Application of OsLOX3 gene in regulation of rice yield
By constructing a CRISPR/Cas9 knockout vector of the OsLOX3 gene and transforming it into rice plants, the application gap of OsLOX3 in rice yield regulation was filled, resulting in a significant increase in rice yield and promoting the breeding of high-yield rice varieties.
Patent Information
- Application Number
- CN202511069666.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-31
- Publication Date
- 2025-11-21
AI Technical Summary
There are no reports on the application of the OsLOX3 gene in rice yield regulation in the current technology, which affects the selection of molecular targets for high-yield rice breeding.
A CRISPR/Cas9 knockout vector for the rice OsLOX3 gene was constructed and transformed into rice plants using Agrobacterium-mediated transformation. Rice plants with OsLOX3 gene mutations were cultured and screened, which significantly increased panicle length, primary branches, secondary branches, and yield per plant.
The OsLOX3 mutant plants showed significantly increased panicle length, primary branches, and secondary branches, resulting in higher yield per plant. This provides a simple and effective method for breeding high-yielding rice varieties.
Smart Images

Figure CN120989128A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant breeding technology, and more specifically, to... OsLOX3 Application of genes in regulating rice yield. Background Technology
[0002] Rice ( Oryza sativa Rice (L.) is one of the world's most important food crops, and increasing its yield is crucial for ensuring food security. Rice yield is mainly determined by key agronomic traits such as the number of effective panicles per unit area, the number of grains per panicle, and the thousand-grain weight, all of which are influenced by a multi-gene regulatory network. In recent years, with the development of molecular biology and genomics, several key genes regulating rice yield have been identified, such as Ghd7, DEP1, GW2, and GS3. The discovery of these genes provides important molecular targets for high-yield rice breeding.
[0003] Lipoxygenases (LOXs) are a class of non-heme iron-binding proteins widely found in plants. They participate in fatty acid oxidation metabolism and play an important role in plant growth, development, stress resistance, and secondary metabolism. Studies have shown that OsLOX3, as a member of the lipoxygenase family, can affect the storage tolerance, drought resistance, and rice blast resistance of rice. However, there are currently no reports on the application of OsLOX3 in rice yield. Summary of the Invention
[0004] The purpose of this invention is to overcome the aforementioned defects and shortcomings in the prior art and to provide a rice lipoxygenase gene. OsLOX3 Application in regulating rice yield.
[0005] The above-mentioned objective of this invention is achieved through the following technical solution: This invention constructs rice OsLOX3 The CRISPR / Cas9 knockout vector pYLCRISPR / Cas9- (whose CDS sequence is shown in SEQ ID No. 1, encoding 864 amino acids, and whose amino acid sequence is shown in SEQ ID No. 2) of the gene. LOX3 They were then transformed into callus tissue from recipient plants and cultured and screened to obtain... OsLOX3 Rice plants with gene mutations; results showed OsLOX3 The rice plants with the gene mutation showed significantly increased panicle length, primary branches, secondary branches, and yield per plant compared to wild-type rice plants, indicating that... OsLOX3 Negative regulation of rice yield. This can thus reduce rice... OsLOX3 The application of genes to regulate rice yield is beneficial for the breeding of high-quality rice varieties.
[0006] This invention first protects OsLOX3 The application of genes in regulating rice yield, theOsLOX3 The nucleotide sequence of the gene is selected from one of the following groups: (a) The nucleotide sequence shown in SEQ ID No. 1; (b) The nucleotide sequence encoding the protein with the amino acid sequence shown in SEQ ID No. 2; (c) A nucleotide sequence complementary to any of the nucleotide sequences described in (a)-(b).
[0007] Specifically, the regulation of rice yield refers to the regulation of rice panicle length, primary branches, secondary branches, and yield per plant.
[0008] Preferably, the regulation of rice yield is to increase rice yield; the increase of rice yield is to make the rice plant taller, the panicle longer, the number of primary and secondary branches more, and the yield per plant higher.
[0009] This invention also provides OsLOX3 Application of gene knockout vectors or plasmids in creating rice varieties with increased yield.
[0010] The present invention also provides a method for increasing rice yield, the method being to knock out [a specific substance] in rice. OsLOX3 Genes, thereby obtaining mutant plants with increased yield; the aforementioned OsLOX3 The nucleotide sequence of the gene is selected from one of the following groups: (a) The nucleotide sequence shown in SEQ ID No. 1; (b) The nucleotide sequence encoding the protein with the amino acid sequence shown in SEQ ID No. 2; (c) A nucleotide sequence complementary to any of the nucleotide sequences described in (a)-(b).
[0011] Furthermore, the knockout of rice OsLOX3 Genes for construction OsLOX3 The gene was knocked out using a CRISPR / Cas9 knockout vector and transformed into rice plants.
[0012] Preferably, the CRISPR / Cas9 knockout vector is pYLCRISPR / Cas9-LOX3.
[0013] Preferably, the method specifically includes the following steps: S1. Targeting OsLOX3 Gene design to knock out target sites and construct sgRNA expression cassettes; S2. The sgRNA expression cassette was ligated into the pYLCRISPR / Cas9 vector with the binary vector pCAMBIA-1300 as the backbone to construct the pYLCRISPR / Cas9-LOX3 knockout vector. S3. Transforming pYLCRISPR / Cas9-LOX3 knockout vector into rice tissue, and culturing to obtain OsLOX3 Rice plants with gene mutation.
[0014] Preferably, the sequence of the knockout target site in step S1 is shown as SEQ ID No. 3.
[0015] Preferably, the PCR amplification primers of the sgRNA expression cassette in step S1 are shown as SEQ ID No. 4-5, respectively.
[0016] Preferably, the transformation is by Agrobacterium-mediated transformation or biolistic-mediated transformation.
[0017] Compared with the prior art, the present application has the following beneficial effects: The present application provides OsLOX3 Application of the gene in regulating rice yield. The present application constructs OsLOX3 CRISPR / Cas9 knockout expression vector of the gene and transforms the receptor plant callus, and cultures to obtain OsLOX3 Rice plants with gene mutation; the phenotype results show that, compared with wild type rice plants, OsLOX3 The spike length, primary branch, secondary branch and yield per plant of the mutant rice are significantly increased. It is shown that OsLOX3 is a negative regulatory gene of rice yield. Therefore, the expression regulation of OsLOX3 can be used to increase rice yield, and helps to provide a brand new and simple and effective method for high-yield rice variety breeding. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 For OsLOX3 Knockout target and genotype detection of OsLOX3 mutant. Among them, Figure 1 a is OsLOX3 Gene knockout target site; b is OsLOX3 mutant Oslox3-1 , Oslox3-2 Compared with the nucleotide sequence around the target site of the wild type rice.
[0019] Figure 2 For OsLOX3 Statistical results of agronomic trait results of the gene strain. Among them, Figure 2 a is the comparison of spike length between wild type and mutant; b is the comparison of primary branch number between wild type and mutant; c is the comparison of whole plant between wild type and mutant, wherein the left is wild type, and the right is CRISPR-Cas9 technology knockout OsLOX3The mutant strains are shown in Figure 1. d represents a comparison of the number of secondary branches between the wild type and the mutant strain; e represents a comparison of the seed setting rate between the wild type and the mutant strain; f and g represent the single-ear morphology of the wild type and the mutant strain, where the left side represents the wild type and the right side represents the mutant strain with OsLOX3 knocked out using CRISPR-Cas9 technology; h represents a comparison of the yield per plant between the wild type and the mutant strain; i represents the single-ear shape of the wild type and the mutant strain, where the left side represents the wild type and the right side represents the mutant strain with OsLOX3 knocked out using CRISPR-Cas9 technology. OsLOX3 The mutant strain is shown in image j; images of single-plant yields of wild-type and mutant strains are shown, with the wild-type on the left and the CRISPR-Cas9 knockout strain on the right. OsLOX3 The mutant strains. * and ** indicate that the gene-edited knockout strains and WT were significantly different at the P<0.05 and P<0.01 levels, respectively, with c Bar=10cm; f, g, i, j Bar=5cm. Detailed Implementation
[0020] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.
[0021] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.
[0022] Example 1 OsLOX3 Obtaining knockout genetically modified rice 1. Construction of CRISPR / Cas9 rice knockout vector Design using the CRISPR target site design website E-CRISPR (http: / / www.e-crisp.org / E-CRISP / ). OsLOX3 Gene (gene sequence as shown in SEQ ID No. 1, encoding amino acid sequence as shown in SEQ ID No. 2) single knockout target (e.g. Figure 1 a) The target sequence is GCTCCCGACAACGTCCATGAGG (SEQ ID No. 3); the amplification primers for the corresponding sgRNA are: OsLOX3-cas9-F: 5'-cagGCTCCTCGACAACGTCCATG-3' (SEQ ID No. 4); OsLOX3-cas9-R: 5'-aacCATGGACGTTGTCGAGGAGC-3' (SEQ ID No. 5). An sgRNA expression cassette was constructed using these primers. The expression cassette was ligated into the pYLCRISPR / Cas9 vector with the binary vector pCAMBIA-1300 as its backbone and transformed into *E. coli* to complete the process. OsLOX3Construction of knockout plasmid. The experimental operation here uses the conventional technology in the field. The vectors, reagents, etc. involved in the experiment are commercially available.
[0023] 2. Agrobacterium-mediated transformation of rice CRISPR / Cas9 knockout vector Transformation of wild type GDR998 Callus, pre-culture, infection, co-culture, selection of resistant callus, differentiation, rooting, seedling, and transgenic plants are obtained by transplanting.
[0024] (1) Select full mature seeds, shell, and shake in 2.5% NaClO solution for 45 min at 180 rpm. Rinse with sterile water for 3-5 times, air dry, and place on induction medium at 26°C in the dark for 4 weeks, with subculture every 15 days.
[0025] (2) Agrobacterium containing pYLCRISPR / Cas9- LOX3 Knockout vector is streaked on LB medium and incubated at 28°C in the dark for 3 days.
[0026] (3) Pick a single colony and inoculate into 5 ml of LB liquid medium containing antibiotics, and incubate at 28°C overnight.
[0027] (4) Centrifuge fresh Agrobacterium culture, collect (at a moderate concentration), and place in AAM liquid medium, and incubate at 26°C in the dark for 2-5 h.
[0028] (5) Select dense callus particles (3-5 mm in diameter) for transformation. Incubate the callus particles to be transformed in the prepared AAM bacterial solution for 5 min, discard the Agrobacterium suspension, use sterile filter paper to absorb the excess bacterial solution on the callus, and then transfer to solid co-culture medium with a layer of sterile filter paper, and incubate at 28°C in the dark for 3 days.
[0029] (6) After co-culture, wash with sterile water for 3 times, rinse with AAM medium once, dry the callus, and then transfer the callus to the selection medium containing antibiotics for screening for 1 month.
[0030] (7) Transfer the resistant callus after screening to the differentiation medium containing antibiotics and continue to incubate at 26°C under light conditions until green shoots are differentiated. Transfer the seedlings to the rooting medium containing antibiotics, remove the seedlings from the rooting medium, wash the residual medium, and acclimate the seedlings in water. When white new roots grow, transplant them to the greenhouse or field.
[0031] 3. Detection of transgenic positive rice lines and screening of mutant plants Using Agrobacterium-mediated rice transgenic method, the callus of Guangkui 998 was transformed, and 8 independent transformation lines were obtained through hygromycin selection. The total DNA of rice leaves was extracted by CTAB method, and PCR amplification was performed using 2x Taq Master Mix and hygromycin detection primers hpt-t / F and hpt-t / R according to the following system. The sequences of the detection primers hpt-t / F and hpt-t / R are as follows: hpt-t / F: 5'-GATGTTGGCGACCTCGTATTGG-3' (SEQ ID No. 6); hpt-t / R: 5'-CGTGCTTTCAGCTTCGATGTAGGAG-3' (SEQ ID No. 7).
[0032] The PCR reaction system is as follows: DNA template 0.5 μL, 2x Taq Master Mix 10 μL, SP1 0.5 μL, SP2 0.5 μL, ddH2O 8.5 μL. The PCR program is set as follows: 95°C for 3 min, 95°C for 15 s, 56°C for 20 s, 72°C for 1 min, 72°C for 5 min, and 16°C hold. In the program, the second step (denaturation) to the fourth step (extension) are performed for 30 cycles.
[0033] After the PCR, the amplification products were subjected to 1% agarose gel electrophoresis, and whether a 600 bp band was produced for each plant was observed. If the target band is produced, it indicates that the knockout vector has been integrated into the chromosome of the plant corresponding to the template DNA. The T0 transgenic plants were detected by hygromycin specific primers, and 5 transgenic positive single plants were obtained.
[0034] The type of mutant plant was identified, and mutant detection primers OsLOX3 T0-S and OsLOX3 T0-A were designed using Primer Premier5 at the upstream and downstream positions of the target site sequence, and their sequences are as follows: OsLOX3 T0-S: 5'-AGTTCTTCCCCATCCATTG-3' (SEQ ID No. 8); OsLOX3 T0-A: 5'-CCTTGATTCTTTCTACATAGCA-3' (SEQ ID No. 9).
[0035] The DNA of the positive plants was extracted, and PCR reaction was performed using 2x green Mix and primers OsLOX3 T0-S and OsLOX3 T0-A according to the following system: 25 μL PCR reaction system: 0.5 μL DNA template, 22.5 μL 2x Gold Mix, 1 μL 718-F, 1 μL 718-R. PCR program settings: 98℃ 2min; 98℃ 10s, 56℃ 15s, 72℃ 10s, 72℃ 7min; 16℃ 10min. The second step is 30-35 cycles.
[0036] After PCR amplification, 1% agarose gel electrophoresis was performed, the target band was purified and recovered using a kit, then T19 simple vector was connected, E. coli DH5α was transformed, 10 single clones were picked from each single strain, and sequencing was performed by Genescript Biotech (Shanghai) Co., Ltd.; the sequencing results of the mutant and wild type were compared by SnapGene software.
[0037] The mutants obtained by CRISPR / Cas9 technology are reported to be divided into three categories: double homozygous mutation, double heterozygous mutation and single chromosome mutation.
[0038] 4. Identification of mutant strains without transgenic sequences: The T1 single strain of the mutant strain was subjected to PCR amplification with primers hpt-F / hpt-R, and the plant which could not amplify the target fragment of the vector was a mutant strain without transgenic sequences. At the same time, the target site amplification primers were used to detect the mutation of the T1 plants. A total of 5 single strains were screened which were negative for Cas9 and Hpt gene detection, and the T1 of which detected 4 homozygous single strains, all of which showed deletion of 1bp; Oslox3-1 1 homozygous single strain was detected, which inserted 1bp Oslox3-2 b). The 5 homozygous single strains screened without transgenic elements were bagged and seeds were collected. Figure 1
[0039] Example 2 Investigation of agronomic traits of transgenic rice knock-out The agronomic traits of wild type rice plants Guanghui998 and T2 generation OsLOX3 mutant homozygous plants Oslox3-1, Oslox3-2 were investigated. The results are shown in Figure 2 Among the two different genotypes of mutant rice materials obtained, Oslox3-1 the ear length of the mutant plant was (26.5±0.5) cm, Oslox3-2 the ear length of the mutant plant was (27.1±0.3) cm, which was significantly longer than that of the wild type (23.9±0.5) cm Figure 2 a, 2f, 2g); Figure 2 c is the comparison of wild type and mutant, wherein the left is wild type and the right is mutant knocked out by CRISPR-Cas9 technology Oslox3 , indicating that Oslox3 The mutant plants were higher than the WT plants.
[0040] Oslox3-1 The primary branch of the mutant plants was (11.7±0.1) branches, Oslox3-2 The primary branch of the mutant plants was (12.0±0.4) branches, significantly more than the wild type (10.8±0.1) branches ( Figure 2 b、2i); Oslox3-1 The secondary branch of the mutant plants was (42.2±0.7) branches, which had no significant difference with the wild type (41.3±0.4) branches, Oslox3-2 The secondary branch of the mutant plants was (44.8±0.7) branches, significantly higher than the wild type (41.3±0.4) branches ( Figure 2 d); Oslox3-1 The seed setting rate of the mutant plants had no significant difference with the wild type ( Figure 2 e); Notably, in terms of the theoretical yield per plant, Oslox3-1 and Oslox3-2 The mutant plants were (33.2±0.3, 35.8±0.2) g, which was significantly improved compared with the wild type (30.7±0.2) g ( Figure 2 h、2j). It is shown that OsLOX3 is a negative regulatory gene of rice yield. By regulating the expression of OsLOX3 , rice yield can be improved, which provides a new and simple and effective method for high-yield rice variety breeding.
Claims
1. OsLOX3 The use of a gene in modulating yield in rice, characterized in that, The OsLOX3 The nucleotide sequence of the gene is selected from one of the sequences of the following group: (a) the nucleotide sequence as shown in SEQ ID No. 1; (b) the nucleotide sequence encoding the protein of the amino acid sequence as shown in SEQ ID No. 2; (c) the nucleotide sequence complementary to the nucleotide sequence of any one of (a)-(b).
2. Use according to claim 1, characterized in that, The regulating rice yield is regulating panicle length, primary branch, secondary branch and yield per plant.
3. Use according to claim 2, characterized in that, The regulating rice yield is increasing rice yield; the increasing rice yield is making panicle length longer, primary branch and secondary branch more and yield per plant higher.
4. OsLOX3 Use of knock-out vectors or plasmids of genes in creating yield- improved rice varieties.
5. A method for increasing yield in rice, characterized by, To knock out a gene in rice and thereby obtain a mutant plant with increased yield OsLOX3 The nucleotide sequence of the gene is selected from one of the following sequences: OsLOX3 The nucleotide sequence of the gene is selected from one of the following sequences: (a) the nucleotide sequence as shown in SEQ ID No. 1; (b) the nucleotide sequence encoding the protein of the amino acid sequence as shown in SEQ ID No. 2; (c) the nucleotide sequence complementary to the nucleotide sequence of any one of (a)-(b).
6. The method of claim 5, wherein, The knockout of the genes in rice OsLOX3 The CRISPR / Cas9 knockout vectors for the genes were constructed OsLOX3 The CRISPR / Cas9 knockout vectors for the genes were constructed and transformed into rice plants.
7. The method of claim 6, wherein, The CRISPR / Cas9 knockout vector is pYLCRISPR / Cas9-LOX3.
8. The method of claim 7, wherein, The method specifically comprises the following steps: S1. For each target gene, design a knockout target site and construct an sgRNA expression cassette. OsLOX3 Gene design knockout target sites and construct sgRNA expression cassettes; S2. Connecting the sgRNA expression cassette into the pYLCRISPR / Cas9 vector with the backbone of the binary vector pCAMBIA-1300 to obtain the pYLCRISPR / Cas9-LOX3 knockout vector; S3. Transform pYLCRISPR / Cas9-LOX3 knock-out vector into rice tissue, and culture to obtain OsLOX3 Rice plants with genetic mutations.
9. The method of claim 8, wherein, The sequence of the knockout target site in step S1 is shown as SEQ ID No.
3.
10. The method of claim 8, wherein, The PCR amplification primers of the sgRNA expression cassette in step S1 are shown as SEQ ID No. 4-5, respectively.