Soybean drought environment adaptability gene GmTIFY8b and application thereof
By discovering and identifying the soybean drought-adaptive gene GmTIFY8b, the problem of scarce soybean drought-resistant gene resources has been solved. Overexpression of this gene improves the drought tolerance of soybeans, thereby enhancing soybean breeding efficiency and providing a key resource for drought-resistant breeding.
Patent Information
- Application Number
- CN202511520169.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-23
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2045-10-23
AI Technical Summary
The scarcity of drought-resistant gene resources in soybeans leads to low efficiency in drought-resistant molecular breeding. The lack of clearly defined key drought-resistant genes that can be directly used in breeding practices limits the efficiency of drought-resistant soybean breeding.
The drought-adaptive gene GmTIFY8b in soybean was identified and determined. Its regulatory function in soybean was determined through genome-wide association analysis and phenotypic plasticity analysis. The drought tolerance of soybean was improved by overexpressing this gene. The GmTIFY8b gene was overexpressed in soybean using transgenic technology, and the drought resistance of soybean was identified by combining it with SNP molecular marker combinations.
The study clarified the regulatory function of the GmTIFY8b gene in soybean drought adaptability, provided direct target gene resources, significantly enhanced the drought adaptability of soybean, improved breeding efficiency, and provided key resources for breeding drought-resistant and high-yielding new soybean varieties.
Smart Images

Figure CN120989149A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering and relates to genes for drought adaptability in soybeans. GmTIFY8b And its applications. Background Technology
[0002] Soybeans Glycine max Soybeans (L.) are an important food and oilseed crop originating in my country, playing a vital role in global agricultural production and economic development. However, in recent years, global climate change has led to a continuous expansion and intensification of drought-affected areas. As a crop with high water requirements, soybeans are particularly vulnerable; varying degrees of drought stress can increase the probability of soybean yields falling below historical averages to 40%–80%, and under extreme drought conditions, it may even lead to total crop failure.
[0003] Currently, although studies have shown that most genes in the TIFY family respond to abiotic stress and are associated with drought and salinity stress, research on the drought adaptation regulatory functions and applications of specific TIFY family genes in soybean is still insufficient. There is a lack of clear key drought-resistant gene resources that can be directly used in breeding practices, which limits the efficiency of molecular breeding for drought resistance in soybean. Summary of the Invention
[0004] To address the problems of scarce soybean drought-resistant gene resources and low efficiency in drought-resistant molecular breeding in existing technologies, this invention provides a soybean drought-adaptive gene. GmTIFY8b This study aims to clarify its function in regulating soybean drought adaptability and provide its application in breeding drought-resistant soybean varieties, thus providing usable target gene resources for soybean drought-resistant breeding.
[0005] To achieve the above objectives, the present invention provides the following technical solution: The first aspect of this invention provides the process for discovering and identifying the soybean drought adaptability gene GmTIFY8b: (1) 224 natural soybean populations were screened for whole-genome resequencing. After data filtering and SNP (single nucleotide polymorphism) calling, 3,557,211 high-quality SNP markers were obtained. (2) A drought stress experiment was conducted in the Yazhou area of Sanya, Hainan (dry season from November to April of the following year). Artificial watering was used as a control. Nine phenotypic data, such as plant height and number of grains per plant, were obtained from 224 materials. (3) The Finlay-Wilkinson regression coefficient (FWR) of the number of grains per plant was calculated using the Finlay-Wilkinson model. The second largest principal component (PC2) was extracted by principal component analysis (PCA). FWR and PC2 were used as indicators of phenotypic plasticity. (4) Using the FarmCPU model of the GAPIT software to carry out genome-wide association analysis (GWAS), a plurality of SNP sites on chromosomes 1, 6, 7 and 8 significantly associated with the phenotype plasticity value (Pvalue<log 10 (1e-5)) are identified; (5) The significantly associated SNPs are functionally annotated, and three genes associated with FWR and PC2 are screened out, combined with the stress resistance characteristics of the TIFY family genes, to determine GmTIFY8b as candidate drought-resistant genes, and it is found that there are three highly linked SNP variation sites (302bp G / A, 412bp G / T and 444bp T / C) in the coding region.
[0006] The second aspect of the present application provides an application of overexpression of the GmTIFY8b gene in improving the drought tolerance of soybeans, GmTIFY8b the nucleotide sequence of the gene is shown as SEQ ID NO. 1.
[0007] The third aspect of the present application provides an application of biological materials related to the above-mentioned GmTIFY8b gene, and the application is any one of the following: A1) application in improving the drought tolerance of soybeans; A2) application in preparing drought-tolerant soybeans; The biological material is any one of the following B1) to B3): B1) an expression cassette containing a nucleic acid molecule with a nucleotide sequence shown as SEQ ID NO. 1; B2) a recombinant vector containing a nucleic acid molecule with a nucleotide sequence shown as SEQ ID NO. 1; B3) a recombinant microorganism containing a nucleic acid molecule with a nucleotide sequence shown as SEQ ID NO. 1, or a recombinant microorganism containing the expression cassette of B1), or a recombinant microorganism containing the recombinant vector of B2), and the microorganism is Agrobacterium.
[0008] The fourth aspect of the present application provides a method for cultivating drought-tolerant plants, which comprises overexpression of the above-mentioned GmTIFY8b gene in plants to obtain plants with improved drought tolerance, and the plants are soybeans.
[0009] In the method, the overexpression of the GmTIFY8b gene in plants is to increase the expression amount of the GmTIFY8b gene in soybeans by using transgenic technology.
[0010] In the method, the overexpression of the GmTIFY8bThe expression amount of the gene is increased by introducing a plant expression vector integrating the nucleic acid molecule shown in SEQ ID NO. 1 into a target plant.
[0011] The fifth aspect of the present application provides application of a primer pair combination for detecting a SNP molecular marker combination in preparation of a product for identifying drought resistance of soybean, wherein the SNP molecular marker combination is based on GmTIFY8b The three SNP sites are at the 303rd, 414th and 447th bases of the coding sequence of the gene; when GmTIFY8b The sites at the 303rd, 414th and 447th bases of the coding sequence of the gene are G, G and T bases respectively, and the soybean material is drought-resistant soybean; when GmTIFY8b The sites at the 303rd, 414th and 447th bases of the coding sequence of the gene are A, T and C bases respectively, and the soybean material is drought-intolerant soybean; the GmTIFY8b The coding sequence of the gene is shown in SEQ ID NO. 1 or SEQ ID NO. 2.
[0012] In the application, the product comprises a soybean genome detection kit or a soybean whole genome SNP chip.
[0013] The sixth aspect of the present application provides a method for identifying drought resistance of soybean, which comprises the following steps: (1) extracting genomic DNA of a sample to be tested from a soybean leaf; (2) amplifying a DNA fragment containing the SNP site by PCR technology with the genomic DNA as a template to obtain a PCR product; (3) detecting the PCR product by a fluorescence detection platform, and determining the drought resistance of the soybean according to the polymorphism of the SNP molecular marker reflected by the obtained fluorescence signal; (4) when GmTIFY8b The sites at the 303rd, 414th and 447th bases of the coding sequence of the gene are G, G and T bases respectively, and the soybean material is drought-resistant soybean; when GmTIFY8b The sites at the 303rd, 414th and 447th bases of the coding sequence of the gene are A, T and C bases respectively, and the soybean material is drought-intolerant soybean; the GmTIFY8b The coding sequence of the gene is shown in SEQ ID NO. 1 or SEQ ID NO. 2.
[0014] The present application has the following beneficial effects: (1) the present application first identifies and determines the drought environment adaptability regulation function of the gene, fills the blank of the drought resistance function research of the TIFY family gene of soybean, and provides a new theoretical basis for the drought resistance mechanism research of soybean; GmTIFY8b (2) the present application provides a new method for identifying drought resistance of soybean, and the method is simple, rapid, accurate and convenient. (2) The haplotype 1 of the gene is significantly associated with high drought resistance, which can be directly used for soybean drought-resistant germplasm screening as a molecular marker to improve breeding efficiency; (3) The drought adaptability of soybean can be significantly enhanced by overexpressing the gene, which provides a key target gene resource for cultivating new drought-resistant and high-yield soybean varieties by molecular breeding technology, and has important agricultural application value. BRIEF DESCRIPTION OF DRAWINGS
[0015] Figure 1 Manhattan plot for genome-wide association analysis of soybean single plant grain number plasticity value phenotype.
[0016] Figure 2 Wayne plot for candidate genes significantly associated with phenotype plasticity.
[0017] Figure 3 GmTIFY8b Heat map of linkage disequilibrium (LD) of gene region.
[0018] Figure 4 GmTIFY8b Expression pattern of the gene in different tissues and expression amount change under drought stress.
[0019] Figure 5 GmTIFY8b SNP site and haplotype constitution diagram of the coding region (CDS) of the gene.
[0020] Figure 6 Comparison chart of drought resistance grade and drought resistance index of different haplotype soybean materials.
[0021] Figure 7 GmTIFY8b Drought resistance phenotype identification of soybean hairy root of the gene overexpression. DETAILED DESCRIPTION
[0022] The specific embodiments of the present application are described below to facilitate the understanding of the present application by those skilled in the art, but it should be clear that the present application is not limited to the scope of the specific embodiments, and for those skilled in the art, all the changes that are obvious within the spirit and scope of the present application defined and determined by the appended claims are obvious, and all the inventions utilizing the concept of the present application are included in the protection.
[0023] Explanation of the sequence table: underlined bases represent polymorphic SNP sites SEQ ID NO. 1: ATGGCTGTGCTGCTGAGAATGGCTCAGCCTCACAATGGCAACACCAACAACACTTCAAACCAGCAATTGGTACTCCATGACTTTCTGGGTATGAGGCCCGCCGCCGATTCCCCCAAAACCGCCGATGTCAGGTTACCGGAGCCTTCGGCCTCCGCCTCTTCCACCGGAGGACGCGGCCCCTTCTCCGCCACCTCCGACATCGCTTCCGAAAAACAGGTAGGAAATCATCTCGAGGGAGTTCCATTCTATGGCCCGAGGAGTGATTTTTCTGGCACTGAGATAAGCAACAGATTAGTGGGAA G CAAGAGAAGTAATTCTGATTCCACTTTTATGGGTTCCTCCAGAGATGCCTTCCAATTGGTCCCTGATTCCTTTCAAAACTCACATTTGATGAAGGTTCTCCGGAATGCA G CTGGAGGAGAAAGGCCTAGAAGGCCCAATGA TGATGCAGTGTTACTTGGTATGCAGTCAATGAAGCCATCTTCTTCTCAGATATTTCAGCCTCCCACCAGCACTAAGATTGATGCCAATAAATGGGAACGGTCTATTCTCATGAATGTTGGCCCTTCCATGCAGCATCCACCGCGTGGGGTGCAATTGGCACCTTTTGTGCACCAAATGGCTTCAAGCAAGATTAGGGATACCAATGCTGGCCCTTCATTCATTTCTCAGTCAGCTGCTGATGAAGGTTCTAGAACTGGAATCAAGGGCCCTGGAATTTTAAGTTCTGCAGCTGCTACAGCCACTGAGAAAAGTATTCCATCTGCTGTGATGCTTGGTGGCAGCAGGCCAAAGCCTGGAACTAATGTAGTAGAATCATCCACACATCCAAGCAGTCAACATGGGCTAACTTCTGCCAGCCGCCAGATGACTATTTTTTATGGAGGCCAAGCTCATGTTTTTGATGATGTCCACCCTCATAAGGCAGATGTTATAATGGCTTTGGCTGGGTCAAATGGAGGATCTTGGTCCACTGCATTCTCGCCTAAATCTGCTGTAAAGATGGTTAATGATGGTATCTTGCATAGCGGAGAAAATGAAACAGGTGTAGTTAGTAATGCAGCATTCCCACAGGAGCTTCATGGGAAATTGTCTATTACTGGCAGTTCTAGCCATGCCATTGGGCTTGGTGATCGAGTAACTACTCCAGCGGGGAAACACCATGGAAACGTTTTTGCGAAAGATACAAGAAATCCGGTCCAACCACCAGATCCCAGTTCTGAAGACAAAAGAGCACAGTGA SEQ ID NO. 2: ATGGCTGTGCTGCTGAGAATGGCTCAGCCTCACAATGGCAACACCAACAACACTTCAAACCAGCAATTGGTACTCCATGACTTTCTGGGTATGAGGCCCGCCGCCGATTCCCCCAAAACCGCCGATGTCAGGTTACCGGAGCCTTCGGCCTCCGCCTCTTCCACCGGAGGACGCGGCCCCTTCTCCGCCACCTCCGACATCGCTTCCGAAAAACAGGTAGGAAATCATCTCGAGGGAGTTCCATTCTATGGCCCGAGGAGTGATTTTTCTGGCACTGAGATAAGCAACAGATTAGTGGGAA A CAAGAGAAGTAATTCTGATTCCACTTTTATGGGTTCCTCCAGAGATGCCTTCCAATTGGTCCCTGATTCCTTTCAAAACTCACATTTGATGAAGGTTCTCCGGAATGCA T CTGGAGGAGAAAGGCCTAGAAGGCCCAATGA CGATGCAGTGTTACTTGGTATGCAGTCAATGAAGCCATCTTCTTCTCAGATATTTCAGCCTCCCACCAGCACTAAGATTGATGCCAATAAATGGGAACGGTCTATTCTCATGAATGTTGGCCCTTCCATGCAGCATCCACCGCGTGGGGTGCAATTGGCACCTTTTGTGCACCAAATGGCTTCAAGCAAGATTAGGGATACCAATGCTGGCCCTTCATTCATTTCTCAGTCAGCTGCTGATGAAGGTTCTAGAACTGGAATCAAGGGCCCTGGAATTTTAAGTTCTGCAGCTGCTACAGCCACTGAGAAAAGTATTCCATCTGCTGTGATGCTTGGTGGCAGCAGGCCAAAGCCTGGAACTAATGTAGTAGAATCATCCACACATCCAAGCAGTCAACATGGGCTAACTTCTGCCAGCCGCCAGATGACTATTTTTTATGGAGGCCAAGCTCATGTTTTTGATGATGTCCACCCTCATAAGGCAGATGTTATAATGGCTTTGGCTGGGTCAAATGGAGGATCTTGGTCCACTGCATTCTCGCCTAAATCTGCTGTAAAGATGGTTAATGATGGTATCTTGCATAGCGGAGAAAATGAAACAGGTGTAGTTAGTAATGCAGCATTCCCACAGGAGCTTCATGGGAAATTGTCTATTACTGGCAGTTCTAGCCATGCCATTGGGCTTGGTGATCGAGTAACTACTCCAGCGGGGAAACACCATGGAAACGTTTTTGCGAAAGATACAAGAAATCCGGTCCAACCACCAGATCCCAGTTCTGAAGACAAAAGAGCACAGTGA SEQ ID NO. 3: 5-GATGTGATTACAGTCTAGAATGGCTGTGCTGCTGAG-3 SEQ ID NO. 4: 5-TCGTGGTCCTTATAGTCGGTACCCTGTGCTCTTTTGTCTTCAGAACTG-3 Example 1 Soybean Drought Resistance Genes GmTIFY8bMining and identification of 1. High-throughput sequencing and data analysis Screening of 224 natural population soybean materials for whole genome resequencing, after field test germination, leaf was taken, sent to Huada Gene Company for DNA extraction, second generation library construction and high-throughput sequencing, 10x per material. The data after machine is filtered by Trimmomatic v0.38, and the adapter sequence is removed, and then calling SNP is carried out by using sentieon commercial software, and the reference genome is Williams 82 v.2.1 version. After obtaining the vcf file, filter it by using vcftools, parameters: vcftools --vcf 188.vcf --recode-INFO-all --max-alleles 2 --min-alleles 2 --minDP 4 --maxDP 60 --minQ 30 --max-missing 0.9 --out groupall --recode, finally 3557211 high-quality SNP markers are obtained.
[0024] 2. Obtaining of soybean drought resistance phenotype data and quantifying phenotype plasticity value for whole genome association analysis The 224 resequenced materials were identified for soybean drought resistance phenotype in the whole growth period. Sanya Yazi region in Hainan belongs to tropical monsoon climate, with obvious dry season and rainy season, and the period from November to the following April with little rainfall and dry air is selected as the drought group, and artificial watering is used to simulate rainfall as the control group, each group of materials has more than three repeats, after all the materials mature, the plant height, seed number per plant, seed weight per plant, hundred seed weight, soybean cross section area, stem diameter, pod height, main stem node number and pod number are counted. The Finlay-Wilkinson model is used for stability analysis of seed number per plant, and the Finlay-Wilkinson regression coefficient (FWR) under control environment and drought stress environment is calculated; at the same time, based on principal component analysis (PCA), the genotype-environment interaction effect is analyzed, and the second principal component (PC2) of the seed number per plant phenotype data under two environmental conditions is extracted to quantify the environment-specific variation pattern. FWR and PC2 are used as quantitative phenotype plasticity indexes, and GAPIT is used to carry out whole genome association analysis (GWAS) of the seed number per plant phenotype plasticity value and 3557211 high-quality SNP markers by using FarmCPU model. The whole genome association analysis results based on FarmCPU model show that (Fig. 1) Figure 1 ), 1, 6, 7 and 8 chromosomes have multiple SNP sites significantly associated with the seed number per plant phenotype plasticity value (Pvalue < log 10 (1e-5).
[0025] By functional annotation of the significantly associated SNPs, 26 genes located in the gene interior and promoter region were identified. Further analysis found that 3 of them (a Glyma.01G235100, Glyma.06G072700, Glyma.08G124100 ) were significantly associated with the Finlay-Wilkinson regression coefficient (FWR) of single pod number and the second principal component (PC2) of PCA (b Figure 2 ) at the same time, indicating that these genes may have drought resistance function. Combined with relevant research reports, most genes of the TIFY family respond to stress, especially drought stress and saline-alkali stress. Therefore, the present application selects GmTIFY8b gene as a drought resistance candidate gene. By linkage disequilibrium analysis (LD) of the SNP site gene interior and promoter region sequence, the SNP site in the gene interior and promoter region is highly linked disequilibrium (c Figure 3 ), so the false positive probability of the SNP site is low.
[0026] 3. Verification of the function of the candidate gene GmTIFY8b Gene is a new functional gene with influence on drought resistance of soybean identified and discovered by the present application. The present application selects the classical soybean material Williams 82 (W82) for normal watering and water deprivation drought treatment for 2 days, and selects the soybean tissue root, stem and leaf of normal watering (control) and the soybean tissue root, stem and leaf of water deprivation drought (drought stress) for real-time quantitative analysis, 3 times of repetition for each time point. By analysis, it is found that GmTIFY8b the expression pattern of gene presents tissue specificity, and the expression amount in stem is significantly higher than that in root and leaf (a Figure 4 in the specification) .GmTIFY8b There is no obvious difference in expression amount in root after drought induction (b Figure 4 in the specification), and there is an upward trend in stem and leaf (c Figure 4 in the specification, d Figure 4 in the specification).
[0027] The drought resistance index is calculated by 9 phenotypes, and the variety with higher drought resistance index is more drought-resistant. By the average value of principal component difference analysis (PCA), the drought resistance level is divided into 1-5 levels, wherein 1-2 is a drought-resistant variety, 3 is a drought-resistant variety based on whole genome resequencing data of the gene GmTIFY8b gene, and 4-5 is a drought-sensitive variety. The haplotype analysis of gene based on whole genome resequencing data of the gene Figure 5 found that there is a SNP variation significantly associated with drought resistance level and drought resistance index at 302bp, 412bp and 444bp in the coding region of gene (a GmTIFY8b ), forming two main haplotypes, namely haplotype 1 (Hap1) and haplotype 2 (Hap2). The t-test analysis of the two haplotypes based on drought resistance level and drought resistance index shows thatHaplotype 1 of the gene showed significant differences in both drought resistance coefficient and drought resistance level (p < 0.05). Figure 6 This further illustrates the relationship between this gene and soybean drought resistance.
[0028] Table 1. Drought Rank and Drought Indices (Drought PI) for the two haplotypes t test
[0029] 4. Soybean drought adaptation genes GmTIFY8b drought resistance phenotype identification (1) GmTIFY8b Gene cloning and expression vector construction A mixed tissue of roots, stems, and leaves from the soybean variety Williams 82 was selected as gene cloning material. Using cDNA as a template, the gene was cloned... GmTIFY8b The gene coding region (SEQ ID NO.1) was ligated into the overexpression vector pUB-GFP. Homologous cloning primer sequences were designed (SEQ ID NO.3 and SEQ ID NO.4). The target gene was amplified using KOD-Plus-Neo high-fidelity PCR enzyme (TOYOBO, Shanghai Biotechnology Co., Ltd.). The PCR reaction system and procedure were consistent with the product instructions, and the annealing temperature of the gene was 58℃.
[0030] The plasmid expressing the vector pUB-GFP was extracted and double-digested with restriction enzymes XbaI and KpnI. The gene amplification product with the adapter and the digested vector product were ligated using homologous recombination, and the recombinant vector was transformed into *E. coli* DH5α competent cells. The recombinant vector pUB-GFP-, verified by sequencing, was then... GmTIFY8b The cells were transformed into Agrobacterium K599 competent cells, and the correct single clones were identified by culture PCR. These clones were then used in the Agrobacterium-induced hairy root formation method.
[0031] (2) GmTIFY8b Identification of drought resistance phenotype in soybean plants with hairy roots The activated Agrobacterium bacterial culture pUB-GFP empty vector and pUB-GFP- GmTIFY8b Soybean plants were smeared onto YEP solid medium containing resistance (streptomycin and kanamycin) and cultured for 36 hours. The hypocotyl of the soybean was removed, and the cut was dipped in bacterial solution from the solid medium. Every 4 days, the plants were irradiated with fluorescence to remove non-fluorescent roots while retaining overexpressing fluorescent hairy roots. When the second trifoliate leaf of the soybean was fully expanded, soybean plants with consistent growth status and root number were selected for subsequent drought resistance phenotype identification. Figure 7 ).
[0032] The obtained transient pUB-GFP empty vector overexpression hairy root soybean plants and the transient pUB-GFP-AtDREB2.6 overexpression hairy root soybean plants were subjected to simulated drought stress with PEG6000 at a concentration of 13%. The phenotypic morphological indexes of the soybean plants treated with drought for 24 h and 36 h were identified, and the relative conductivity (membrane damage index) of the soybean plants treated with drought for 36 h was determined. The test results showed that, compared with the transient pUB-GFP empty vector overexpression hairy root soybean plants, the leaves of the transient pUB-GFP-AtDREB2.6 overexpression hairy root soybean plants were significantly less wilted. GmTIFY8b GmTIFY8b The leaves of the transient pUB-GFP-AtDREB2.6 overexpression hairy root soybean plants were significantly less wilted. Through analysis of the relative conductivity data, GmTIFY8b The membrane damage degree of the leaves of the transient pUB-GFP-AtDREB2.6 overexpression hairy root soybean plants was significantly lower than that of the empty vector soybean plants (c). The research results showed that Figure 7 The overexpression of the gene significantly improved the drought environment adaptability of the soybean. GmTIFY8b GmTIFY8b
[0033] The above has been described in detail. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.
[0034] The term "protein" is used interchangeably herein to mean a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more of the amino acid residues is a non-naturally encoded amino acid. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are connected via covalent peptide bonds.
[0035] The term "transformation" refers to the process of introducing a heterologous DNA sequence into a host cell or organism.
[0036] The term "expression" refers to the transcription and / or translation of an endogenous gene or transgene in a plant cell.
[0037] It will be apparent to those skilled in the art that various modifications and variations can be made in the present application without departing from the spirit or scope of the application. Thus, it is intended that the present application cover modifications and variations of this application provided they come within the scope of the appended claims and their equivalents.
Claims
1. Overexpression GmTIFY8b The application of genes in improving soybean drought tolerance is characterized by, GmTIFY8b The coding sequence of the gene is shown in SEQ ID NO.
1.
2. As described in claim 1 GmTIFY8b The application of gene-related biomaterials is characterized by, The application is any one of the following: A1) Application in improving soybean drought tolerance; A2) Application in the preparation of drought-resistant soybeans; The biomaterial is any one of B1) to B3) below: B1) An expression cassette containing a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO. 1; B2) Recombinant vectors containing nucleic acid molecules with nucleotide sequences as shown in SEQ ID NO. 1; B3) A recombinant microorganism containing a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO. 1, or a recombinant microorganism containing the expression cassette described in B1), or a recombinant microorganism containing the recombinant vector described in B2), wherein the microorganism is Agrobacterium.
3. A method for cultivating drought-resistant plants, characterized in that, The method includes overexpression in plants GmTIFY8b Genes were used to obtain plants with improved drought resistance, wherein the plant is soybean. GmTIFY8b The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
4. The method according to claim 3, characterized in that, The overexpression in plants GmTIFY8b The gene is the one used in soybeans to modify the soybean structure using transgenic technology. GmTIFY8b Gene expression levels increase.
5. The method according to claim 4, characterized in that, The use of genetic engineering technology to modify soybeans... GmTIFY8b The increase in gene expression was achieved by introducing a plant expression vector that integrates the nucleic acid molecule shown in SEQ ID NO. 1 into the target plant.
6. The application of primer pair combinations for detecting SNP molecular marker combinations in the preparation of products for identifying the drought resistance of soybeans, characterized in that, The SNP molecular marker combination is based on GmTIFY8b It consists of three SNP sites at the 303rd, 414th, and 447th bases of the gene coding sequence; when GmTIFY8b The sites at the 303rd, 414th, and 447th bases of the gene coding sequence are G, G, and T bases, respectively, and the soybean material is drought-resistant soybean; when GmTIFY8b The sites at the 303rd, 414th, and 447th bases of the gene coding sequence are A, T, and C bases, respectively, and the soybean material is drought-intolerant soybean; GmTIFY8b The gene coding sequence is shown in SEQ ID NO. 1 or SEQ ID NO.
2.
7. The application according to claim 6, characterized in that, The products include soybean genome detection kits or soybean whole genome SNP chips.
8. A method for identifying the drought resistance of soybeans, characterized in that, The method includes the following steps: (1) Genomic DNA was extracted from soybean leaves to test the sample; (2) Using genomic DNA as a template, amplify the DNA fragment containing the SNP site described in claim 6 by PCR technology to obtain the PCR product; (3) The PCR products were detected using a fluorescence detection platform, and the drought resistance of soybeans was judged based on the polymorphism of SNP molecular markers reflected by the obtained fluorescence signals. (4) When GmTIFY8b The sites at the 303rd, 414th, and 447th bases of the gene coding sequence are G, G, and T bases, respectively, and the soybean material is drought-resistant soybean; when GmTIFY8b The sites at the 303rd, 414th, and 447th bases of the gene coding sequence are A, T, and C bases, respectively, and the soybean material is drought-intolerant soybean; GmTIFY8b The gene coding sequence is shown in SEQ ID NO. 1 or SEQ ID NO. 2.
Citation Information
Patent Citations
Application of GmbZIP73 gene in regulation and control of soybean drought tolerance
CN118048388A
Drought tolerant plants
WO2017197322A1