4CLL1, wherein a) is the phenotype of seed hypocotyls overexpressing Ps4CLL1, b) is the number of adventitious roots of seed hypocotyls overexpressing Ps4CLL1, c) is the relative expression of seed hypocotyls overexpressing Ps4CLL1, d) is the average maximum root length of seed hypocotyls overexpressing Ps4CLL1, and e) is the rooting rate statistics of seed hypocotyls overexpressing Ps4CLL1. DETAILED DESCRIPTION
[0025] The principles and features of the present application are described below in conjunction with the accompanying drawings, and the examples are only used to explain the present application and are not intended to limit the scope of the present application.
[0026] The present application obtains Paeonia suffruticosa rooting regulation related genes Ps4CLL1 and performs RT-qPCR expression and functional verification, revealing its regulation on plant lateral root development and adventitious root differentiation, providing a new method for exploring Paeonia suffruticosa rooting mechanism and establishing tissue culture and rapid propagation system.
[0027] T3 Super PCR Mix was purchased from Beijing Qingke Biotechnology; pClone007 Versatile Simple Vector Kit was purchased from Beijing Qingke Biotechnology; DH5α competent cells were purchased from Beijing Qingke Biotechnology; pCAMBIA1301 empty vector plasmid was purchased from Beijing Zhuangmeng Biotechnology; T4 DNA ligase was purchased from Nanjing Novizan Biotechnology; membrane localization marker was purchased from Beijing Zhuangmeng Biotechnology; GV3101 Agrobacterium competent cells were purchased from Beijing Qingke Biotechnology; 1 / 2 MS medium was purchased from Solarbiotech; Silwet L-77 was purchased from Solarbiotech; Hygromycin Hyg was purchased from Roche; Indolebutyric acid (IBA) was purchased from Solarbiotech; TRV1 was purchased from Beijing Zhuangmeng Biotechnology; TRV2 was purchased from Beijing Zhuangmeng Biotechnology; 'Fengdan' seeds were purchased from Luoyang Shenzhou Peony Garden; 2-morpholine ethanesulfonic acid (MES) was purchased from Solarbiotech; C58C1 Agrobacterium was purchased from Beijing Zhuangmeng Biotechnology; WPM medium was purchased from Solarbiotech.
[0028] The LB liquid medium is formulated with: 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride, and is prepared with water.
[0029] LB solid medium: Based on the LB liquid medium formula, agar is added, with an agar content of 1.5%-2% (by mass).
[0030] The primers involved in this invention were all synthesized by Sangon Biotech (Shanghai) Co., Ltd., and their specific sequences are shown in Table 1.
[0031] Table 1 Primer sequences involved in this invention Primer name Primer sequence (5'-3') Sequence number Cloning primer-F ATGACCCAGAATAGTACCTCAAGGA SEQ ID NO. 3 Cloning primer-R TTAAAGCTTAGAGGTCGCAAGTTTAA SEQ ID NO. 4 Subcellular vector construction primer-F CGCGGATCCATGACCCAGAATAGTACCTCAAGGA SEQ ID NO. 5 Subcellular vector construction primer-R ACGCGTCGACAAGCTTAGAGGTCGCAAGTTTAA SEQ ID NO. 6 Overexpression vector construction primer-F CGCGGATCCATGACCCAGAATAGTACCTCAAGGA SEQ ID NO. 7 Overexpression vector construction primer-R ACGCGTCGACTTAAAGCTTAGAGGTCGCAAGTTTAA SEQ ID NO. 8 Silencing expression vector construction primer-F CCGGAATTCACCCAGAATAGTACCTCAAGGATGA SEQ ID NO. 9 Silencing expression vector construction primer-R CGGGGTACCGAAGAAGATGGAATTGGGTGAAA SEQ ID NO. 10 Unless otherwise specified, all methods and conditions used in the embodiments are conventional or performed according to the techniques or conditions described in the literature in this field, or according to the product instructions. Reagents, experimental materials, and instruments used without specified manufacturers are all conventional products that can be purchased from legitimate channels. Unless otherwise specified, all solutions in this invention are prepared using water as the solvent.
[0032] The following is a description through specific embodiments.
[0033] Example 1: Cloning Peonies Ps4CLL1 Gene Using sequences obtained from screening libraries in the early stages of this invention as a reference, Primer 5.0 was used for primer design, namely cloning primer-F and cloning primer-R. The primer sequence of cloning primer-F is shown in SEQ ID NO.3, and the primer sequence of cloning primer-R is shown in SEQ ID NO.4. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0034] The 'phoenix' tissue culture seedlings were grafted on the medium for 30 d. The medium formula was: WPM medium + 1.0 mg·L -1 Caffeic acid + 4.0 mg·L -1 IAA + 30 g·L -1 Sucrose + 7.5 g·L -1 Agar. The stem base of 'phoenix' tissue culture seedlings was taken, and the total RNA was extracted by using Beijing Huayueyang RNA extraction kit, and the cDNA was obtained by using Hunan Aikuerui Bio Evo M-MLV long fragment reverse transcription kit. The above cDNA was used as a template for cloning.
[0035] The PCR system included: T3 Super PCR Mix 45 μL, cloning primer-F (10 μM) 2 μL, cloning primer-R (10 μM) 2 μL, cDNA 1 μL.
[0036] The PCR reaction program included: 98℃, 3 min; 38 cycles: 98℃, 30 sec, 55℃, 30 sec, 72℃, 1 min; 72℃, 10 min; 4℃ +∞.
[0037] After the PCR product was separated by electrophoresis, the fragment was recovered and purified by using TIANgel Midi Purification Kit reagent box (Tiangen, Beijing), and the recovered fragment was connected to pClone007 Versatile Simple Vector Kit, 25℃ for 10 min.
[0038] The connection reaction system included: target fragment 50 ng, 5×pClone007 Versatile Simple Vector Mix 2 μL, and ddH2O was added to 10 μL.
[0039] The heat shock method was used to transform E. coli DH5α competent cells, and a single colony was picked and sent to Shanghaigong Bioengineering (Shanghai) Co., Ltd. for sequencing. The peony Ps4CLL1 Gene fragment, the nucleotide sequence of which is shown as SEQ ID NO. 1, and the amino acid sequence of which is shown as SEQ ID NO. 2.
[0040] Example 2 Bioinformatics analysis of peony Ps4CLL1 The physicochemical properties of peony Ps4CLL1 protein were analyzed by using ExPASy online website (http: / / www.Expasy.ch / tools / pi_tool.html), as shown in Table 2, the molecular formula of Ps4CLL1 was C 2696 H4351 N 711 O 797 S 22 , the number of amino acids is 552 aa, the molecular weight is about 60182.81 Da, the isoelectric point of Ps4CLL1 protein is 8.65, the total number of basic amino acid residues (Arg + Lys) is greater than the total number of acidic amino acid residues (Asp + Glu), the instability index is 39.06, the lipid solubility index is 97.5, and the total average hydrophilic index is positive 0.026. Therefore, Ps4CLL1 protein is a stable hydrophobic basic lipid-soluble protein.
[0041] Table 2 Physicochemical property analysis of peony Ps4CLL1 Gene name Physicochemical properties of Ps4CLL1 Molecular formula C 2696 H 4351 N 711 O 797 S 22 ]]> Number of amino acids (aa) 552 Relative molecular weight (kDa) 60182.81 Isoelectric point 8.65 Unstable index 39.06 Asp + Glu 57 Arg + Lys 62 Lipid-soluble index 97.5 Total average hydrophilic index 0.026 Using the CDD online tool of NCBI (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi) to analyze the conserved domain of Ps4CLL1 coding amino acid sequence, it was found that it contains highly conserved 4CL_AFD_class_I super family domain, belonging to AFD class_I superfamily superfamily ( Figure 1 a)。
[0042] Using TMHMM-2.0 (https: / / services.healthtech.dtu.dk / service.php?TMHMM-2.0) and SignalP-6.0 (httPs: / / services.healthtech.dtu.dk / service.php?SignalP) to predict the transmembrane domain and signal peptide of Ps4CLL1, PS4CLL1 has no signal peptide and no signal recognition function, belonging to non-secretory protein ( Figure 1 b);And there are two transmembrane domains, belonging to transmembrane protein ( Figure 1 d)。
[0043] Through SOPMA, the secondary structure of Ps4CLL1 protein was predicted and analyzed, and it was found that the secondary structure of Ps4CLL1 protein was composed of 29.17% of α-helix, 51.63% of random coil, 0% of β-turn and 19.20% of extended chain ( Figure 1 e);Among them, the random coil in Ps4CLL1 protein accounts for the main component, indicating that the secondary structure of the protein is unstable and loose. Through SWISS-MODEL, the tertiary structure of Ps4CLL1 protein was predicted, and it was found that the HD model of the protein had more random coil structure and the same structure as the secondary structure ( Figure 1 c)。
[0044] Example 3 Peony Ps4CLL1 Subcellular localization analysis Will Ps4CLL1 The cDNA sequence of the gene and the pCAMBIA1301 vector were digested with two enzymes to construct the Ps4CLL1-pCAMBIA1301-GFP fusion expression vector. The specific experimental methods included the following steps: Based on cloning Ps4CLL1 The gene sequence and pCAMBIA1301 vector sequence were analyzed using BamHI and SalI restriction sites. Primers were designed using Primer 5.0, and primers for subcellular vector construction, namely primer-F (SEQ ID NO.5) and primer-R (SEQ ID NO.6), were synthesized. The cloned gene was then used with specific primers. Ps4CLL1 The gene sequence (prepared using the method in Example 1) was used as a template for PCR amplification.
[0045] The PCR amplification reaction system includes: 45 μL of T3 Super PCR Mix, 2 μL of subcellular vector construction primer-F (10 μM), 2 μL of subcellular vector construction primer-R (10 μM), and 1 μL of cDNA.
[0046] The PCR amplification reaction conditions included: 98℃ for 3 min; 38 cycles: 98℃ for 30 sec, 55℃ for 30 sec, 72℃ for 1 min; 72℃ for 10 min; 4℃ for +∞.
[0047] The target fragment was separated by agarose gel electrophoresis, and then the amplified fragment was recovered by gel recovery. The recovered target product and the pCAMBIA1301 empty vector plasmid were then subjected to double enzyme digestion.
[0048] The enzyme digestion reaction system included: 1000 ng of gene recovery fragment / pCAMBIA1301 empty vector plasmid, 5 μL of buffer, 1 μL of BamHI, 1 μL of SalI, and ddH2O to a final volume of 50 μL.
[0049] The electrophoretically separated target fragment and the digested vector fragment were recovered and purified. The recovered gene fragment and the vector fragment were ligated using T4 DNA ligase at 4°C overnight. The ligation reaction system included: recovered fragment 0.3 pmol, vector fragment 0.03 pmol, buffer 1 μL, T4 DNA Ligase 1 μL. The ligation product was transformed into DH5a competent cells by heat shock method. After transformation, plasmid extraction was performed to obtain the fusion expression vector, which was named Ps4CLL1-pCAMBIA1301-GFP.
[0050] The Ps4CLL1-pCAMBIA1301-GFP plasmid and the membrane localization marker were transformed into Agrobacterium competent GV3101, respectively, and positive single colonies were screened. The positive bacteria containing the Ps4CLL1-pCAMBIA1301-GFP plasmid and the membrane localization vector were inoculated into 50 mL LB liquid medium containing 50 mg·L -1 Rif and 100 mg·L -1 Kan, and cultured at 28°C with 200 rpm shaking until the OD 600 of the culture reached 0.8-1.0. The prepared bacterial solution was centrifuged (5000 rpm, 10 min) to collect the bacterial cells, the supernatant was removed, and the bacterial suspension was resuspended with resuspension solution (containing 10 mM MgCl2 and 10 mM MES) and adjusted to an OD 600 of 0.8-1.0 to obtain the infection solution.
[0051] The infection solution containing the membrane marker was mixed with the infection solution containing the Ps4CLL1-pCAMBIA1301-GFP plasmid at a volume ratio of 1:1, and the mixture was placed at 28°C in the dark for 2 h. The back of the Nicotiana benthamiana leaf was infected by injection, and the leaf was cultured in the dark for 2-3 d. The tobacco leaf injected with the bacterial solution was punched into a round piece using a puncher, and a section was prepared. The fluorescence signal was observed using a laser confocal microscope (Nikon A1Rsi, Japan) (excitation wavelength: 488 nm, emission wavelength: 500-550 nm) (Figure Figure 2 ). The results showed that Ps4CLL1 was localized on the cell membrane, indicating that Ps4CLL1 may function on the cell membrane.
[0052] Example 4 Ps4CLL1 Genetic Arabidopsis heterologous transformation (1) Construction of overexpression vector Based on the cloning primers, specific primers required for the construction of the overexpression vector were obtained by adding enzyme digestion sites, i.e., overexpression vector construction primer-F (SEQ ID NO. 7) and overexpression vector construction primer-R (SEQ ID NO. 8).
[0053] The sequence obtained in Example 1 was used as a template, and after cloning, electrophoresis, and purification, the enzyme digestion site-containing Ps4CLL1 sequence was obtained.Ps4CLL1 The sequence was obtained by the method described in Example 3. The sequence obtained above was digested with plant expression vector pCAMBIA2300, respectively, and the digestion system included: target fragment / vector fragment 1000 ng, BamHI 1 μL, SalI 1 μL, Buffer 5 μL, ddH2O supplemented to 50 μL.
[0054] T4 DNA Ligase (Nanjing Novoprotein) was used for ligation to construct pCAMBIA2300-Ps4CLL1 plant expression vector, and the ligation system included: target fragment 0.3 pmol, vector fragment 0.03 pmol, 10 × Ligase Buffer 1 μL, ddH2O supplemented to 10 μL. The recombinant vector was obtained by the above method.
[0055] (2) Heterologous transformation of Arabidopsis thaliana The above constructed recombinant vector was transformed into GV3101 Agrobacterium competent cells by chemical transformation method, and was coated on 1 / 2MS medium containing 100 mg·L -1 Kan LB plate, 28°C for 2 d, and positive single colonies were picked and cultured to OD 600 =1.0, centrifuged, resuspended with resuspension solution, and obtained the infection solution.
[0056] The formula of the resuspension solution included: 1 / 2MS+5% sucrose+0.05% Silwet L-77, prepared with water, and the above percentages were mass percentages.
[0057] The siliques and open flower buds of Arabidopsis thaliana plants were cut off, and the inflorescences were immersed in the prepared infection solution for 5 min. Then, the Arabidopsis thaliana plants were cultured in the dark for 24 h, and then cultured under normal conditions (light intensity 36 μmol·m -2 ·s -1 , light time 16 h·d -1 ) until the fruits matured. The matured seeds were inoculated on the Arabidopsis thaliana positive screening medium. The Arabidopsis thaliana positive screening medium included: 1 / 2MS+100 mg·L -1 Kan +30 g·L -1 sucrose+7.5 g·L -1 agar, prepared with water. The culture conditions were (light intensity 36 μmol·m -2 ·s -1 , light time 16 h·d -1 ).
[0058] Next, homozygous positive lines were screened. The screening method included: planting the seeds obtained above on a positive selection medium, culturing for 20 days, and then selecting lines that could grow normally. These lines were then transplanted into peat moss and grown under normal conditions (light intensity 36 μmol·m⁻¹). -2 ·s -1 Light duration 16 h·d -1 The leaves were cultured until the fruit matured, and gDNA was extracted from the leaves using the CTAB method. Then, PCR amplification was performed using cloning primers.
[0059] The PCR system includes: 45 μL of T3 Super PCR Mix, 2 μL of cloning primer-F (10 μM), 2 μL of cloning primer-R (10 μM), and 1 μL of cDNA.
[0060] The PCR reaction program included: 98℃, 3 min; 38 cycles: 98℃, 30 sec, 55℃, 30 sec, 72℃, 1 min; 72℃, 10 min; 4℃, +∞.
[0061] like Figure 3 As shown in a), 15 positive strains, from OE1 to OE15, were obtained.
[0062] The above-mentioned positive Arabidopsis seeds were sown on a positive selection medium and cultured for 20 days. Lines that could grow normally were then selected and transplanted into peat moss. Under normal conditions (light intensity 36 μmol·m⁻¹), the plants were cultured. -2 ·s -1 Light duration 16 h·d -1 The cells were cultured until the fruit matured. Afterward, they were inoculated onto a positive selection medium and cultured for 20 days. Lines with all progeny showing positive results were then cultured until the fruit matured, and the seeds were harvested for subsequent phenotypic observation.
[0063] (3) Peony Ps4CLL1 Phenotypic observation of transgenic Arabidopsis Arabidopsis thaliana overexpressing Ps4CLL1 and wild-type Arabidopsis thaliana (WT) were planted in 1 / 2 MS medium and cultured under conditioned conditions (light intensity 36 μmol·m⁻¹). -2 ·s -1 Light duration 16 h·d -1 ), observe root phenotype, and detect primary root length and Ps4CLL1 expression level.
[0064] The experimental method for detecting the expression amount of Ps4CLL1 includes the following steps: taking root system, extracting RNA using Beijing Huaiyueyang RNA extraction kit, and using Evo M-MLV reverse transcription kit to perform reverse transcription on the above-mentioned RNA. SYBR Green Premix Pro Taq HS qPCR Kit II (Rox Plus) kit is used for qRT-PCR, and 3 biological repeats and three technical repeats are used in this experiment to determine the expression amount of Ps4CLL1.
[0065] From Figure 3 As can be seen from b), c) and d) of the above, the main root length of the Ps4CLL1 overexpression strain is significantly higher than that of the WT, and the Ps4CLL1 expression amount of the Ps4CLL1 overexpression strain is significantly higher than that of the WT.
[0066] After cutting the roots of each strain (cutting the main root and lateral root from the base), the strains are planted in adventitious root induction medium, and the adventitious root phenotype is observed after 10 days of induction. The culture conditions (light intensity 36 μmol·m -2 ·s -1 , light time 16 h·d -1 ). The adventitious root induction medium includes: 1 / 2MS + 1 mg·L -1 IBA, prepared with water. The adventitious root phenotype is observed, the number of adventitious roots is detected, and the average maximum root length is detected.
[0067] From Figure 3 As can be seen from e), f) and g) of the above, the above-mentioned Arabidopsis overexpression strain and the wild type strain are cut and inoculated in the adventitious root induction medium, and the number of adventitious roots of the overexpression strain is significantly increased compared with the WT, indicating that Ps4CLL1 has a significant promoting effect on the generation of Arabidopsis adventitious roots.
[0068] Example 5 Tree peony Ps4CLL1 Gene transformation of tree peony root system (1) Construction of silencing vector Design specific primers for silencing vector with enzyme digestion site. The specific primers for constructing the silencing expression vector are silencing expression vector construction primer-F (SEQ ID NO. 9) and silencing expression vector construction primer-R (SEQ ID NO. 10).
[0069] Using the Ps4CLL1 sequence obtained in Example 1 as a template, after cloning, electrophoresis and purification, the Ps4CLL1 silencing vector sequence with enzyme digestion site is obtained, and the experimental method is referred to Example 3. After the above-mentioned sequence and the plant expression vector TRV2 are subjected to enzyme digestion, electrophoresis, purification and ligation, the methods and reaction systems are the same as those in Example 3. The Ps4CLL1-TRV2 vector is obtained by the above-mentioned method.
[0070] (2) Transformation of Paeonia suffruticosa root system and Paeonia suffruticosa Ps4CLL1 Phenotype observation of transgenic Paeonia suffruticosa root system Plasmids pCAMBIA2300, pCAMBIA2300-Ps4CLL1, TRV1, TRV2, Ps4CLL1-TRV2 were respectively transformed into Agrobacterium GV3101, and the transformation method was the same as that in Example 4.
[0071] The above positive single colonies were respectively taken into 50 mL of LB liquid medium containing Kan (100 mg / mL), and shaken and cultured at 28°C, 220 rpm for 16-24 h until OD 600 = 0.8-1.0, centrifuged to collect the bacterial cells, resuspended with a resuspension solution (10 mM MgCl2, 10 mM MES, 150 μM acetosyringone, prepared with water), and adjusted the bacterial suspension to OD 600 = 0.8-1.0. 28°C, dark, static for 2 h to obtain the infection solution. The hypocotyls of 'Fengdan' seeds about 5 cm long but without lateral roots were selected, and the hypocotyls were cut transversely, and the hypocotyls were left 2-3 cm long. The treated hypocotyls were soaked in the infection solution, and placed in a vacuum pump-0.8 Mpa condition for 15 min. After vacuum infiltration, the residual infection solution on the seeds was washed with distilled water. The infected seeds were placed on wet filter paper for dark culture for one day, and then transferred to sterilized fine sand, and placed in a cool and ventilated place for culture for 14 d, and then used for subsequent phenotype observation and detection of the relative expression amount of Ps4CLL1.
[0072] The experimental method for detecting the relative expression amount of Ps4CLL1 includes the following steps: taking the seed root system, extracting RNA using Beijing Huayueyang RNA extraction kit, and reverse transcribing the above RNA using Evo M-MLV reverse transcription kit. SYBRGreen Premix Pro TaqHS qPCR Kit II (Rox Plus) kit was used for qRT-PCR, and 3 biological replicates and three technical replicates were used in this experiment to determine the expression amount of Ps4CLL1.
[0073] The experimental results of Paeonia suffruticosa seed hypocotyls overexpressing Ps4CLL1 are shown in Figure 4 . Figure 4 CK represents 'Fengdan' transformed with pCAMBIA2300, and OE represents 'Fengdan' transformed with pCAMBIA2300-Ps4CLL1. It can be seen from Figure 4 that after overexpression of the Ps4CLL1 gene, Ps4CLL1 the gene is significantly overexpressed in the seed hypocotyl; the observation phenotype shows that overexpression of the Ps4CLL1The seed hypocotyls of the different lines showed obvious phenotypic differences in the ability of adventitious root formation. Compared with the control group, the number of adventitious roots and the maximum root length of the OE lines were significantly increased.
[0074] The experimental results of silencing Ps4CLL1 in the seed hypocotyls of Paeonia suffruticosa are shown in Figure 5 Figure 5 In the figure, TRV represents the TRV1 and TRV2 empty co-transformation lines, and 4CLL1-TRV represents the TRV1 and Ps4CLL1-TRV2 co-transformation lines. Figure 5 As can be seen from the figure, after silencing Ps4CLL1, the relative expression amount of Ps4CLL1 decreased, the number of adventitious roots of the seed hypocotyls of Ps4CLL1-TRV was less than that of the empty TRV, and the maximum root length was also lower than that of the empty.
[0075] The above results show that, Ps4CLL1 the gene has a promoting effect on the formation of adventitious roots of Paeonia suffruticosa.
[0076] Example 6 Transient transformation of Paeonia suffruticosa test tube seedlings with the Ps4CLL1 gene Ps4CLL1 Example 6 Transient transformation of Paeonia suffruticosa test tube seedlings with the Ps4CLL1 gene The proliferated Paeonia suffruticosa test tube seedlings ‘Taipinghong’ were inoculated into a solid culture medium to induce rooting for 30 days.
[0077] Solid culture medium: WPM medium + 4 mg·L -1 IBA + ascorbic acid 50 mg·L -1 + LH 0.5 g·L -1 + PVP 1 g·L -1 + sucrose 30 g·L -1 + agar 7 g·L -1 .
[0078] After 30 days, Paeonia suffruticosa test tube seedlings ‘Taipinghong’ with well-grown calli at the stem base but without adventitious root formation were selected for subsequent infection. The pCAMIBA2300 empty plasmid and the pCAMBIA2300-Ps4CLL1 plasmid were respectively transformed into C58C1 Agrobacterium, and positive single colonies were screened. The positive bacteria containing the pCAMIBA2300 empty plasmid and the pCAMBIA2300-Ps4CLL1 plasmid were respectively inoculated into 50 mL of LB liquid medium containing 50 mg·L -1 Rif and 100 mg·L -1 Kan, and cultured at 28°C with 200 rpm shaking until the OD 600 was 0.8-1.0. The prepared bacterial solution was collected by centrifugation (5000 rpm, 10 min), the supernatant was removed, and the bacterial suspension was resuspended with resuspension solution (WPM medium containing 100 μM acetosyringone) and adjusted to OD 600 was 0.4, and the mixture was allowed to stand for 2 h to obtain the infection solution. The pretreated stems of the peony test tube seedlings were immersed in the infection solution, and after 10 min of infection, the infected seedlings were transferred to rooting medium containing Cef (100 mg·L -1 ) + Kan (50 mg·L -1 ), with 15 seedlings per treatment.
[0079] The rooting medium formula included: WPM + 4 mg·L -1 IBA + ascorbic acid 50 mg·L -1 + LH 0.5 g·L -1 + PVP 1 g·L -1 + sucrose 30 g·L -1 + agar 7 g·L -1 .
[0080] After 40 d of rooting culture, the rooting condition was observed, and the relative expression amount of Ps4CLL1 was detected. The experimental method for detecting the relative expression amount of Ps4CLL1 included: taking the stem base and adventitious roots of the rooting culture test tube seedlings, extracting RNA using the Beijing Huayueyang RNA extraction kit, and performing reverse transcription on the above RNA using the Evo M-MLV reverse transcription kit. SYBR Green Premix Pro Taq HS qPCR Kit II (Rox Plus) kit was used for qRT-PCR, and three biological replicates and three technical replicates were used in the experiment to determine the expression amount of Ps4CLL1.
[0081] The experimental results of the peony test tube seedlings overexpressing Ps4CLL1 are shown in Figure 6 . Figure 6 In the experiment, CK was the peony test tube seedling ‘Taipinghong’ transformed with the empty pCAMIBA2300 plasmid, and OE3 and OE5 were both peony test tube seedlings ‘Taipinghong’ transformed with pCAMBIA2300-Ps4CLL1.
[0082] From Figure 6As can be seen, the number of adventitious roots of the overexpression strain is increased compared with the control group (CK); the infected plants are positive and Ps4CLL1 is overexpressed in the Paeonia suffruticosa test-tube seedlings through genome DNA and qPCR experiments; 15 plants of the OE strain and the CK strain are counted respectively, the rooting rates of the two strains are counted respectively, it is found that the rooting rate of the OE strain is 54%, the rooting rate of the CK strain is 30%, and overexpression of Ps4CLL1 promotes the rooting rate of the Paeonia suffruticosa test-tube seedlings; the average number of adventitious roots of the OE strain is significantly increased compared with the average number of adventitious roots of the CK strain, and the average maximum adventitious root length is increased.
[0083] The above results show that overexpression of Ps4CLL1 plays a role in promoting the occurrence of adventitious roots in the Paeonia suffruticosa test-tube seedlings.
[0084] The above only describes the preferred embodiments of the present application and is not intended to limit the present application, and any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. A kind Ps4CLL1 Gene fragment, characterized in that, comprising the nucleotide sequence of SEQ ID NO.
1.
2. A Ps4CLL1 protein, characterized in that, For the claim 1 Ps4CLL1 Protein expressed by the gene fragment.
3. The Ps4CLL1 protein according to claim 2, characterized in that, Ps4CLL1 4. A primer for amplifying a gene segment, characterized by, comprising the amino acid sequence of SEQ ID NO.
2. Ps4CLL1 5. An expression vector, characterized by, comprising the claim 1 comprising the nucleotide sequence of SEQ ID NO. 7 and the nucleotide sequence of SEQ ID NO.
8. gene fragment.
6. A composition comprising Ps4CLL1 a strain of the gene fragment, characterized in that, Ps4CLL1 7. The use of any one of the gene fragment of claim 1, the Ps4CLLl protein of claim 2 or 3, the primer of claim 4, the expression vector of claim 5, or the bacterial strain of claim 6 to promote plant rooting. comprising the expression vector of claim 5. The use of any one of the gene fragment of claim 1, the Ps4CLLl protein of claim 2 or 3, the primer of claim 4, the expression vector of claim 5, or the bacterial strain of claim 6 to promote plant rooting.
8. The claim 1 Ps4CLL1 The use of any one of the following in promoting increased root length and / or increased root number in plants: gene fragment, Ps4CLL1 protein of claim 2 or 3, primer of claim 4, expression vector of claim 5, or strain of claim 6.
9. The method of claim 1 Ps4CLL1 The use of any one of the gene fragment of claim 1, the Ps4CLL1 protein of claim 2 or 3, the primer of claim 4, the expression vector of claim 5, or the bacterial strain of claim 6 in promoting the growth of adventitious roots.
10. A method of promoting rooting of a plant, comprising applying to the plant a composition comprising a compound of Formula (I) or a salt thereof. Ps4CLL1 Expression in plants comprising the following steps: Ps4CLL1 Genes.