Application of wheat TaqW-6B gene in regulating and controlling content of water-soluble araboxylan in grains

By overexpressing the wheat TaqW-6B gene and utilizing recombinant overexpression vectors and CRISPR-Cas9 technology, the unclear problem of regulating the content of water-soluble arabinoxylan was solved, and the content of water-soluble arabinoxylan in grains was significantly increased or decreased, providing a new wheat variety breeding program.

CN120989148APending Publication Date: 2025-11-21THE SHENNONG LABORATORY +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511514240.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-22
Publication Date
2025-11-21

AI Technical Summary

Technical Problem

The biological functions and molecular mechanisms of genes related to water-soluble arabinoxylan content are unclear in the existing technology, and there is a lack of gene resources that can effectively regulate the content of water-soluble arabinoxylan in grains.

Method used

By overexpressing the wheat TaqW-6B gene, and using a recombinant overexpression vector and CRISPR-Cas9 technology, the synthesis of water-soluble arabinoxylan in wheat grains can be regulated to efficiently increase or decrease its content.

Benefits of technology

Significantly increasing or decreasing the content of water-soluble arabinoxylan in wheat grains provides genetic resources and molecular tools for breeding wheat varieties with high or low WE-AX content.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120989148A_ABST
    Figure CN120989148A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of plant genetic breeding, in particular to application of a wheat TaqW-6B gene in regulating and controlling the content of water-soluble araboxylan in grains. Researches find that the wheat TaqW-6B gene can regulate and control the WE-AX content in wheat grains, the TaqW-6B gene is over-expressed in wheat plants, and the WE-AX content in the wheat grains can be remarkably increased; the gene is knocked out of wheat, so that the WE-AX content of wheat grains is remarkably reduced. Therefore, the gene can be used for cultivating new wheat varieties.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the field of plant genetic breeding technology, and particularly relates to application of a wheat TaqW-6B gene in regulating content of grain water-soluble arabinoxylan. BACKGROUND

[0002] Wheat grain water-soluble arabinoxylan (WE-AX) is a kind of non-starch polysaccharide widely distributed in endosperm, aleurone layer, bran and hull, and has excellent water-holding capacity, viscosity characteristics and oxidative gelation capacity. As an important component of dietary fiber, WE-AX has various physiological functions such as regulating blood glucose, improving cholesterol metabolism, antioxidant, enhancing immunity and promoting proliferation of intestinal beneficial bacteria due to its unique physicochemical properties and immunomodulatory activity. Appropriate intake of whole grain products not only helps to control postprandial blood glucose level, but also can significantly reduce the risk of chronic diseases such as diabetes, hyperlipidemia and coronary heart disease. These characteristics make WE-AX an important object of research and development of functional foods and nutritional supplements, and show broad application prospects in the fields of food and medicine. However, the biological function and molecular mechanism of the gene related to the content of water-soluble arabinoxylan are still unclear. Therefore, it is of great significance to explore and utilize the gene resources related to the content of water-soluble arabinoxylan for breeding wheat varieties with high WE-AX content. SUMMARY

[0003] In order to make up for the defects and deficiencies in the prior art, the application provides application of a wheat grain water-soluble arabinoxylan content related TaqW-6B gene in regulating content of grain water-soluble arabinoxylan. Overexpression of the gene can significantly increase the content of wheat grain WE-AX, thereby providing new gene resources and molecular tools for screening WE-AX-rich germplasm resources.

[0004] The technical scheme adopted by the application is as follows: application of a wheat TaqW-6B gene in regulating content of grain water-soluble arabinoxylan; the wheat TaqW-6B gene positively regulates synthesis of wheat grain water-soluble arabinoxylan.

[0005] The application further provides a method for increasing content of wheat grain water-soluble arabinoxylan, which increases the content of wheat grain water-soluble arabinoxylan by overexpression of wheat.

[0006] Preferably, the recombinant overexpression vector for overexpressing the wheat TaqW-6B gene is constructed by specifically amplifying primers connecting homologous arms with a cloning vector plasmid as a template; after linearizing the overexpression vector, the CDS homologous arm fragment of the wheat TaqW-6B gene is homologously recombined into the overexpression vector; the CDS sequence of the wheat TaqW-6B gene is shown in SEQ ID NO. 5; and the sequences of the primers connecting the homologous arms are shown in SEQ ID NO. 7 and 8.

[0007] The application also provides a recombinant overexpression vector for overexpressing a wheat TaqW-6B gene, wherein the recombinant overexpression vector comprises a CDS sequence of the wheat TaqW-6B gene; the CDS sequence is homologously recombined into the overexpression vector through a homologous arm fragment; and the CDS sequence of the wheat TaqW-6B gene is shown in SEQ ID NO. 5.

[0008] The application also provides a reagent or kit for increasing the content of water-soluble arabinoxylan in wheat kernels, wherein the reagent or kit comprises the sequences of primers connecting homologous arms, as shown in SEQ ID NO. 7 and 8.

[0009] The application also provides a method for cultivating wheat plants with high or low content of water-soluble arabinoxylan in wheat kernels, by up-regulating or down-regulating the expression of a TaqW-6B gene in a wheat sample to obtain plants with high or low content of water-soluble arabinoxylan in wheat kernels.

[0010] The application discloses a wheat TaqW-6B gene that can regulate the content of WE-AX in wheat kernels, and overexpressing the TaqW-6B gene in wheat plants can significantly increase the content of WE-AX in wheat kernels; knocking out the gene in wheat can significantly reduce the content of WE-AX in wheat kernels. Therefore, the gene can be used to cultivate new wheat varieties. BRIEF DESCRIPTION OF DRAWINGS

[0011] Figure 1 Figure for the overexpression vector Pwmb110 in the examples of the application; Figure 2 Figure for the intermediate vector TaU3 Figure 3 Figure for the gene knockout final vector 110-Cas9-SgRNA-Rdg2b Figure 4 Identification of overexpression lines and gene editing lines; wherein (a) PCR positive identification of T1 generation plants of the overexpression lines; (b) expression amount of genes in the overexpression lines; (c) PCR positive identification of T1 generation plants of the gene editing lines; (d) sequencing analysis of three gene editing lines (KO1, KO2 and KO3). Figure 5 To identify the WE-AX content in wheat grains of the TaqW-6B transgenic lines; (a) overexpression lines; (b) gene-edited (knockout) lines. Detailed Implementation

[0012] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments. It should be noted that the following specific embodiments are merely illustrative of the invention and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present invention in any way.

[0013] Example 1: Cloning of the CDS sequence of the wheat TaqW-6B gene 1. Discovery of the wheat TaqW-6B gene Based on previous research by Li et al., by integrating genome-wide association analysis and linkage analysis, we identified a novel major locus, QWE-AX.haust-6B, on wheat chromosome 6BL that regulates the content of water-soluble arabinoxylan (WE-AX) in grains. Linkage analysis in the AC population initially located this locus between markers 3944740–4991038 (physical location 459.38–572.09 Mb), explaining 8.51–15.59% of the phenotypic variation. Further association analysis in the CH population narrowed the candidate interval to 516.47–571.58 Mb. KASP markers KASP-6B-3 (561.6 Mb) and KASP-6B-6 (557.8 Mb), developed based on this interval, were validated in the AC population and showed strong linkage to this locus, ultimately finely mapping QWE-AX.haust-6B to a physical interval of 3.8 Mb. A total of 23 high-confidence genes were annotated within this interval, among which TraesCS6B02G312000 encodes an aspartic protease family protein, the expression product of which has xylanase inhibitory function (Li, Q., Zeng, Z., Zhao, Y. et al. Genome-wide association study and linkage mapping reveal TaqW-6B associated with water-extractable arabinoxylancontent in wheat grain[J]. Theor Appl Genet 2024, 137, 166.).

[0014] 2. Cloning of the TaqW-6B gene The total RNA of wheat grains was extracted from the wheat grains of Avocet (a female parent material with high content in AC population) at about 14 days after flowering using FastPure Universal Plant Total RNA Isolation Kit kit (Novozyme, Nanjing), and cDNA was obtained by reverse transcription using HiScript III RT SuperMix for qPCR (+gDNA wiper) kit (Novozyme, Nanjing). The primers TaqW-6B-CDS-F and TaqW-6B-CDS-R were designed, and the CDS sequence of 1416 bp of TaqW-6B gene was obtained by PCR amplification using cDNA as a template.

[0015] TaqW-6B-CDS-F: 5'-CCCATAGCCTGCACTGAGCC-3' (SEQ ID NO. 1); TaqW-6B-CDS-R: 5'-CGGCGAATGATTTACACTCAAA-3' (SEQ ID NO. 2).

[0016] The high-fidelity enzyme 2xPhanta Flash Master Mix (Dye Plus) with high amplification efficiency was used for PCR amplification in a 20 μL system: 10 μL of 2xPhanta Flash Master Mix (Dye Plus), 0.8 μL of upstream primer (10 μM), 0.8 μL of downstream primer (10 μM), 1 μL of template (50-100 ng), and 7.4 μL of ddH2O. The PCR reaction conditions were set as follows: initial pre-denaturation at 98 ℃ for 30 sec; followed by 35 cycles of reaction (98 ℃ denaturation for 10 sec, 60 ℃ annealing for 5 sec, and 72 ℃ extension for 20 sec); 72 ℃ extension for 1 min; and 4 ℃ storage of the amplification product.

[0017] The PCR product was mixed with the same volume of 6xDNA loading Buffer, and 1.0% agarose gel electrophoresis was used for detection and analysis. After electrophoresis, the gel block containing the target band was cut from the gel, and DNA recovery and purification were performed according to the steps of the FastPure Gel DNA Extraction Mini Kit gel recovery / DNA purification kit (Novozyme, Nanjing).

[0018] 3 μL of PCR product was mixed with 2 μL of cloning vector plasmid (Ultra-Universal TOPO Cloning Kit) (Novagen, Nanjing) and 5 μL of ddH2O, and incubated at 25 °C for 5 min to complete the ligation reaction, and then immediately cooled on ice. The ligation product was added to 100 μL of competent cells, mixed gently, and after ice bath for 30 min, 42 °C water bath heat shock for 45 sec, quickly moved to ice for 2 min, and during this period avoid shaking the tube. 900 μL of LB liquid medium without antibiotics was added to the centrifuge tube, mixed, and then incubated at 37 °C, 200 rpm for 1 h. The bacterial cells were collected by centrifugation (5000 rpm, 3 min), and 900 μL of supernatant was removed. The bacterial cells were resuspended with the remaining culture medium, and then all were plated on LB solid medium containing 50 mg / L ampicillin. The plate was first placed at 37 °C for about 10 min until the liquid was absorbed, and then inverted and cultured for 15-16 h. When the single colony grew to the appropriate size, a single clone was picked and inoculated into a 1 mL centrifuge tube of LB liquid medium (containing 1 / 1000 volume of 50 mg / L ampicillin), and incubated at 37 °C for 8-10 h.

[0019] PCR verification was performed on the bacterial solution using M13 universal primers, and the primer sequences were as follows: M13F: 5'-GTAAAACGACGGCCAGT-3' (SEQ ID NO. 3); M13R: 5'-CAGGAAACAGCTATGAC-3' (SEQ ID NO. 4).

[0020] If the PCR result was positive and contained the expected fragment, sequencing was performed. The sequencing results showed that the CDS sequence of the amplified TaqW-6B gene was as shown in SEQ ID NO. 5, and by translation, the TaqW-6B protein sequence encoded by the TaqW-6B gene was as shown in SEQ ID NO. 6.

[0021]

[0022] The protein sequence encoded by TaqW-6B gene is specifically as follows: MAPASLPLLVAAFSLLFAAATPIRDVADACSSQVQAADFEHLNSTAMHLPLHHSRGPCSPVSVPSDLPFSAVLTHDDARIASLAARLAKAPSSSTARPMVTVASLYRANDKVDGVAASLASVPLTPGTSYGVGNYVTRMGLGTPAKPYIMVVDTGSSLTWLQCSPCRVSCHRQSGPVFDPKTSSSYAAVSCSTPQCNDLSTATLNPAACSSSDVCIYQASYGDSSFSVGYLSKDTVSFGSNSVPNFYYGCGQDNEGLFGRSAGLMGLARNKLSLLYQLAPTLGYSFSYCLPSSSSSGYLSIGSYNPGQYSYTPMVSSTLDDSLYFIKLSGMTVAGKPLAISSSEYSSLPTIIDSGTVITRLPTTVYDSLSKAVAGAMKGTKRADAYSILDTCFVGQASSLRVPAVSMGFSGGAALKLSAQNLLVDVDSSTTCLAFAPARSAAIIGNTQQQTFSVVYDVKSNRIGFAAGGCR (SEQ ID NO. 6).

[0023] Example 2 Preparation of wheat TaqW-6B transgenic material Following the method of Ishida et al., an Agrobacterium-mediated transformation system for immature wheat embryos was used, with immature embryos of the wheat variety Zhengmai 1860 (WT) 14 days after flowering as explants for transformation (Ishida Y, Tsunashima M, Hiei Y, Komari T. Wheat (Triticum aestivum L). transformation using immature embryos. Methods Mol Biol. 2015, 1223: 189-198.). Agrobacterium EHA105 carrying the target gene overexpression vector (pWMB110-TaqW-6B) and the CRISPR-Cas9 knockout vector (110-Cas9-6BsgRNA-Rdg2b) was introduced into the recipient wheat variety Zhengmai 1860 using Agrobacterium-mediated transformation. Overexpressing plants of the TaqW-6B gene (1860-TaqW-6B-OE) and gene-edited knockout plants (1860-TaqW-6B-Cas) were obtained. The overexpression vector pWMB110 and the gene editing vector 110-Cas9sgRNA-Rdg2b were the original empty vectors. For details of the vectors, please refer to the literature published by Liu et al. (Liu H, Wang K, Jia Z, et al. Efficient induction of haploid plants in wheat by editing of TaMTL using an optimized Agrobacterium-mediated CRISPR system[J]. J Exp Bot. 2020; 71(4):1337-1349.).

[0024] 1. Construction of the recombinant overexpression vector pWMB110-TaqW-6B After confirmation of the correct clone via sequencing, homologous arm ligation primers (TaqW-6B-110bamF / TaqW-6B-110sacR) were designed using CE Design V1.04 software. Using the cloning vector plasmid as a template, specific amplification was performed using the primers ligating the homologous arms. Electrophoresis was performed after amplification. Once the PCR amplification band was identified, the target band was excised and recovered from the gel. The pWMB110 overexpression vector (…) was then processed using BamHI and SacI restriction enzymes. Figure 1 Linearization was performed, and the CDS homologous arm fragment was homologously recombined into the overexpression vector pWMB110 according to the instructions of the Clon Express II OneStep Cloning Kit (Novozymes, Nanjing) to complete the construction of the overexpression vector pWMB110-TaqW-6B.

[0025] TaqW-6B-110sacR: ACGATCGGGGAAATTCGGCGAATGATTTACACTCAAA (SEQ ID NO. 8). TaqW-6B-110sacR: ACGATCGGGGAAATTCGGCGAATGATTTACACTCAAA (SEQ ID NO. 8).

[0026] 2. TaqW-6B gene editing vector 110-Cas9-6Bsg RNA-Rdg2b construction According to the sequence information of the wheat TaqW-6B gene, two specific target sites (dCAPS Finder 2.0: http: / / helix.wustl.edu / dcaps / dcaps.html) were designed on the first and second exons of the TaqW-6B gene using the CRISPR-Cas9 method, and the target site sequences were TaqW-6B-gRNA1: 5'-[CCC]TGCTCTTCGCCGCGGCGACT-3' (SEQ ID NO. 9) and TaqW-6B-gRNA2: 5'-[CCC]TTCTCGGCGGTGCTCACCCA-3' (SEQ ID NO. 10). The intermediate vector TaU3 plasmid (pUC57-TaqW-6B) was used as a template, and the TaqW-6Bsg RNA sequence was amplified using U-F, gR-R, TaqW-6B-sgRNAF, and TaqW-6B-sgRNAR as primers. The designed target was inserted into the Blunt-TaU3 intermediate vector, and the first round of PCR was performed: 2-5 ng of TaU3 plasmid was used as a template, and four primers were used in the reaction: U-F and gR-R were each 0.2 μM, and TaqW-6B-sgRNAF and TaqW-6B-sgRNAR were each 0.1 μM. 25-28 cycles (94 ℃, 10 s; 58 ℃, 15 s; 68 ℃, 20 s). Then, ZWHind-UF and ZWHindR were used as primers to amplify the fragment containing the homologous arm of the Cas9 vector, and the sgRNA sequence containing the TaU3 promoter was amplified from the intermediate vector. The second round of PCR was performed: 1 μL of the first round of PCR product was diluted 10 times with H2O, and 1 μL was used as a template, 28-30 cycles (94 ℃, 10 s; 58 ℃, 15 s; 68 ℃, 20 s). Gel detection, gel purification, and fragment recovery. HindIII enzyme digestion, 37 ℃ enzyme digestion for 4 h, linearization of the gene knockout final vector 110-Cas9-SgRNA-Rdg2b (pUC57-TaqW-6B-110-Cas9-6Bsg RNA-Rdg2b) (Fig. 2). Figure 2 ), using U-F, gR-R, TaqW-6B-sgRNAF, and TaqW-6B-sgRNAR as primers to amplify the TaqW-6Bsg RNA sequence, and the designed target was inserted into the Blunt-TaU3 intermediate vector. The first round of PCR was performed: 2-5 ng of TaU3 plasmid was used as a template, and four primers were used in the reaction: U-F and gR-R were each 0.2 μM, and TaqW-6B-sgRNAF and TaqW-6B-sgRNAR were each 0.1 μM. 25-28 cycles (94 ℃, 10 s; 58 ℃, 15 s; 68 ℃, 20 s). Then, ZWHind-UF and ZWHindR were used as primers to amplify the fragment containing the homologous arm of the Cas9 vector, and the sgRNA sequence containing the TaU3 promoter was amplified from the intermediate vector. The second round of PCR was performed: 1 μL of the first round of PCR product was diluted 10 times with H2O, and 1 μL was used as a template, 28-30 cycles (94 ℃, 10 s; 58 ℃, 15 s; 68 ℃, 20 s). Gel detection, gel purification, and fragment recovery. HindIII enzyme digestion, 37 ℃ enzyme digestion for 4 h, linearization of the gene knockout final vector 110-Cas9-SgRNA-Rdg2b (pUC57-TaqW-6B-110-Cas9-6Bsg RNA-Rdg2b) (Fig. 2). Figure 3), purified vector (200-400 ng), fragments (100-200 ng), and connected with Infusion enzyme (37 ℃, 15 min; 50 ℃, 15 min). The connection was to the Hind III enzyme-digested final vector 110-Cas9-SgRNA-Rdg2b, and the construction of the knockout vector 110-Cas9-6Bsg RNA-Rdg2b vector was completed. The primer sequences are as follows: U-F: CTCCGTTTTACCTGTGGAATCG (SEQ ID NO. 11); gR-R: CGGAGGAAAATTCCATCCAC (SEQ ID NO. 12); TaqW-6B-sgRNA1F: TGGGTGAGCACCGCCGAGAAgttttagagctagaaat (SEQ ID NO. 13); TaqW-6B-sgRNA1R: TTCTCGGCGGTGCTCACCCATGCTTCTTGGTGCCGCGCCTCC (SEQ ID NO. 14); TaqW-6B-sgRNA2F: GTCGCCGCGGCGAAGAGCAgttttagagctagaaat (SEQ ID NO. 15); TaqW-6B-sgRNA2R: TGCTCTTCGCCGCGGCGACTGCTTCTTGGTGCCGCGCCTCC (SEQ ID NO. 16); ZWHind-UF: CTGCACTGCAGGCATGCAAGCTTAGTATGGAATCGGCAGCAAAGG (SEQ ID NO. 17); ZWHindR: AAACGACGGCCAGTGCCAAGCTTACGCGTATCCATCCACTCCAAGCTCTTG (SEQ ID NO. 18).

[0027] 3. Identification of positive transgenic plants The primer Ubi1899-F and TaqW-6B_CDS-R are used for positive identification of the vector of the overexpression positive plants (1860-TaqW-6B-OE), and then the fluorescent quantitative PCR primer (TaqW-6B-qRT-F / R) is used for gene expression difference identification. A small amount of leaf genomic DNA of the gene editing plant is extracted, the primer TaU3F and CeHindR are used for positive identification of the vector of the gene knockout mutant plant, and then the primer (TaqW-6B) A / B / D1-F and (TaqW-6B) A / B / D1-R, (TaqW-6B) A / B / D2-F and (TaqW-6B) A / B / D2-R are used for PCR amplification and cloning sequencing to identify the editing of the 1860-TaqW-6B-Cas9 target sequence of the gene knockout mutant plant. The 200-300 bp fragment primer containing the target point is designed, the sequence is amplified and sequenced, and the knockout site of the transgenic plant is analyzed. The sequence is sent to the high-throughput tracking platform Hi-TOM (http: / / www.hi-tom.net / hi-tom / ) of the CRISPR / Cas system induced mutation for sequence identification, and the editing type is determined after comparing the wild type wheat sequence to verify whether the knockout target is effective. The following is the primer sequence information: Ubi1899-F: TTTAGCCCTGCCTTCATACGCT (SEQ ID NO. 19); TaqW-6B_CDS-R: CGGCGAATGATTTACACTCAAA (SEQ ID NO. 20); TaqW-6B-qRT-F: TACCGGGCGAACGACAAA (SEQ ID NO. 21); TaqW-6B-qRT-R: CATGATGTACGGTTTGGCC (SEQ ID NO. 22); TaU3F: GAATTCATCCTCACGTTCAACACC (SEQ ID NO. 23); CeHindR: AAGGCGGGAAACGACAATCTG (SEQ ID NO. 24); (TaqW-6B)B1-6A-F: CTAACGATACGATACGCACGAC (SEQ ID NO. 25); (TaqW-6B)B1-6A-R: TGAGGTAGCCCACGGAGAAG (SEQ ID NO. 26); (TaqW-6B) B1-6B-F: GCGGCAAACTAATTCGTACTGTAC (SEQ ID NO. 27); (TaqW-6B) B1-6B-R: GATGACGGGAGGCAGTAGGA (SEQ ID NO. 28); (TaqW-6B) B1-6D-F: GAAAGGAGATGACGGACAGGA (SEQ ID NO. 29); (TaqW-6B) B1-6D-R: GAACACTGGAGCCAGGTGAG (SEQ ID NO. 30); (TaqW-6B) B2-6A-F: TGCTATCTATCCACCCACCC (SEQ ID NO. 31); (TaqW-6B) B2-6A-R: CGGTGTTACTACTTCGGTTCAG (SEQ ID NO. 32); (TaqW-6B) B2-6B-F: GGAGCCACGGGAGTATCAA (SEQ ID NO. 33); (TaqW-6B) B2-6B-R: TTCCAGGAGTCAGGACAGCA (SEQ ID NO. 34); (TaqW-6B) B2-6D-F: GTCACATATCGTTTTGGTAATCCG (SEQ ID NO. 35); (TaqW-6B) B2-6D-R: TTGACAGTTACAGACGCTTTAGACA (SEQ ID NO. 36).

[0028] PCR positive identification was carried out on T1 generation plants by overexpression, and 3 strains (OE1, OE2 and OE3) were selected from TaqW-6B-T1 generation transgenic plants, and wild type plants were used as controls. At 14 days after flowering, the expression amount in the overexpression plants was about 10-35 times that of the wild type, indicating that the TaqW-6B gene in the transgenic strain achieved efficient overexpression, as shown in FIGS. 1(a) and (b). Figure 4 PCR positive identification was carried out on T1 generation plants by overexpression, and 3 strains (OE1, OE2 and OE3) were selected from TaqW-6B-T1 generation transgenic plants, and wild type plants were used as controls. At 14 days after flowering, the expression amount in the overexpression plants was about 10-35 times that of the wild type, indicating that the TaqW-6B gene in the transgenic strain achieved efficient overexpression, as shown in FIGS. 1(a) and (b). Figure 4The middle (c) was subjected to PCR extension and sequencing analysis to identify the gene editing type, and finally 3 gene editing lines (KO1, KO2 and KO3) were obtained, including three-hit editing line taqw-6b-Cas9aabbdd (KO1), two-hit editing line taqw-6b-Cas9AAbbdd (KO2) and two-hit editing line taqw-6b-Cas9aaBBdd (KO3). The KO1 line produces a frameshift mutation at target site 2 on the A genome; causes premature termination of amino acids at target site 2 on the B genome; and causes a frameshift mutation of amino acids at target site 1 on the D genome. The KO2 line causes premature termination of amino acids at target site 2 on the B genome; and causes a frameshift mutation of amino acids at target site 2 on the D genome. The KO3 line causes a frameshift mutation of amino acids at target site 2 on the A genome; and causes a frameshift mutation of amino acids at target site 2 on the D genome (KO3) as Figure 4 The middle (d).

[0029] Example 3 Identification of WE-AX content in wheat TaqW-6B transgenic material grains According to the method for determining the content of WE-AX in wheat grains by Yang Li et al., the WE-AX in wheat grains of T1 overexpression line materials 1860-TaqW-6B-OE (OE1, OE2 and OE3) and gene editing lines 1860-TaqW-6B-Cas9 (KO1, KO2 and KO3) were determined (Yang Li, Huang Yulan, Chang Ping, et al. QTL analysis of arabinoxylan content in wheat and its relationship with quality traits [J]. Acta Agronomica Sinica, 2014, 40(09): 1695-1701.). Compared with wild type Zhengmai 1860 (WT), the WE-AX content of the overexpression lines was increased, among which the increase of OE2 strain reached a very significant level (P<0.01), and the increase of OE1 and OE3 strains reached a significant level (P<0.05), as Figure 5 The middle (a). On the contrary, the WE-AX content of the gene editing lines was reduced to varying degrees, among which the WE-AX content of the complete knockout line KO1 was reduced by a significant level (P<0.01), and the double mutant line KO2 also showed a significant decrease (P<0.05), as Figure 5 The middle (b). These results consistently show that the expression level of TaqW-6B gene is positively correlated with the WE-AX content in wheat grains, and overexpression of the gene can significantly promote the accumulation of WE-AX, while knockout leads to a decrease in its content, thereby verifying that the wheat TaqW-6B gene positively regulates the synthesis of WE-AX in wheat grains.

[0030] In summary, overexpression of TaqW-6B gene in wheat plants can significantly increase the WE-AX content in wheat grains, and knocking out the gene in wheat can significantly reduce the WE-AX content in wheat grains. Therefore, the TaqW-6B gene can regulate the WE-AX content in wheat grains and can be used to cultivate new wheat varieties.

[0031] The above-described embodiments are only used to describe the preferred modes of the present application, and are not intended to limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope of the present application defined by the claims.

Claims

1. Application of wheat TaqW-6B gene in regulating the content of water-soluble arabinoxylan in grain, characterized in that, The wheat TaqW-6B gene positively regulates the synthesis of water-soluble arabinoxylan in wheat kernels.

2. A method of increasing the water soluble arabinoxylan content of wheat grain, characterised in that, The method increases the content of water-soluble arabinoxylan in wheat kernels by overexpressing the wheat TaqW-6B gene.

3. The method of increasing the water soluble arabinoxylan content of wheat grain according to claim 2, characterised in that, The recombinant overexpression vector used for overexpressing the wheat TaqW-6B gene is constructed by using a cloning vector plasmid as a template, and specifically amplifying the primers for connecting the homologous arms; after linearizing the overexpression vector, the CDS homologous arm fragment of the wheat TaqW-6B gene is homologously recombined onto the overexpression vector. The sequences of the primers for connecting the homologous arms are shown in SEQ ID NO. 7 and 8; the CDS sequence of the wheat TaqW-6B gene is shown in SEQ ID NO.

5.

4. A recombinant overexpression vector overexpressing a wheat TaqW-6B gene, characterized by, The recombinant overexpression vector comprises the CDS sequence of the wheat TaqW-6B gene; the CDS sequence is homologously recombined onto the overexpression vector through the homologous arm fragment; The CDS sequence of the wheat TaqW-6B gene is shown in SEQ ID NO.

5.

5. A reagent or kit for constructing the recombinant overexpression vector of claim 4, characterized in that, The reagent or kit comprises the sequences of the primers for connecting the homologous arms, which are shown in SEQ ID NO. 7 and 8.

6. A method of breeding a wheat plant having a high or low water soluble arabinoxylan content of the wheat grain, characterised in that, The expression of the TaqW-6B gene in the wheat sample is up-regulated or down-regulated; and plants with high or low content of water-soluble arabinoxylan in wheat kernels are obtained.