Application of rice SD10 gene in regulation and control of yield and lodging resistance

Abstract

The invention discloses application of a rice SD10 gene in yield regulation and lodging resistance. The invention provides a protein, a substance for up-regulating or enhancing or improving the expression of a coding gene of the protein, or an application of a substance for up-regulating or enhancing or improving the activity or content of the protein in at least one of the following substances. A1) improving lodging resistance of plants; a2) increasing the plant yield; a3) cultivating lodging-resistant plants; a4) cultivating high-yield plants; a5) plant breeding; the protein comprises an amino acid residue as shown in SEQ ID No. 2; the invention proves that the SD10 gene simultaneously affects the characters such as single plant yield and stalk thickness, and plays a very important role in regulating and controlling the rice yield and lodging resistance, and the encoding nucleic acid of the protein SD10 is a high-quality gene for cultivating high-quality variety rice, and is used for cultivating high-yield and lodging-resistant rice.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to rice genes. SD10 Applications in regulating yield and preventing lodging. Background Technology

[0002] Rice ( Rice Rice (L.) is one of the world's three major food crops, with a long history of cultivation. Nearly half of the world's population relies on rice as their staple food, and one-fifth of the total energy consumed by humankind comes from rice. Therefore, increasing rice production is of great significance in alleviating global hunger and meeting the ever-growing demand for food, and increasing rice yield per unit area has become one of the important ways to solve the problem of food security.

[0003] In cereal crops, lodging severely impacts grain yield and quality. The "Green Revolution" of the 1960s, a breakthrough in rice cultivation, improved lodging resistance through the use of gibberellin-deficient semi-dwarf varieties. However, the reduced nitrogen use efficiency of semi-dwarf varieties led to excessive fertilizer application, negatively impacting the environment and human health. Simultaneously, dwarfing limited the potential for further increases in grain yield due to shortened panicle length, thus affecting overall grain production. An effective approach to addressing these issues is to identify undiscovered superior alleles in wild rice, particularly quantitative trait loci (QTLs) associated with high yield and lodging resistance, to breed improved rice varieties.

[0004] Common wild rice ( Oryza rufipogon Griff. is an Asian cultivated rice ( Rice Wild rice (L.) is a closely related ancestor of cultivated rice, exhibiting rich genetic diversity. Long-term artificial and natural selection led to the loss of many important and desirable alleles during the domestication process, resulting in a significant decline in the genetic diversity of cultivated rice. These lost alleles may contain numerous gene resources related to important agronomic traits, particularly yield and lodging resistance. Therefore, identifying and applying beneficial alleles related to yield and lodging resistance in wild rice is of great significance. Summary of the Invention

[0005] The technical problem solved by this invention is to provide a way to identify superior genes in wild rice and obtain high-yielding, lodging-resistant rice.

[0006] To solve the above-mentioned technical problems, the first aspect of the present invention provides the use of a protein, a substance that upregulates, enhances, or increases the expression of the gene encoding the protein, or a substance that upregulates, enhances, or increases the activity or content of the protein in at least one of the following: A1) Improve plant resistance to lodging; A2) Increase plant yield; A3) Cultivate lodging-resistant plants; A4) Cultivating high-yield plants; A5) Plant breeding; The protein is any one of the following: The protein shown in B1) includes the amino acid residues shown in SEQ ID No. 2; The protein shown in B2) has more than 80% amino acid residue identity with the protein shown in B1) and has the same function; The protein shown in B3) includes the protein shown in B1) or B2) by attaching a tag to its N-terminus and / or C-terminus to obtain the protein with the sequence shown.

[0007] In the above text, the indicators for plant breeding are lodging resistance and / or yield; the plant breeding mentioned above is to improve the lodging resistance of plants, increase plant yield, cultivate lodging-resistant plants and / or cultivate high-yielding plants.

[0008] In some embodiments, the protein shown in B1) may be the amino acid residue shown in SEQ ID No. 2.

[0009] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0010] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.

[0011] In the aforementioned proteins, the 80% or more identity can be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.

[0012] Substances that upregulate, enhance, or increase the expression of the gene encoding the protein, or the activity or content of the protein, can improve plant lodging resistance and / or yield.

[0013] The substance is a substance that regulates the expression of nucleic acid, and may be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcriptional level of the gene; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of translation of the gene; 5) regulation of mRNA degradation of the gene; 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0014] In the above-described applications, the substance is any one of the following: C1) Nucleic acid molecules encoding the proteins described in the first aspect; C2) An expression cassette containing the nucleic acid molecule described in C1); C3) a recombinant vector containing the nucleic acid molecule described in C1), or a recombinant vector containing the expression cassette described in C2); C4) Recombinant microorganisms containing the nucleic acid molecules described in C1), or recombinant microorganisms containing the expression cassette described in C2), or recombinant microorganisms containing the recombinant vector described in C3); C5) A transgenic plant cell line containing the nucleic acid molecule described in C1), or a transgenic plant cell line containing the expression cassette described in C2), or a transgenic plant cell line containing the recombinant vector described in C3); C6) Transgenic plant tissue containing the nucleic acid molecule described in C1), or transgenic plant tissue containing the expression cassette described in C2), or transgenic plant tissue containing the recombinant vector described in C3); C7) a transgenic plant organ containing the nucleic acid molecule described in C1), or a transgenic plant organ containing the expression cassette described in C2), or a transgenic plant organ containing the recombinant vector described in C3).

[0015] In the preceding text, C2) refers to an expression cassette that is capable of expressing the gene in a host cell. This DNA may include not only promoters that initiate gene transcription but also terminators that terminate gene transcription. Furthermore, the expression cassette may also include enhancer sequences. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: constitutive promoter 35S of cauliflower mosaic virus; wound-inducible promoters from tomatoes, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120:979-992); chemically induced promoters from tobacco, pathogenesis-related (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); tomato protease inhibitor II promoter (PIN2) or LAP promoter (both induced by jasmonic acid methyl ester); heat shock promoters (US Patent 5,187,267); tetracycline-inducible promoters (US Patent 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 2007 1 0099169.7)); and promoters specific to seed storage proteins (e.g., beta-carotene, napin, etc.). The promoters of oleosin and soybean beta conglycin (Beachy et al. (1985) EMBOJ. 4:3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are cited in full. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminators (see, for example: Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627.

[0016] In C3) above, the recombinant vector can be a recombinant expression vector containing the gene expression cassette constructed using a plant expression vector. The plant expression vector can be a Gateway system vector or a binary Agrobacterium vector, such as pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, pMDC85, or pCAMBIA1391-Xb. When constructing recombinant expression vectors using TaBON1, any enhancing, constitutive, tissue-specific, or inducible promoter can be added before its transcription initiation nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin gene Ubiqutin promoter (pUbi), etc., which can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. As a specific embodiment, this invention uses pCAMBIA1300 or pTCK303 / JL1460 vectors as expression vectors.

[0017] The nucleic acid molecule shown in C1) above is any one of the following: c1) includes the DNA molecule shown in SEQ ID No. 1; c2) includes the DNA molecule shown in SEQ ID No. 3; c3) includes the DNA molecule shown in positions 131-6176 of SEQ ID No. 3; c4) includes the DNA molecule shown in positions 2606-5801 of SEQ ID No. 3; c5) includes a DNA molecule obtained by sequentially linking the sequences shown in positions 2606-5801 of SEQ ID No. 4 and SEQ ID No. 3; c6) has more than 75% identity with any of the defined nucleotide sequences of c1)-c5) and encodes a cDNA molecule or DNA molecule that encodes the protein described in the first aspect; c7) hybridizes under stringent conditions with any of the defined nucleotide sequences of c1)-c5) and encodes a cDNA molecule or DNA molecule that encodes the protein described in the first aspect.

[0018] In some embodiments, c1) may be the DNA molecule shown in SEQ ID No. 1.

[0019] In some embodiments, c2) may be the DNA molecule shown in SEQ ID No. 3.

[0020] In some embodiments, c3) may be the DNA molecule represented by positions 131-6176 of SEQ ID No. 3.

[0021] In some embodiments, c4) may be the DNA molecule represented by positions 2606-5801 of SEQ ID No. 3.

[0022] In some embodiments, c5) may be a DNA molecule obtained by sequentially linking the sequences shown in positions 2606-5801 of SEQ ID No. 4 and SEQ ID No. 3.

[0023] In some embodiments, the nucleic acid molecule shown in c4) may also include a spike-high expression promoter, such as DEP1 Promoter (SEQ ID No. 4).

[0024] In the above-described nucleic acid molecules (c1-c4), those skilled in the art can easily mutate the nucleotide sequence encoding the protein SD10 of this invention using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides that have more than 75% identity with the nucleotide sequence of the protein SD10 isolated in this invention, as long as they encode and function as protein SD10, are all derived from and equivalent to the nucleotide sequence of this invention.

[0025] The aforementioned 75% or higher degree of identity can be 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the sameness.

[0026] In a second aspect, the present invention provides a method for improving the lodging resistance of plants, comprising the following steps: upregulating or enhancing or increasing the expression level of the nucleic acid molecule encoding the protein described in the first aspect in the plant, and / or upregulating or enhancing or increasing the activity and / or content of the protein described in the first aspect in the plant, thereby improving the lodging resistance of plants.

[0027] Thirdly, the present invention provides a method for cultivating lodging-resistant plants, comprising the following steps: upregulating or enhancing or increasing the expression level of the nucleic acid molecule encoding the protein described in the first aspect in the recipient plant, and / or upregulating or enhancing or increasing the activity and / or content of the protein described in the first aspect in the recipient plant, to obtain the target plant, which is a lodging-resistant plant; The target plant exhibits higher lodging resistance than the recipient plant.

[0028] Fourthly, the present invention provides a method for increasing plant yield, comprising the following steps: upregulating or enhancing or increasing the expression level of the nucleic acid molecule encoding the protein described in the first aspect in the plant, and / or upregulating or enhancing or increasing the activity and / or content of the protein described in the first aspect in the plant, thereby increasing plant yield.

[0029] Fifthly, the present invention provides a method for cultivating high-yield plants, comprising the following steps: upregulating or enhancing or increasing the expression level of the nucleic acid molecule encoding the protein described in the first aspect in the recipient plant, and / or upregulating or enhancing or increasing the activity and / or content of the protein described in the first aspect in the recipient plant, thereby obtaining the target plant, which is a high-yield plant; The target plant has a higher yield than the recipient plant.

[0030] The plant mentioned above is any one of the following: D1) dicotyledonous plants; D2) monocotyledonous plants; D3) grasses; D4) rice; D5) indica rice.

[0031] In some implementations, the rice variety can be ZH17.

[0032] In some implementations, the indica rice variety can be 93-11.

[0033] In some embodiments, increasing plant yield refers to increasing the yield per plant; In some embodiments, improving plant lodging resistance means increasing plant stem thickness and / or mechanical strength.

[0034] Experiments of this invention have demonstrated that this invention upregulates, enhances, or increases protein levels in plants. SD10 The expression of the encoding nucleic acid can increase plant yield and / or lodging resistance. SD10 Genes simultaneously influence traits such as yield per plant and stem thickness, playing a crucial role in regulating rice yield and lodging resistance. Proteins... SD10 The encoded nucleic acid is a high-quality gene for breeding superior rice varieties, used to cultivate rice varieties that are both high-yielding and lodging resistant. Attached Figure Description

[0035] Figure 1 Comparison of spike type, grain type, stem diameter and phenotypic data for 9DIL109 and 93-11.

[0036] Figure 2 For NIL- sd10 Comparison of spike type, grain type, stem diameter and phenotypic data with 93-11.

[0037] Figure 3 For NIL- sd10 Phenotypic comparison with complementary transgenic lines.

[0038] Figure 4 Phenotypic comparison of 93-11 and interference transgenic lines.

[0039] Figure 5 For ZH17 and p DEP1 - SD10 Phenotypic comparison of strains. Detailed Implementation

[0040] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0041] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0042] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0043] The vector pTCK303 / JL1460 is described in the following literature: Wang Z, Chen CG, Xu YY, Jiang RX, Han Y, Xu ZH, Chong K. A Practical Vector for Efficient Knockdown of GeneExpression in Rice ( Oryza sativa L.). Plant Mol Biol Rep, 2004, 22: 409-417, the vector is named pTCK303 in the article.

[0044] Example 1 SD10 The discovery of genes In 2012, our laboratory constructed an introgression line system using common wild rice from Dongxiang, Jiangxi Province as the donor parent and the superior indica rice variety 93-11 as the recurrent parent. This study selected 9DIL109, an introgression line from this system characterized by significantly dwarfed plant height, a significantly reduced number of grains per panicle, and significantly thinner stems. After backcrossing 9DIL109 with the recurrent parent 93-11 and self-crossing, an F2 population was constructed for preliminary QTL mapping. Fine QTL mapping was then performed by expanding the population further based on the genotypes and phenotypes of exchanged individual plants in the F2 generation. Experimental materials were grown at the Shangzhuang Experimental Base of China Agricultural University from May to October each year; and at the Nanfan Base in Sanya, Hainan Province from December to May of the following year. NIL- sd10 To purify the background containing SD10 Near-isogenic lines of wild rice with infiltrated gene fragments were used as recipient materials for partial genetic transformation.

[0045] This study began in May 2017. The rice materials used were stably planted in Beijing and Hainan every year. At the maturity stage, 15 plants with consistent growth were selected from the parent materials for phenotypic investigation, which mainly included plant height, number of tillers, length of main stem panicle, number of grains per main stem panicle, number of primary branches, number of secondary branches, grain length, grain width, thousand-grain weight, yield per plant, stem thickness, and mechanical strength.

[0046] The experimental results are shown in Figure 1 (a. Comparison of ear type between 93-11 and 9DIL109, bar = 5 cm. b. Comparison of grain width, bar = 1 cm. c. Comparison of grain length, bar = 1 cm. d. Comparison of stem diameter, bar = 1 cm. ep. Phenotypic data statistics, including plant height, number of tillers, number of grains per ear on the main stem, ear length, number of primary branches, number of secondary branches, grain length, grain width, thousand-grain weight, yield per plant, stem diameter, and mechanical strength (breaking force). The values ​​are presented as mean ± standard error, double-tailed.) t The test results show that, compared with 93-11, 9DIL109 has significantly shorter plant height, significantly fewer grains per panicle on the main stem, and significantly thinner stem.

[0047] Map-based cloning and functional analysis were performed on 9DIL109. The results revealed a QTL associated with rice yield on the long arm of chromosome 10, named... SD10 . SD10 Encodes a pectin methylesterase, gene number LOC_Os10g26680 . SD10 The open reading frame of the gene is shown in SEQ ID No. 1 of the sequence listing. It encodes the protein SD10, whose amino acid sequence is shown in SEQ ID No. 2 of the sequence listing. It consists of 336 amino acid residues.

[0048] By backcrossing 9DIL109 with the recurrent parent 93-11, followed by continuous self-crossing, and using marker-assisted selection to eliminate wild-rice introgression fragments on other chromosome segments, a subset of chromosomes containing wild-rice introgression fragments was obtained with 93-11 as the background. SD10 The infiltrating line of approximately 1 Mb of wild rice from Dongxiang was named NIL- sd10 The material was planted stably in Beijing and Hainan every year. At the maturity stage, 15 plants with the same growth were selected from the parent material for phenotypic investigation, which mainly included plant height, number of tillers, length of main stem panicle, number of grains per main stem panicle, number of primary branches, number of secondary branches, grain length, grain width, thousand-grain weight, yield per plant, stem thickness and mechanical strength.

[0049] The experimental results are shown in Figure 2 (a. 93-11 and NIL-) sd10 a. Plant type comparison, bar = 20 cm. b. Ear type comparison, bar = 5 cm. c. Grain width comparison, bar = 1 cm. d. Grain length comparison, bar = 1 cm. e. Stem diameter comparison, bar = 1 cm. fs. Phenotypic data statistics, including plant height, number of tillers, number of grains per ear on the main stem, ear length, number of primary branches, number of secondary branches, number of grains per primary branch, number of grains per secondary branch, grain length, grain width, thousand-grain weight, yield per plant, stem diameter (stem diameter), and mechanical strength (breaking force). The values ​​are presented as mean ± standard error, double-tailed. t The test results show that, compared to 93-11, NIL- sd10 Plant height decreases, the number of grains per spike on the main stem decreases, the stem becomes thinner, and the yield per plant decreases.

[0050] Example 2: Obtaining and phenotypic identifying T2 generation homozygous complementary transgenic plants The construction steps of recombinant plasmid pCTP-SD10 are as follows: 1. Synthetic primers According to SEQ ID No. 1 in the sequence list SD10 Based on the gene sequence, primers SD10-CTP-F and SD10-CTP-R were designed and synthesized; the primer sequences are as follows: SD10-CTP-F:AACAGCTATGACATGATTACGAATTCAAAACACCAGGACCCCATTC (SEQ ID No. 5, GAATTC is a restriction endonuclease) Eco RI identification site) SD10-CTP-R:CCAAGCTTGCATGCCTGCAGGTCGACTCTTTGGAGGCTTCGCATAC (SEQ ID No. 6, GTCGAC is a restriction endonuclease) Room I. Identification site).

[0051] 2. Using DNA from 93-11 as a template and SD10-CTP-F and SD10-CTP-R as primers, PCR amplification was performed to obtain a DNA fragment of approximately 6046 bp. The fragment was then recovered and digested with enzymes.

[0052] 3. Using restriction endonucleases Eco R Ⅰ and Room I. The vector pCAMBIA1300 was digested with enzymes, and approximately 11 kb of the vector backbone was recovered.

[0053] 4. Ligate the enzyme digestion product to the vector backbone to obtain the recombinant plasmid.

[0054] Based on the sequencing results, the structure of the recombinant plasmid pCTP-SD10 is described as follows: The small DNA fragment between the EcoRI and SalRI recognition sequences of the vector pCAMBIA1300 is replaced with the DNA molecule whose nucleotide sequence is shown in positions 131 to 6176 of SEQ ID No. 3 in the sequence listing.

[0055] In the DNA molecule shown in SEQ ID No. 3 above, positions 131-2605 are the promoter sequence contained in the complementary vector; positions 2606-2683 are the 5' UTR sequence; and positions 2684-4814 are... SD10 Gene exon plus intron sequence; positions 4815-5012 are 3'UTR sequence.

[0056] II. Obtaining Recombinant Agrobacterium The recombinant plasmid pCTP-SD10 was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium EHA105 / pCTP-SD10.

[0057] III. Obtaining T0 generation transgenic plants The method used by Hiei et al. (Hiei Y, Ohta S, Komari T & Kumashiro T. Efficient transformation of rice) Rice L.) mediated by Agrobacteriumand sequence analysis of the boundaries of the T-DNA. Plant J. 1994, 6:271–282) Transformation of recombinant Agrobacterium EHA105 / pCTP-SD10 into NIL- sd10 T0 generation complementary transgenic plants were obtained.

[0058] IV. Real-time quantitative PCR detection of T0 generation transgenic plants Five T0 generation complementary transgenic plants were randomly selected (named CTP-1-T0 to CTP-5-T0, respectively) for real-time quantitative PCR detection. The specific steps are as follows: 1. Using 2-week-old seedlings of 5 T0 generation complementary transgenic plants as experimental materials, total RNA was first extracted with TRIZOL reagent, and then reverse transcribed with SuperScript II reverse transcriptase to obtain cDNA of each T0 generation complementary transgenic plant.

[0059] 2. RT-qPCR was used to detect the presence of [a specific substance] in five T0 generation complementary transgenic plants. SD10 Relative gene expression levels (in terms of) UBI (Genes used as internal reference genes). Detection SD10 The primers for the gene were the forward primer RT-SD10-ceF1:GGTGTGCCTTCTACAATTGC (SEQ ID No. 7) and the reverse primer RT-SD10-ceR1:CGGCTGTGAGCAGTAATGT (SEQ ID No. 8). The primers for the internal reference gene were UBI-F:CTGTCAACTGCCGCAAGAAG (SEQ ID No. 9) and UBI-R:GGCGAGTGACGCTCTAGTTC (SEQ ID No. 10).

[0060] 3. With NIL- sd10 middle SD10 The relative expression level of the gene was taken as 1, and the expression levels of other rice plants were statistically analyzed. SD10 The relative expression levels of genes. The results showed that, compared to NIL- sd10 In comparison, among the five T0 generation complementary transgenic plants SD10 The relative expression levels of all genes increased significantly.

[0061] The above results indicate that CTP-1-T0 to CTP-5-T0 are all positive T0 generation complementary transgenic plants.

[0062] V. Obtaining T2 generation homozygous complementary transgenic plants and real-time quantitative PCR detection CTP-1-T0 and CTP-2-T0 were self-crossed for two consecutive generations to obtain T2 generation homozygous complementary transgenic plants, which were named NIL- sd10 CTP -1 and NIL- sd10 CTP -2.

[0063] Following the method in step four, NIL- sd10 CTP -1, NIL- sd10 CTP -2 and NIL- sd10 Real-time quantitative PCR detection was performed separately.

[0064] Some test results can be found Figure 3 The results showed that, compared with NIL- sd10 In comparison, NIL- sd10 CTP -1 and NIL- sd10 CTP -2 SD10 The relative expression levels of all genes increased significantly.

[0065] VI. Phenotypic Identification of T2 Generation Homozygous Complementary Transgenic Plants The experimental materials were planted and grown at the Shangzhuang Experimental Base of China Agricultural University from May to October each year; and at the Nanfan Base in Sanya, Hainan from December to May of the following year.

[0066] During the maturity stage, 15 plants of the same growth pattern from both the parental and transgenic materials were selected for phenotypic investigation, including plant height, number of tillers, length of main stem panicle, number of grains per main stem panicle, number of primary branches, number of secondary branches, stem thickness, grain length, grain width, yield per plant, and mechanical strength.

[0067] Some experimental results can be found in Figure 3 (a. NIL- sd10 NIL- sd10 CTP -1, NIL- sd10 CTP -2. Ear type comparison, bar = 5 cm. b. Grain width comparison, bar = 1 cm. c. Grain length comparison, bar = 1 cm. d. Stem diameter comparison, bar = 1 cm. e. NIL- sd10 The relative expression levels of complementary transgenic plants. Phenotypic data are statistically analyzed, including plant height, number of tillers, number of grains per panicle on the main stem, number of primary branches, number of secondary branches, number of grains per primary branch, number of grains per secondary branch, grain length, grain width, thousand-grain weight, yield per plant, stem thickness (stem diameter), and mechanical strength (breaking force). The values ​​are presented as mean ± standard error, two-tailed. t(Test), it can be seen that, compared with NIL- sd10 In comparison, NIL- sd10 CTP -1, NIL- sd10 CTP -2 significantly increased per-plant yield, stem diameter, and mechanical strength. 。

[0068] Example 3: Obtaining and phenotypic identifying T2 generation homozygous interference transgenic plants I. Construction of recombinant plasmid pRNAi-SD10 The construction steps of recombinant plasmid pRNAi-SD10 are as follows: 1. Synthetic primers According to SEQ ID No. 1 in the sequence list SD10 Based on the gene sequence, primers SD10-Ri-1F, SD10-Ri-1R, SD10-Ri-2F, and SD10-Ri-2R were designed and synthesized; the primer sequences are as follows: SD10-Ri-1F:TTTCGAGATTTTCAATCGATACTAGTCAGCAGATAGGTGTGCCTTC (SEQ IDNo.11) (ACTAGT is a restriction endonuclease) Spe I's identification site); SD10-Ri-1R: TTGAACGATCGGGGAAATTCGAGCTCCGATCCATAAAAGTGTGCGC (SEQ IDNo.12) (GAGCTC is a restriction endonuclease) Bag I. Identification site); SD10-Ri-2F:TTCTGCAGGTCGACTCTAGAGGATCCCGATCCATAAAAGTGTGCGC (SEQ IDNo.13) (GGATCC is a restriction endonuclease) BamH I. Identification site); SD10-Ri-2R: GCAGATCTGTCGACCTCGAGGGTACCCAGCAGATAGGTGTGCCTTC (SEQ IDNo.14) (GGTACC is a restriction endonuclease) CPN I. Identification site).

[0069] 2. RNA was extracted from 93-11 and reverse transcribed to obtain cDNA. Using the cDNA from 93-11 as a template and SD10-Ri-1F and SD10-Ri-1R as primers, PCR amplification was performed to obtain DNA fragment A of approximately 334 bp. PCR product 1 was recovered.

[0070] 3. Using cDNA from 93-11 as a template and SD10-Ri-2F and SD10-Ri-2R as primers, PCR amplification was performed to obtain DNA fragment B of approximately 334 bp. PCR product 2 was recovered.

[0071] 4. Using restriction endonucleases Spe I and Bag I digested the vector pTCK303 / JL1460 with enzyme I, and recovered approximately 14.6 kb of the vector backbone.

[0072] 5. Ligate PCR product 1 with vector backbone 1 to obtain intermediate plasmid.

[0073] 6. Using restriction endonucleases BamH I and CPN I digested the intermediate plasmid with enzyme 1 and recovered approximately 14.9 kb of the vector backbone 2.

[0074] 7. Ligate PCR product 2 with vector backbone 2 to obtain recombinant plasmid pRNAi-SD10.

[0075] Based on the sequencing results, the structure of the recombinant plasmid pRNAi-SD10 is described as follows: The vector pTCK303 / JL1460... BamH I identify sequences and CPN The I-recognition sequence replaces the small DNA fragments between the sequences with the nucleotide sequence that is the reverse complementary sequence of the DNA molecule shown in SEQ ID No. 1 from position 440 to position 773 from the 5' end, and replaces the vector pTCK303 / JL1460. Spe I identify sequences and Bag The DNA fragments between the I-identifying sequences are replaced by the nucleotide sequence shown in SEQ ID No. 1 of the sequence listing, from position 440 to position 773 from the 5' end, representing the DNA molecule.

[0076] II. Obtaining Recombinant Agrobacterium The recombinant plasmid pRNAi-SD10 was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium EHA105 / pRNAi-SD10.

[0077] III. Obtaining T0 generation interference transgenic plants The method used by Hiei et al. (Hiei Y, Ohta S, Komari T & Kumashiro T. Efficient transformation of rice) Rice L.) mediated by Agrobacterium (and sequence analysis of the boundaries of the T-DNA. Plant J. 1994, 6:271–282) Recombinant Agrobacterium EHA105 / pRNAi-SD10 was transformed into 93-11 (hereinafter referred to as indica rice) to obtain T0 generation interference transgenic plants.

[0078] IV. Real-time quantitative PCR detection of T0 generation interference transgenic plants Five T0 generation interference transgenic plants (named RNAi-1-T0 to RNAi-5-T0, respectively) were randomly selected for real-time quantitative PCR detection. The specific steps are as follows: 1. Using 2-week-old seedlings of 5 T0 generation interference transgenic plants as experimental materials, total RNA was first extracted with TRIZOL reagent, and then reverse transcribed with SuperScript II reverse transcriptase to obtain cDNA of each T0 generation interference transgenic plant.

[0079] 2. RT-qPCR was used to detect the presence of [a certain substance] in five T0 generation interference transgenic plants. SD10 Relative gene expression levels (in terms of) UBI (Genes used as internal reference genes).

[0080] Detection SD10 The primers for the gene are as follows: RT-SD10-ceF:CAGTCGTCCAGGTTATTGG (SEQ ID No.15) RT-SD10-ceR: CCTGAGGAGCTGAGTTCTCA (SEQ ID No. 16).

[0081] Detection UBI The primers for the gene are as follows: UBI-F:CTGTCAACTGCCGCAAGAAG and UBI-R:GGCGAGTGACGCTCTAGTTC Following the method described above, the T0 generation interference transgenic plants were replaced with 93-11, with all other steps remaining unchanged, to obtain the 93-11 transgenic plants. SD10 Relative gene expression levels. (Based on 93-11) SD10 The relative expression level of the gene was taken as 1, and the expression levels of other rice plants were statistically analyzed. SD10The relative expression level of genes.

[0082] The results showed that, compared with 93-11, the five T0 generation interference transgenes... SD10 The relative expression levels of all genes were significantly reduced.

[0083] The above results indicate that RNAi-1-T0 to RNAi-5-T0 are all T0 generation interference transgenic positive plants.

[0084] V. Obtaining T2 generation homozygous interference transgenic plants and real-time quantitative PCR detection RNAi-1-T0 and RNAi-2-T0 were self-crossed for two consecutive generations to obtain T2 generation homozygous interference transgenic plants, which were named 93-11. RNAi -1 and 93-11 RNAi -2.

[0085] Following the method in step four, for 93-11 RNAi -1 and 93-11 RNAi Real-time quantitative PCR was performed on -2 and 93-11, respectively.

[0086] Some test results can be found Figure 4 e. It can be seen that, compared with 93-11, 93-11 RNAi -1 and 93-11 RNAi -2 SD10 The relative expression levels of all genes were significantly reduced.

[0087] VI. Phenotypic Identification of T2 Generation Homozygous Interference Transgenic Plants The experimental materials were planted and grown at the Shangzhuang Experimental Base of China Agricultural University from May to October each year; and at the Nanfan Base in Sanya, Hainan from December to May of the following year.

[0088] At the maturity stage, the 93-11 indica rice and the T2 generation homozygous interference transgenic plants 93-11 were subjected to [a specific method / initiative]. RNAi -1 and 93-11 RNAi -2 Fifteen plants with consistent growth were selected for phenotypic investigation, including plant height, number of tillers, length of main stem panicle, number of grains per main stem panicle, number of primary branches, number of secondary branches, stem thickness, grain length, grain width, yield per plant, and mechanical strength (measured using a plant stem strength tester).

[0089] Some experimental results can be found in Figure 4 (a. 93-11 and 93-11) RNAi a. Ear shape comparison, bar = 5 cm. b. Grain width comparison, bar = 1 cm. c. Grain length comparison, bar = 1 cm. d. Stem diameter comparison, bar = 1 cm. e. NIL- sd10 The relative expression levels of the transgenic plants and the interference plants. Phenotypic data statistics include plant height, number of tillers, number of grains per panicle on the main stem, number of primary branches, number of secondary branches, number of grains per primary branch, number of grains per secondary branch, grain length, grain width, thousand-grain weight, yield per plant, stem thickness (stem diameter), and mechanical strength (breaking force). The values ​​are presented as mean ± standard error, two-tailed. t (Test results) show that, compared with indica rice 93-11, the T2 generation homozygous interference transgenic plants 93-11 RNAi -1 and 93-11 RNAi -2 significantly reduced the number of grains per spike on the main stem, yield per plant, stem thickness, and mechanical strength.

[0090] This indicates that inhibition SD10 Gene expression can reduce the number of grains per panicle, yield per plant, stem thickness, and mechanical strength in rice.

[0091] Example 4 SD10 Application of genes in improving rice yield and lodging resistance SD10 The expression level is high in the internodes and low in the young spikelet, therefore, the promoter with high expression in the young spikelet is utilized. pDEP1 drive SD10 High expression in young spikelets is expected to increase yield.

[0092] I. Recombinant plasmid p DEP1 -SD10 build 1. Synthetic primers According to SEQ ID No. 1 in the sequence list SD10 Based on the gene sequence, primers DEP1-1F, DEP1-1R, DEP1-SD10-2F, and DEP1-SD10-2R were designed and synthesized; the primer sequences are as follows: DEP1-1F: AACAGCTATGACATGATTACGAATTCCGTATTGAGAAACATAATCA (SEQ ID No. 17, GAATTC is a restriction endonuclease) Eco RI identification site) DEP1-1R:GCGCGTGGACTGCCTGGGTTGAGTTCAACAGCGAGCGGGG (SEQ ID No. 18) DEP1-SD10-2F:CCCCGCTGCTGTTGAACTCACCCAGGCAGTCCACGCGC (SEQ ID No. 19) DEP1-SD10-2R:CCAAGCTTGCATGCCTGCAGGTCGACTGACGTTTGGTGAAGCATGA (SEQ ID No. 20, GTCGAC is a restriction endonuclease) Room I. Identification site).

[0093] 2. Using ZH17 DNA as a template, PCR amplification was performed using DEP1-1F / DEP1-1R and DEP1-SD10-2F / DEP1-SD10-2R primers, respectively, yielding approximately 2700 bp. DEP1 Promoter sequence (fragment 1) and 3196 bp SD10 Genome sequence (fragment 2), recovered fragment.

[0094] 3. Using restriction endonucleases Eco R Ⅰ and Room I. The vector pCAMBIA1300 was digested with enzymes, and approximately 11 kb of the vector backbone was recovered.

[0095] 4. Connect fragment 1 and fragment 2 to the vector backbone to obtain the recombinant plasmid.

[0096] Based on the sequencing results, the recombinant plasmid p DEP1 The structure of -SD10 is described as follows: The carrier pCAMBIA1300... Eco R Ⅰ and Room Ⅰ The DNA fragments between the recognition sequences are replaced with DNA molecules whose nucleotide sequences are sequentially linked together from positions 2606 to 5801 of SEQ ID No. 4 and SEQ ID No. 3 in the sequence listing, with position 2700 of SEQ ID No. 4 adjacent to position 2606 of SEQ ID No. 3.

[0097] II. Obtaining Recombinant Agrobacterium Recombinant plasmid p DEP1 -SD10 was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium tumefaciens EHA105 / p DEP1 -SD10.

[0098] III. Obtaining T0 generation transgenic plants The method used by Hiei et al. (Hiei Y, Ohta S, Komari T & Kumashiro T. Efficient transformation of rice) Rice L.) mediated by Agrobacteriumand sequence analysis of the boundaries of the T-DNA. Plant J. 1994, 6:271–282) Recombinant Agrobacterium EHA105 / p DEP1 -SD10 was used to transform ZH17 (hereinafter referred to as japonica rice) to obtain T0 generation transgenic plants.

[0099] IV. Real-time quantitative PCR detection of T0 generation transgenic plants Five transgenic plants of the obtained T0 generation were randomly selected (named DEP1-SD10-1-T0 to DEP1-SD10-5-T0, respectively) for real-time quantitative PCR detection. The specific steps are as follows: 1. Using approximately 1 cm young spikelets from 5 T0 generation transgenic plants as experimental materials, total RNA was first extracted using TRIZOL reagent, and then reverse transcribed using SuperScript II reverse transcriptase to obtain cDNA from each T0 generation transgenic plant.

[0100] 2. RT-qPCR was used to detect the presence of [a specific substance] in five T0 generation transgenic plants. SD10 Relative gene expression levels (in terms of) UBI (Genes used as internal reference genes).

[0101] Detection SD10 The primers for the gene are the forward primer RT-SD10-ceF1: GGTGTGCCTTCTACAATTGC and the reverse primer RT-SD10-ceR1: CGGCTGTGAGCAGTAATGT.

[0102] Detection UBI The primers for the gene are UBI-F:CTGTCAACTGCCGCAAGAAG and UBI-R:GGCGAGTGACGCTCTAGTTC.

[0103] 3. Taking ZH17 as an example SD10 The relative expression level of the gene was taken as 1, and the expression levels of other rice plants were statistically analyzed. SD10 The relative expression level of genes.

[0104] The results showed that, compared with ZH17, the five T0 generation transgenic plants had lower T0 ...00 T000 T000 T000 T000 T000 T000 T000 T000 T000 T SD10 The relative expression levels of all genes increased significantly.

[0105] The above results indicate that DEP1-SD10-1-T0 to DEP1-SD10-5-T0 are all T0 generation transgenic positive plants.

[0106] V. Obtaining T2 generation homozygous transgenic plants and real-time quantitative PCR detection DEP1-SD10-1-T0 and DEP1-SD10-2-T0 were self-crossed for two consecutive generations to obtain T2 generation homozygous transgenic plants, which were named p DEP1 :sd10-1 and p DEP1 :sd10-2.

[0107] Following the method in step four, p DEP1 :sd10-1 and p DEP1 sd10-2 and ZH17 were detected by real-time quantitative PCR.

[0108] Some test results can be found Figure 5 The results show that, compared to ZH17, p DEP1 :sd10-1 and p DEP1 : sd10-2 SD10 The relative expression levels of all genes increased significantly.

[0109] VI. Phenotypic Identification of T2 Generation Homozygous Transgenic Plants The experimental materials were planted and grown at the Shangzhuang Experimental Base of China Agricultural University from May to October each year; and at the Nanfan Base in Sanya, Hainan from December to May of the following year.

[0110] During the maturity stage, the parental material ZH17 and the transgenic material p... DEP1 :sd10-1 and p DEP1 For sd10-2, 15 plants with consistent growth were selected for phenotypic investigation, including the number of grains per spike on the main stem, thousand-grain weight, yield per plant, stem thickness, and mechanical strength.

[0111] Some experimental results can be found in Figure 5 (a. ZH17 and p) DEP1 : sd10-1 field phenotypic comparison. b. ZH17, p DEP1 :sd10-1 and p DEP1 c. Ear type comparison (sd10-2), bar = 5 cm. d. Grain length comparison (bar = 1 cm). e. Grain width comparison (bar = 1 cm). ZH17, p DEP1 :sd10-1 and p DEP1 Comparison of sd10-2 expression levels. Phenotypic data statistics include: number of grains per panicle on the main stem, thousand-grain weight, yield per plant, stem thickness (stem diameter), and mechanical strength (breaking force). Values ​​are presented as mean ± standard error, two-tailed. t (Test results) show that, compared with Japonica rice ZH17, the T2 generation homozygous transgenic plants p DEP1 :sd10-1 and p DEP1The number of grains per spike, thousand-grain weight, yield per plant, stem thickness and mechanical strength of sd10-2 were significantly improved.

[0112] The results in summary prove that SD10 Genes simultaneously influence traits such as yield per plant and stem thickness, playing a crucial role in regulating rice yield and lodging resistance.

[0113] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. The use of a protein, a substance that upregulates, enhances, or increases the expression of the gene encoding the protein, or a substance that upregulates, enhances, or increases the activity or content of the protein in at least one of the following: A1) Improve plant resistance to lodging; A2) Increase plant yield; A3) Cultivate lodging-resistant plants; A4) Cultivating high-yield plants; A5) Plant breeding; The protein is any one of the following: The protein shown in B1) includes the amino acid residues shown in SEQ ID No. 2; The protein shown in B2) has more than 80% amino acid residue identity with the protein shown in B1) and has the same function; The protein shown in B3) includes the protein shown in B1) or B2) by attaching a tag to its N-terminus and / or C-terminus to obtain the protein with the sequence shown.

2. The application according to claim 1, characterized in that: The substance is any one of the following: C1) A nucleic acid molecule encoding the protein described in claim 1; C2) An expression cassette containing the nucleic acid molecule described in C1); C3) a recombinant vector containing the nucleic acid molecule described in C1), or a recombinant vector containing the expression cassette described in C2); C4) Recombinant microorganisms containing the nucleic acid molecules described in C1), or recombinant microorganisms containing the expression cassette described in C2), or recombinant microorganisms containing the recombinant vector described in C3); C5) A transgenic plant cell line containing the nucleic acid molecule described in C1), or a transgenic plant cell line containing the expression cassette described in C2), or a transgenic plant cell line containing the recombinant vector described in C3); C6) Transgenic plant tissue containing the nucleic acid molecule described in C1), or transgenic plant tissue containing the expression cassette described in C2), or transgenic plant tissue containing the recombinant vector described in C3); C7) a transgenic plant organ containing the nucleic acid molecule described in C1), or a transgenic plant organ containing the expression cassette described in C2), or a transgenic plant organ containing the recombinant vector described in C3).

3. The application according to claim 2, characterized in that: The nucleic acid molecule shown in C1) is any one of the following: c1) includes the DNA molecule shown in SEQ ID No. 1; c2) includes the DNA molecule shown in SEQ ID No. 3; c3) includes the DNA molecule shown in positions 131-6176 of SEQ ID No. 3; c4) includes the DNA molecule shown in positions 2606-5801 of SEQ ID No. 3; c5) includes a DNA molecule obtained by sequentially linking the sequences shown in positions 2606-5801 of SEQ ID No. 4 and SEQ ID No. 3; c6) has more than 75% identity with any of the defined nucleotide sequences c1)-c5) and encodes a cDNA molecule or DNA molecule that encodes the protein of claim 1. c7) hybridizes under stringent conditions with any of the defined nucleotide sequences of c1)-c5) and encodes a cDNA molecule or DNA molecule that encodes the protein of claim 1.

4. A method for improving plant lodging resistance, comprising the following steps: upregulating or enhancing or increasing the expression level of the nucleic acid molecule encoding the protein of claim 1 in the plant, and / or upregulating or enhancing or increasing the activity and / or content of the protein of claim 1 in the plant, thereby improving plant lodging resistance.

5. A method for cultivating lodging-resistant plants, comprising the following steps: upregulating or enhancing or increasing the expression level of the nucleic acid molecule encoding the protein of claim 1 in the recipient plant, and / or upregulating or enhancing or increasing the activity and / or content of the protein of claim 1 in the recipient plant, to obtain the target plant, which is a lodging-resistant plant; The target plant exhibits higher lodging resistance than the recipient plant.

6. A method for increasing plant yield, comprising the steps of: upregulating or enhancing or increasing the expression level of the nucleic acid molecule encoding the protein of claim 1 in the plant, and / or upregulating or enhancing or increasing the activity and / or content of the protein of claim 1 in the plant, thereby increasing plant yield.

7. A method for cultivating high-yield plants, comprising the following steps: upregulating or enhancing or increasing the expression level of the nucleic acid molecule encoding the protein of claim 1 in the recipient plant, and / or upregulating or enhancing or increasing the activity and / or content of the protein of claim 1 in the recipient plant, thereby obtaining the target plant, which is a high-yield plant; The yield of the target plant is higher than that of the recipient plant.

8. The application according to any one of claims 1-3 or the method according to any one of claims 4-7, characterized in that: The plant is any one of the following: D1) dicotyledonous plants; D2) monocotyledonous plants; D3) grasses; D4) rice; D5) indica rice.

Images