Primer pair capable of directly detecting DNA methylation and application, detection reagent and detection method thereof

Abstract

The invention discloses a primer pair capable of directly detecting DNA methylation and application thereof, a detection reagent and a detection method, belongs to the technical field of gene detection, and particularly relates to a primer pair capable of directly detecting DNA methylation, the primer pair comprises a forward primer and a reverse primer, the forward primer and / or the reverse primer are / is modified by 2 '-F RNA, and the forward primer and the reverse primer cover methylation sites of DNA to be detected. According to the primer pair capable of directly detecting DNA methylation, a to-be-detected sample does not need to be pretreated, 2 '-F RNA modification is carried out on the primer pair for detecting the to-be-detected sample, an unmethylated template is normally amplified, but amplification of a DNA methylated template is limited, and therefore the purpose that DNA methylation and non-methylation can be directly distinguished without pretreatment is achieved.

Description

Technical Field

[0001] This invention belongs to the field of gene detection technology, and in particular relates to a primer pair that can directly detect DNA methylation, its application, detection reagents and detection methods. Background Technology

[0002] DNA methylation, a key form of DNA chemical modification, is not only an important mechanism for gene expression regulation but also one of the most significant molecular alterations in the early stages of tumorigenesis. Recent studies have shown that aberrant methylation of CpG island regions is an important molecular marker for various cancers and has become a frontier and hot topic in current tumor epigenetics research. However, existing DNA methylation detection technologies generally face technical bottlenecks due to time-consuming and cumbersome procedures, primarily the inability to directly distinguish between methylated and unmethylated cytosine (C), requiring specific pretreatment of DNA samples before detection. The most common pretreatment methods include bisulfite conversion, methylation-sensitive restriction endonucleases, immunoprecipitation, and chemical labeling. Among these, bisulfite conversion is the most widely used pretreatment method, converting unmethylated C to uracil (U) (which manifests as thymine after PCR amplification) while retaining methylated C unchanged, thus significantly improving the ability to distinguish between methylated and unmethylated sites. Furthermore, specific enzymatic or chemical treatments can enhance selectivity for target regions, reduce background noise, and make the results more reliable. However, the cumbersome pretreatment can lead to serious loss of low-quality or trace DNA samples, increasing the cost and difficulty of the experiment. Furthermore, taking bisulfite treatment as an example, when some unmethylated C cannot be effectively converted to U during the transformation process, this will introduce false positive or false negative results, affecting the accuracy and reproducibility of the test results, which also seriously restricts the application value of DNA methylation in clinical diagnosis.

[0003] With the development of detection technologies, third-generation sequencing technologies such as Single Molecule Real-Time (SMRT) and nanopore sequencing have overcome read length limitations, achieving ultra-long reads and single-base detection, and have been applied to the detection of whole-genome DNA methylation. SMRT sequencing can detect 5mC modification at 250x coverage based on polymerase kinetics, but this method cannot directly detect 5mC at single-molecule resolution. Nanopore sequencing, with its unique signal readout method, achieves the goal of directly detecting DNA methylation without pretreatment by reading the difference in electrical signals between methylated and unmethylated DNA. However, nanopore sequencing technology has limited resolution of the raw signal for detecting methylation, has a higher error rate than sulfite sequencing, requires algorithm correction, and has high cost for low-throughput single-sample detection. Therefore, even though third-generation sequencing technology can directly detect DNA methylation without pretreatment, it is still difficult to truly apply it in clinical practice. Other studies have found that DNA polymerization behavior is strongly influenced by different modes of methylcytosine, leading to fundamental differences in DNA solubilization and DNA-gold affinity between cancer and normal genomes. Based on this characteristic, some studies have utilized electrochemical and colorimetric techniques, respectively, on planar and colloidal gold surfaces, to develop DNA methylation detection technologies that can directly distinguish between cancer patients and healthy individuals, taking advantage of differences in gDNA adsorption levels. However, this technology differentiates between cancer patients and healthy individuals by judging the affinity between the entire genomic DNA and gold, and cannot achieve true targeted detection of a specific DNA methylation to more precisely differentiate different disease types, disease stages, or recurrences. Other studies have utilized the property of intercalating nucleic acid (INA) to increase the DNA melting temperature (Tm), modifying primers and probes with INA. Due to the difference in Tm between methylated and unmethylated sequences, DNA methylation detection without pretreatment has been achieved. However, this method requires complex primer design, severely limiting the detectable methylation regions, and detecting only a single DNA methylation site significantly reduces the distinguishing effect between methylated and unmethylated DNA.

[0004] Therefore, there is a need to develop new methods that can directly detect DNA methylation, providing simpler reaction systems and design ideas to implement targeted DNA methylation detection without pretreatment at a lower detection cost. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention proposes a primer pair for direct detection of DNA methylation, along with its application, detection reagents, and detection method. The primer pair provided by this invention eliminates the need for sample pretreatment. This invention relates to the modification of primers with 2'-fluoroRNA monomers. This chemical modification involves replacing the 2'-OH group of the ribose with a highly electronegative fluorine atom, forming a 2'-F-ribonucleoside ring with a C3'-terminal conformation. Therefore, oligonucleotides containing 2'-F RNA monomers adopt a more thermodynamically stable α-helical structure when hybridizing with the target. This invention, by modifying the primer pair for detecting the sample with 2'-F RNA, allows for the normal amplification of unmethylated templates while restricting the amplification of DNA methylated templates, thereby achieving the goal of directly distinguishing between methylated and unmethylated DNA without pretreatment.

[0006] To achieve the above objectives, the present invention provides a primer pair for direct detection of DNA methylation, the primer pair comprising a forward primer and a reverse primer, wherein the forward primer and / or the reverse primer is modified with 2'-F RNA, and the forward primer and the reverse primer cover the methylation site of the DNA to be detected.

[0007] Preferably, the number of bases modified by 2'-F RNA in the forward primer is ≥1, the number of bases modified by 2'-F RNA in the reverse primer is ≥1, and the length of the forward primer is 5-15 nt, 15-20 nt, 20-30 nt, 30-40 nt, 40-50 nt, 50-60 nt, 60-70 nt, 70-80 nt, 80-90 nt, 90-100 nt, 100-110 nt, 110-120 nt, 120-130 nt, 130-140 nt, or 140 nt. The reverse primer has a length of 5-15 nt, 15-20 nt, 20-30 nt, 30-40 nt, 40-50 nt, 50-60 nt, 60-70 nt, 70-80 nt, 80-90 nt, 90-100 nt, 100-110 nt, 110-120 nt, 120-130 nt, 130-140 nt, or 140-150 nt.

[0008] Preferably, the forward primer further includes other modifications, including one or more of the following: locked nucleic acid, peptide nucleic acid, 2-methoxy base, thio, deoxyhypoxanthine, deoxyuracil, phosphorylation, biotin, digoxigenin, amyl arm, inosine, 1-(2'-deoxy-β-D-furanibosyl)-3-nitropyrrole, or 5-nitroindole. The reverse primer further includes other modifications, including one or more of the following: locked nucleic acid, peptide nucleic acid, 2-methoxy base, thio, deoxyhypoxanthine, deoxyuracil, phosphorylation, biotin, digoxigenin, amyl arm, inosine, 1-(2'-deoxy-β-D-furanibosyl)-3-nitropyrrole, or 5-nitroindole.

[0009] The present invention also provides the application of the primer pair in the preparation of DNA methylation detection reagents.

[0010] Preferably, the DNA methylation detection reagent is used to detect single-stranded nucleic acids and / or double-stranded nucleic acids, wherein the single-stranded nucleic acids are derived from prokaryotes, eukaryotes, viruses, cell lines or viroids, and the double-stranded nucleic acids are derived from prokaryotes, eukaryotes, viruses, cell lines or viroids.

[0011] The present invention also provides a DNA methylation detection reagent, comprising: one or more of the following: the primer pair, the internal reference gene, the internal reference gene primer pair, the specific probe targeting the sample to be tested, the specific probe targeting the internal reference gene, the nucleic acid polymerase, the reagent for nucleic acid amplification, the reagent for sequencing, the reagent for gene chip detection, or the reagent for melting curve analysis.

[0012] Preferably, the specific probe targeting the sample to be tested is labeled with a reporter group and a quencher group, the specific probe targeting the sample to be tested specifically detects the target nucleic acid amplified by the primer pair, the specific probe targeting the sample to be tested has a linear or hairpin structure, the specific probe targeting the sample to be tested has resistance to 5' nuclease activity, and the length of the specific probe targeting the sample to be tested is 5-15 nt, 15-20 nt, 20-30 nt, 30-40 nt, 40-50 nt, 50-60 nt, 60-70 nt, 70-80 nt, 80-90 nt, 90-100 nt, 100-110 nt, 110-120 nt, 120-130 nt, 130-140 nt, or 140-150 nt.

[0013] Preferably, the specific probe targeting the internal reference gene is labeled with a reporter group and a quencher group, the specific probe targeting the internal reference gene specifically detects the target nucleic acid amplified by the primer pair of the internal reference gene, the specific probe targeting the internal reference gene has a linear or hairpin structure, the specific probe targeting the internal reference gene has resistance to 5' nuclease activity, and the length of the specific probe targeting the internal reference gene is 5-15 nt, 15-20 nt, 20-30 nt, 30-40 nt, 40-50 nt, 50-60 nt, 60-70 nt, 70-80 nt, 80-90 nt, 90-100 nt, 100-110 nt, 110-120 nt, 120-130 nt, 130-140 nt, or 140-150 nt;

[0014] The nucleic acid polymerase is a template-dependent nucleic acid polymerase;

[0015] The reagents used for nucleic acid amplification include one or more of the following: enzyme working buffer, dNTPs, water, a solution containing magnesium ions, or single-stranded DNA binding proteins.

[0016] The reagents used for sequencing include one or more of the following: enzyme working buffer, dNTPs, ddNTPs, water, solution containing magnesium ions, single-stranded DNA binding protein, ligase, nucleic acid adapter, or sequencing primer.

[0017] The reagents used for gene chip detection include one or more of the following: enzyme working buffer, dNTPs, water, hybridization buffer, washing buffer, or labeling reagent.

[0018] The reagents used for melting curve analysis include detection probes.

[0019] The present invention also provides a detection method using the DNA methylation detection reagent, comprising the following steps:

[0020] The sample to be tested is mixed with a specific probe targeting the sample, the primer pair that can directly detect DNA methylation, and a nucleic acid polymerase, and then amplified by PCR to obtain the methylation Ct value and the unmethylation Ct value of the sample to be tested.

[0021] The internal reference gene was mixed with a specific probe targeting the internal reference gene, primer pairs for the internal reference gene, and nucleic acid polymerase, and then amplified by PCR to obtain the Ct value of the internal reference gene.

[0022] The methylation Ct value of the sample to be tested is compared with the Ct value of the internal reference gene, and the unmethylated Ct value of the sample to be tested is compared with the Ct value of the internal reference gene to determine whether the sample to be tested has DNA methylation.

[0023] Preferably, the step of comparing the methylation Ct value of the sample to be tested with the Ct value of the internal reference gene, and comparing the unmethylated Ct value of the sample to be tested with the Ct value of the internal reference gene to determine whether the sample to be tested has DNA methylation, specifically involves comparing and analyzing the detection curve obtained from the methylation Ct value of the sample to be tested with the standard curve obtained from the Ct value of the internal reference gene, and comparing and analyzing the detection curve obtained from the unmethylated Ct value of the sample to be tested with the standard curve obtained from the Ct value of the internal reference gene to determine whether the sample to be tested has DNA methylation.

[0024] Compared with the prior art, the present invention has the following advantages and technical effects:

[0025] This invention provides a primer pair for direct detection of DNA methylation, its application, detection reagents, and detection method. This invention achieves direct detection of DNA methylation without pretreatment by modifying the primer pair used to detect the sample with 2'-F RNA. 2'-FRNA modification is a chemical modification that replaces the 2'-OH group of the ribose with a highly electronegative fluorine atom, forming a 2'-F-ribonucleoside ring with a C3'-terminal conformation. Therefore, oligonucleotides containing 2'-FRNA monomers adopt a more thermodynamically stable α-helical structure when hybridizing with the target.

[0026] Compared with existing methylation detection technologies:

[0027] (1) Compared with existing methylation detection methods that require cumbersome pretreatment before methylation detection, the present invention can achieve direct detection of DNA methylation;

[0028] (2) The DNA methylation detection method proposed in this invention omits the pretreatment step, reduces sample loss, and does not have the problem of incomplete conversion or false positives, making the methylation detection results more accurate and reliable.

[0029] (3) Compared with existing DNA methylation detection methods, the present invention is more time-saving, convenient, accurate and efficient in detecting DNA methylation;

[0030] Therefore, this invention develops a novel method for detecting DNA methylation, which enables direct detection of DNA methylation without pretreatment, and is highly advantageous for targeted and rapid detection of DNA methylation. Attached Figure Description

[0031] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0032] Figure 1 This is a schematic diagram of the DNA methylation detection method of the present invention. In the figure, F and R represent upstream and downstream primers, respectively. Hollow circles represent unmethylated, solid circles represent methylated, black arrows represent primers, black rhombuses represent 2'-F RNA modified on primers, and P represents detection probes.

[0033] Figure 2 To compare the amplification efficiency of different primer sets for detecting methylation in Example 1 using the dye method and probe method, A shows the amplification curves of primer pairs without 2'-F RNA or any other modification for detecting methylation using the dye method; B shows the amplification curves of primer pairs modified with 2'-F RNA for detecting methylation using the dye method; C shows the amplification curves of primer pairs without 2'-F RNA or any other modification for detecting methylation using the probe method; and D shows the amplification curves of primer pairs modified with 2'-F RNA for detecting methylation using the probe method. In the figures, solid black lines represent methylation-positive and dashed black lines represent methylation-negative.

[0034] Figure 3 Example 2 shows the amplification efficiency of different primer sets for detecting methylation. In the figure, A is the amplification curve of methylation detected by primer pair without 2'-F RNA or any other modification; B is the amplification curve of methylation detected by primer pair modified with 2'-F RNA and 1 locked nucleic acid; C is the amplification curve of methylation detected by upstream primer modified with 2'-F RNA and locked nucleic acid and downstream primer without 2'-F RNA or any other modification; D is the amplification curve of methylation detected by primer pair modified with 1 2'-F RNA and 2 locked nucleic acids. In the figure, the black solid line is HeLa cell line DNA, representing a methylation positive signal, and the black dashed line is Jurkat cell line DNA, representing a methylation negative signal.

[0035] Figure 4Example 3 shows the amplification efficiency of methylation detection using different primer pairs. A represents the amplification curve of methylation detection using primer pair consisting of upstream primer 6 and downstream primer 6; B represents the amplification curve of methylation detection using primer pair consisting of upstream primer 7 and downstream primer 7; C represents the amplification curve of methylation detection using primer pair consisting of upstream primer 6 and downstream primer 7; and D represents the amplification curve of methylation detection using primer pair consisting of upstream primer 7 and downstream primer 6. In the figure, the solid black line represents HeLa cell line DNA, indicating a methylation-positive template, and the dashed black line represents Jurkat cell line DNA, indicating a methylation-negative template.

[0036] Figure 5 Example 4 shows the amplification efficiency of methylation detection. In the figure, A is the methylation amplification curve of Hela cell line DNA, and B is the methylation amplification curve of Jurkat cell line DNA. The gray solid line represents the β-actin signal, the black solid line is the amplification curve of the Septin9 gene of Hela cell line, which represents the methylation positive signal, and the black dashed line is the amplification curve of the Septin9 gene of Jurkat cell line, which represents the methylation negative signal.

[0037] Figure 6 Example 5 shows the sensitivity determination for detecting DNA methylation. In the figure, the black dashed line represents 100% Jurkat, i.e., a methylation-negative signal. The gray dashed lines, from high to low, represent amplification signals of 50%, 25%, 12.5%, 6.25%, 3.125%, and 1.56% Jurkat, respectively. The black solid line represents 100% HeLa, i.e., a methylation-positive template.

[0038] Figure 7 The following are the experimental results of clinical samples tested in Example 6. In Example A, the amplification curves for methylation detection in HeLa and Jurkat cell line DNA using the method of the present invention are shown. The gray and black solid lines in the figure represent the amplification signals of the β-actin and Septin9 genes in HeLa cell line DNA, respectively, and the gray and black dashed lines represent the amplification signals of the β-actin and Septin9 genes in Jurkat cell line DNA, respectively. Example B shows the detection results of methylation-negative clinical samples, where the gray and black solid lines represent the amplification signals of the β-actin and Septin9 genes after DNA extraction from the sample, respectively. Example C shows the detection results of methylation-positive clinical samples, where the gray and black solid lines represent the amplification signals of the β-actin and Septin9 genes after DNA extraction from the sample, respectively. Detailed Implementation

[0039] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0040] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0041] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0042] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.

[0043] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0044] The primers modified with 2'-fluoroRNA monomers involved in this invention were developed by Xiamen Newtech Biotechnology Co., Ltd.

[0045] Example 1

[0046] Using the random methylation site cg26668608 on the PSD gene (NM_002779.5) as the target nucleic acid to be amplified, the ability of primers modified with 2'-fluoroRNA monomer (2'-F RNA) to directly detect DNA methylation was investigated. That is, by using a highly electronegative fluorine atom to replace the 2'-OH group of ribose, oligonucleotides modified with 2'-F RNA have stronger stability when hybridizing with the target.

[0047] The primer and probe sequences used in this embodiment are shown in Table 1. The instrument used in this embodiment is a SLAN 96 real-time fluorescence PCR instrument (Shanghai Hongshi Medical Technology Co., Ltd.).

[0048] Table 1. Specific nucleotide sequences of primers and probes used in Example 1.

[0049] Primers and probes Sequence (5'→3') Serial Number upstream primer 1 GGTGAGGAGGAGCG SEQ ID NO.1 Downstream primer 1 GAGCACTTCCTGGC SEQ ID NO.2 upstream primer 2 GGTGAGGAGGAG-CG SEQ ID NO.3 Downstream primer 2 GAGCACTTCCT-G-GC SEQ ID NO.4 Detection probe 1 FAM-AGCCGTCACAGCCACATTC-BHQ1 SEQ ID NO.5

[0050] Note: Bases preceded by a "-" are 2'-F RNA modified bases.

[0051] Using CpG Methyltransferase (M.SssI) enzyme (NEB) and following the instructions, a methylation function was specifically added to cytosine in the cytosine-guanine linkage sequence to simulate the methylation of cytosine. A water-treated plasmid was used to simulate the unmethylated state.

[0052] PCR amplification was performed using a 30 μL PCR reaction system, which included: 1×TaqPCR buffer (TaKaRa), 6 mM MgCl2, 0.25 mM dNTPs, 1 U Taq DNA polymerase (Takara), 0.3 μM dye or probe, 0.3 μM primers, 10 μL of template treated with M.SssI enzyme as a methylation-positive template, plasmid treated with water as a methylation-negative template, and a template-free control (water).

[0053] The reaction conditions for real-time PCR were: 95℃ pre-denaturation for 5 min; 50 cycles (95℃ denaturation for 20 s, 60℃ annealing for 20 s); and fluorescence signals from the FAM, HEX, ROX and Cy5 channels were collected during the annealing stage.

[0054] like Figure 2 China A Figure 2 B, Figure 2 C and Figure 2 As shown in Figure D, the ability of the primers modified with 2'-F RNA in Example 1 to distinguish between methylated and unmethylated DNA is illustrated. Solid black lines represent methylation-positive primers, and dashed black lines represent methylation-negative primers. Figure 2 China A and Figure 2 Chinese B uses the Syto 9 dye method. Figure 2 In study A, upstream primers 1 and 2 (i.e., primers without 2'-F RNA or any other modifications) were used to amplify the random methylation site cg26668608. The templates used were methylated positive templates treated with M.SssI and methylated negative templates treated with water. The results showed that there was no significant difference in the amplification curves between upstream primers 1 and 2 without 2'-F RNA or any other modifications when detecting methylated positive and negative templates.

[0055] like Figure 2As shown in Figure B, the effect of modifying the upstream primer 2 and downstream primer 2 with two 2'-F RNAs at their 3' ends on the amplification efficiency of methylated and unmethylated primers is illustrated. The results show that, compared with primer pairs without 2'-F RNA or any other modification, the upstream primer 2 and downstream primer 2 modified with 2'-F RNA exhibit a significant difference in amplification efficiency when binding methylated and unmethylated templates (ΔCt = 7.45).

[0056] Because dye-based methods have poor specificity, some non-specific amplifications may lead to spurious amplification of the ΔCt value. Therefore, if... Figure 2 C and Figure 2 As shown in Figure D, the difference in amplification between methylated and unmethylated DNA templates was compared again using the probe method with primer pairs without 2'-F RNA or any other modification. The results showed that the probe method detected a smaller difference in amplification between methylated and unmethylated DNA compared to the dye method. However, compared to primer pairs without 2'-F RNA or any other modification, primer pairs modified with 2'-F RNA still showed a difference in amplification between methylated and unmethylated DNA (ΔCt = 3.1). These results indicate that, regardless of whether the dye method or the probe method is used, primer pairs modified with 2'-F RNA exhibit significant differences in amplification efficiency when amplifying DNA templates that are methylated negative and positive, with the amplification efficiency for methylated negative templates being better than that for methylated positive templates.

[0057] Example 2

[0058] Using the CpG island sequence on the promoter of the Septin9 gene (NM_001113491.2)v2 transcript as an example, and with HeLa cell line as a DNA methylation-positive template and Jurkat cell line as a methylation-negative template, the ability of primer pairs modified with 2'-F RNA to distinguish between methylation-positive and methylation-negative templates was investigated. The sequences of the primers and probes used are shown in Table 2. The instrument used in this embodiment was a SLAN 96 real-time fluorescence PCR instrument.

[0059] Table 2. Specific nucleotide sequences of primers and probes used in Example 2.

[0060] Primers and probes Sequence (5'→3') Serial Number upstream primer 3 TCGGATCCCGCG SEQ ID NO.6 Downstream primer 3 AGCCAAGCACCCA SEQ ID NO.7 Downstream primer 3' CCAGCACAGCACTCAC SEQ ID NO.8 upstream primer 4 CGGATCCC+GCG SEQ ID NO.9 Downstream primer 4 GCCAAGCAC+CCA SEQ ID NO.10 upstream primer 5 CGGATCCC+G+CG SEQ ID NO.11 Downstream primer 5 GCCAAGCAC+C+CA SEQ ID NO.12 Detection probe 2 ROX-GCAGCTAGATGTGATCATTT-BHQ2 SEQ ID NO.13

[0061] Note: Bases preceded by a "-" are 2'-F RNA modified bases; bases preceded by a "+" are locked nucleic acid modified bases.

[0062] PCR amplification and melting curve analysis were performed using a 30 μL PCR reaction system, which included: 1×Taq PCR buffer (TaKaRa), 6 mM MgCl2, 0.25 mM dNTPs, 1 U Taq DNA polymerase (Takara), 0.3 μM probe, 0.3 μM primer, and 10 μL cell line DNA, or a negative control (water).

[0063] The reaction conditions for real-time PCR were: pre-denaturation at 95℃ for 5 min; 50 cycles (denaturation at 95℃ for 20 s, annealing at 60℃ for 20 s); and fluorescence signals of the FAM, HEX, ROX, and Cy5 channels were collected during the annealing phase. After PCR amplification, melting curve analysis was performed using the following program: denaturation at 95℃ for 2 min; incubation at 45℃ for 2 min; subsequently, the temperature was increased from 45℃ to 95℃ at a rate of 0.04℃ / s, and fluorescence signals of the FAM, HEX, ROX, and Cy5 channels were collected.

[0064] Experimental results are as follows Figure 3 As shown, Figure 3 Figure A shows that when using conventional primers (i.e., primers without 2'-F RNA or any other modifications) to amplify the HeLa and Jurkat cell lines, there is no significant difference in amplification efficiency between the two.

[0065] like Figure 3 As shown in Figure B, two 2'-F RNAs and one locked nucleic acid were simultaneously modified onto the upstream and downstream primers. The resulting upstream primer 4 and downstream primer 4 were used to amplify HeLa and Jurkat cell lines. The results showed that 2'-F RNA modification combined with other modifications (such as locked nucleic acid) on the upstream and downstream primers could also achieve the same effect of lower amplification efficiency for methylated templates than for unmethylated templates (ΔCt = 3.36).

[0066] like Figure 3 As shown in Figure C, upstream primer 4 was modified with two 2'-F RNAs and one locked nucleic acid, while downstream primer 3' was an unmodified conventional primer. These primers were used to amplify HeLa and Jurkat cell lines. The results showed that even with only upstream primers modified with 2'-F RNA and locked nucleic acid (LNA), there was still a difference in amplification efficiency between HeLa and Jurkat (ΔCt = 4.24).

[0067] like Figure 3As shown in Figure D, the upstream and downstream primers were modified simultaneously with one 2'-F RNA and two LNAs. The resulting upstream primer 5 and downstream primer 5 were used to amplify DNA templates from Hela and Jurkat cell lines, respectively. The results showed that when the number of LNAs was ≥2, even combined modification with 2'-F RNA would severely inhibit PCR amplification.

[0068] Example 3

[0069] Taking the CpG island sequence on the promoter of the Septin9 gene v2 transcript as an example, 2'-F RNA was modified at the methylated cytosine at the 5', 3', and middle positions of the primers, respectively. This demonstrated that modification of the 2'-F RNA at any position on the methylated cytosine of the primers could distinguish between methylated and unmethylated DNA. The primer and probe sequences used are shown in Table 3. The instrument used was a SLAN 96 real-time fluorescence PCR instrument.

[0070] Table 3. Specific nucleotide sequences of primers and probes used in Example 3.

[0071] Primers and probes Sequence (5'→3') Serial Number Upstream primer 6 T-CTGACAC-CG-C SEQ ID NO.14 Downstream primer 6 CACATT-CGAACTC-C SEQ ID NO.15 upstream primer 7 -CG-CA-CGATC-C SEQ ID NO.16 Downstream primer 7 -CGAC-CG-CGGC-C SEQ ID NO.17 Detection probe 2 ROX-GCAGCTAGATGTGATCATTT-BHQ2 SEQ ID NO.13

[0072] Note: Bases preceded by a "-" are 2'-F RNA modified bases.

[0073] PCR amplification and melting curve analysis were performed using a 30 μL PCR reaction system, which included: 1×Taq PCR buffer (TaKaRa), 6 mM MgCl2, 0.25 mM dNTPs, 1 U Taq DNA polymerase (Takara), 0.3 μM probe, 0.3 μM primer, and 10 μL cell line DNA, or a negative control (water).

[0074] The reaction conditions for real-time PCR were: pre-denaturation at 95℃ for 5 min; 50 cycles (denaturation at 95℃ for 20 s, annealing at 60℃ for 30 s); and fluorescence signals of the FAM, HEX, ROX, and Cy5 channels were collected during the annealing phase. After PCR amplification, melting curve analysis was performed using the following program: denaturation at 95℃ for 2 min; incubation at 45℃ for 2 min; subsequently, the temperature was increased from 45℃ to 95℃ at a rate of 0.04℃ / s, and fluorescence signals of the FAM, HEX, ROX, and Cy5 channels were collected.

[0075] Experimental results are as follows Figure 4 As shown, Example 3 demonstrates the ability to distinguish between DNA methylated and unmethylated DNA when different amounts of 2'-F RNA are used and modified at different positions on the primers.

[0076] like Figure 4As shown in Figure A, when one and two 2'-F RNAs are modified at the 5' and 3' ends of upstream primer 6 (upstream primer 6), and one 2'-F RNA is modified at the 3' end and middle part of downstream primer 6 (downstream primer 6), and this primer combination is used to amplify DNA templates from HeLa and Jurkat cell lines, it can also clearly distinguish between DNA methylated (HeLa) and unmethylated (Jurkat) DNA (ΔCt = 3.99).

[0077] like Figure 4 As shown in Figure B, when 2'-F RNA is modified at the 5' end, 3' end, and middle position of upstream primer 7 (upstream primer 7), and 2'-F RNA is also modified at the 5' end, 3' end, and middle position of downstream primer 7 (downstream primer 7), and each upstream and downstream primer is modified with 4 2'-F RNAs, the amplification signals of Hela and Jurkat are suppressed.

[0078] like Figure 4 As shown in Figure C, when using the upstream primer 6 and downstream primer 7 to amplify HeLa and Jurkat cell line DNA, the ΔCt between DNA methylation and unmethylation is 7.45. Figure 4 As shown in Figure D, when using the upstream primer 7 and downstream primer 6 to amplify HeLa and Jurkat respectively, PCR amplification will be inhibited. Therefore, 2'-F RNA can be modified at any position on the primers, but when the amount of 2'-F RNA is excessive, PCR amplification will be inhibited.

[0079] Example 4

[0080] In this embodiment, the amplification primers and probes for the internal reference gene β-actin were added to the system described in Example 3, and the amplification curve was used as the reference curve for this system. The primer and probe sequences used are shown in Table 4. The instrument used was a SLAN96 real-time fluorescence PCR instrument.

[0081] Table 4. Specific nucleotide sequences of primers and probes used in Example 4.

[0082] Primers and probes Sequence (5'→3') Serial Number Upstream primer 6 T-CTGACAC-CG-C SEQ ID NO.14 Downstream primer 7 -CGAC-CG-CGGC-C SEQ ID NO.17 Detection probe 2 ROX-GCAGCTAGATGTGATCATTT-BHQ2 SEQ ID NO.13 upstream primer 8 CATGTACGTTGCTATCCAGG SEQ ID NO.18 Downstream primer 8 GTAGATGGGCACAGTGTG SEQ ID NO.19 Detection probe 3 FAM-TACCACTGGCATCGTGATGGA-BHQ1 SEQ ID NO.20

[0083] Note: Bases preceded by a "-" are 2'-F RNA modified bases.

[0084] PCR amplification and melting curve analysis were performed using a 30 μL PCR reaction system, which included: 1×Taq PCR buffer (TaKaRa), 6 mM MgCl2, 0.25 mM dNTPs, 1 U Taq DNA polymerase (Takara), 0.3 μM probe, 0.3 μM primer, and 10 μL cell line DNA, or negative control (water).

[0085] The reaction conditions for real-time PCR were: pre-denaturation at 95℃ for 5 min; 50 cycles (denaturation at 95℃ for 20 s, annealing at 60℃ for 30 s); and fluorescence signals of the FAM, HEX, ROX, and Cy5 channels were collected during the annealing phase. After PCR amplification, melting curve analysis was performed using the following program: denaturation at 95℃ for 2 min; incubation at 45℃ for 2 min; subsequently, the temperature was increased from 45℃ to 95℃ at a rate of 0.04℃ / s, and fluorescence signals of the FAM, HEX, ROX, and Cy5 channels were collected.

[0086] Experimental results are as follows Figure 5 As shown, the results indicate that in the same PCR reaction system, when detecting the same concentration of Hela and Jurkat DNA templates, there was no significant difference in the amplification curves of the internal reference gene β-actin in the two templates, but the amplification Ct value of Hela was significantly higher than that of Jurkat.

[0087] like Figure 5 As shown in Figure A, subtracting the Ct value of β-actin from the Ct value of Septin9 in HeLa cell line DNA yields ΔCt-H = 16.28. Figure 5 As shown in Figure B, subtracting the Ct value of β-actin from the Ct value of Septin9 in Jurkat cell line DNA yields ΔCt-J = 8.41. ΔCt-H can be used as a quality control standard for system configuration, while ΔCt-J can be used as a reference standard to distinguish between DNA methylation and unmethylation. If the ΔCt value of the sample is less than ΔCt-J, it is judged as methylation-negative; if the ΔCt value is greater than ΔCt-J, it is judged as methylation-positive. These results indicate that modifying 2'-FRNA on primers and combining it with the Ct value of β-actin can directly distinguish between DNA methylation and unmethylation.

[0088] Example 5

[0089] The sensitivity of the system established in Example 4 was investigated. Jurkat and HeLa cell line DNA at concentrations of 10 ng / μL were mixed to prepare 100%, 50%, 25%, 12.5%, 6.25%, 3.125%, 1.56%, and 0% Jurkat templates, respectively, to explore its ability to detect methylated negative templates with different concentrations. The primers and probes used were the same as in Example 4. The instrument used was a SLAN 96 real-time fluorescence PCR instrument.

[0090] In this embodiment, a 30 μL PCR reaction system was used for PCR amplification and melting curve analysis. The PCR reaction system included: 1×Taq PCR buffer (TaKaRa), 6 mM MgCl2, 0.25 mM dNTPs, 1 U Taq DNA polymerase (Takara), 0.3 μM probe, 0.3 μM primer, and 10 μL cell line DNA, or negative control (water).

[0091] The reaction conditions for real-time PCR were: pre-denaturation at 95℃ for 5 min; 50 cycles (denaturation at 95℃ for 20 s, annealing at 60℃ for 30 s); and fluorescence signals of the FAM, HEX, ROX, and Cy5 channels were collected during the annealing phase. After PCR amplification, melting curve analysis was performed using the following program: denaturation at 95℃ for 2 min; incubation at 45℃ for 2 min; subsequently, the temperature was increased from 45℃ to 95℃ at a rate of 0.04℃ / s, and fluorescence signals of the FAM, HEX, ROX, and Cy5 channels were collected.

[0092] Experimental results are as follows Figure 6 As shown, even with a Jurkat content of only 1.56%, the present invention can distinguish between DNA methylation positive and methylation negative, demonstrating that the DNA methylation detection method described in this invention has high sensitivity.

[0093] Example 6

[0094] This embodiment examines the practicality of the present invention in detecting clinical samples. The primer and probe sequences used are the same as in Example 4. The instrument used is a SLAN 96 real-time fluorescence PCR instrument.

[0095] PCR amplification and melting curve analysis were performed using a 30 μL PCR reaction system, which included: 1×Taq PCR buffer (TaKaRa), 6 mM MgCl2, 0.25 mM dNTPs, 1 U Taq DNA polymerase (Takara), 0.3 μM probe, 0.3 μM primer, and 10 μL circulating tumor DNA, or a negative control (water).

[0096] The reaction conditions for real-time PCR were: pre-denaturation at 95℃ for 5 min; 50 cycles (denaturation at 95℃ for 20 s, annealing at 60℃ for 30 s); and fluorescence signals of the FAM, HEX, ROX, and Cy5 channels were collected during the annealing phase. After PCR amplification, melting curve analysis was performed using the following program: denaturation at 95℃ for 2 min; incubation at 45℃ for 2 min; subsequently, the temperature was increased from 45℃ to 95℃ at a rate of 0.04℃ / s, and fluorescence signals of the FAM, HEX, ROX, and Cy5 channels were collected.

[0097] Experimental results are as follows Figure 7 As shown, the results demonstrate the ability of the present invention to detect some clinical samples related to colorectal cancer using the system of the present invention, and to examine the ability of the present invention to directly detect and distinguish between Septin9 gene methylation and non-methylation.

[0098] like Figure 7 As shown in Figure A, according to the judgment rules described in Example 4, ΔCt-H = 36.94 - 24.41 = 12.53 and ΔCt-J = 31.87 - 24.80 = 7.07 were calculated. The results show that there is a significant difference between ΔCt-H and ΔCt-J, proving that the system quality control is qualified. In addition, ΔCt-J will be used as the standard for judging DNA methylation positive and negative. When ΔCt-J' < ΔCt-J after sample amplification, it is judged as methylation negative, and when ΔCt-J' > ΔCt-J, it is judged as methylation positive.

[0099] like Figure 7 As shown in Figure B, this is a clinical sample related to colorectal issues. The calculated ΔCt-J' = 32.47 - 29.17 = 3.3 < ΔCt-J, therefore this sample is interpreted as methylation negative.

[0100] like Figure 7 As shown in Figure C, this is a clinical sample related to colorectal cancer. After calculation, ΔCt-J' = 39.17 - 29.85 = 9.32 > ΔCt-J, therefore this sample was interpreted as methylation positive. The detection results of the method established in this invention are consistent with the clinical pathological results, further proving the clinical applicability of this invention.

[0101] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A primer pair for directly detecting DNA methylation, characterized in that, The primer pair includes a forward primer and a reverse primer, wherein the forward primer and / or the reverse primer is modified with 2'-F RNA, and the forward primer and the reverse primer cover the methylation sites of the DNA to be detected.

2. The primer pair according to claim 1, characterized in that, The forward primer has ≥1 base modified with 2'-F RNA, and the reverse primer has ≥1 base modified with 2'-F RNA. The length of the forward primer is 5–15 nt, 15–20 nt, 20–30 nt, 30–40 nt, 40–50 nt, 50–60 nt, 60–70 nt, 70–80 nt, 80–90 nt, 90–100 nt, 100–110 nt, 110–120 nt, 120–130 nt, 130–140 nt, or 140 nt. The reverse primer has a length of 5-15 nt, 15-20 nt, 20-30 nt, 30-40 nt, 40-50 nt, 50-60 nt, 60-70 nt, 70-80 nt, 80-90 nt, 90-100 nt, 100-110 nt, 110-120 nt, 120-130 nt, 130-140 nt, or 140-150 nt.

3. The primer pair according to claim 1, characterized in that, The forward primer also includes other modifications, including one or more of the following: locked nucleic acid, peptide nucleic acid, 2-methoxy base, thio, deoxyhypoxanthine, deoxyuracil, phosphorylation, biotin, digoxigenin, amyl arm, inosine, 1-(2'-deoxy-β-D-furanibosyl)-3-nitropyrrole, or 5-nitroindole. The reverse primer also includes other modifications, including one or more of the following: locked nucleic acid, peptide nucleic acid, 2-methoxy base, thio, deoxyhypoxanthine, deoxyuracil, phosphorylation, biotin, digoxigenin, amyl arm, inosine, 1-(2'-deoxy-β-D-furanibosyl)-3-nitropyrrole, or 5-nitroindole.

4. The use of the primer pair as described in any one of claims 1 to 3 in the preparation of DNA methylation detection reagents.

5. The application according to claim 4, characterized in that, The DNA methylation detection reagent is used to detect single-stranded nucleic acids and / or double-stranded nucleic acids, wherein the single-stranded nucleic acids are derived from prokaryotes, eukaryotes, viruses, cell lines or viroids, and the double-stranded nucleic acids are derived from prokaryotes, eukaryotes, viruses, cell lines or viroids.

6. A DNA methylation detection reagent, characterized in that, include: The primer pair, internal reference gene, internal reference gene primer pair, specific probe targeting the sample to be tested, specific probe targeting the internal reference gene, nucleic acid polymerase, reagent for nucleic acid amplification, reagent for sequencing, reagent for gene chip detection, or reagent for melting curve analysis as described in claim 1, may be one or more of these.

7. The DNA methylation detection reagent according to claim 6, characterized in that, The specific probe targeting the sample to be tested is labeled with a reporter group and a quencher group. The specific probe targeting the sample to be tested specifically detects the target nucleic acid amplified by the primer pair according to claim 1. The specific probe targeting the sample to be tested has a linear or hairpin structure. The specific probe targeting the sample to be tested has resistance to 5' nuclease activity. The length of the specific probe targeting the sample to be tested is 5-15 nt, 15-20 nt, 20-30 nt, 30-40 nt, 40-50 nt, 50-60 nt, 60-70 nt, 70-80 nt, 80-90 nt, 90-100 nt, 100-110 nt, 110-120 nt, 120-130 nt, 130-140 nt, or 140-150 nt.

8. The DNA methylation detection reagent according to claim 6, characterized in that, The specific probe targeting the internal reference gene is labeled with a reporter group and a quencher group. The specific probe targeting the internal reference gene specifically detects the target nucleic acid amplified by the primer pair of the internal reference gene. The specific probe targeting the internal reference gene has a linear or hairpin structure. The specific probe targeting the internal reference gene has resistance to 5' nuclease activity. The length of the specific probe targeting the internal reference gene is 5-15 nt, 15-20 nt, 20-30 nt, 30-40 nt, 40-50 nt, 50-60 nt, 60-70 nt, 70-80 nt, 80-90 nt, 90-100 nt, 100-110 nt, 110-120 nt, 120-130 nt, 130-140 nt, or 140-150 nt. The nucleic acid polymerase is a template-dependent nucleic acid polymerase; The reagents used for nucleic acid amplification include one or more of the following: enzyme working buffer, dNTPs, water, a solution containing magnesium ions, or single-stranded DNA binding proteins. The reagents used for sequencing include one or more of the following: enzyme working buffer, dNTPs, ddNTPs, water, solution containing magnesium ions, single-stranded DNA binding protein, ligase, nucleic acid adapter, or sequencing primer. The reagents used for gene chip detection include one or more of the following: enzyme working buffer, dNTPs, water, hybridization buffer, washing buffer, or labeling reagent. The reagents used for melting curve analysis include detection probes.

9. A detection method using the DNA methylation detection reagent according to any one of claims 6 to 8, characterized in that, Includes the following steps: The sample to be tested is mixed with a specific probe targeting the sample, the primer pair that can directly detect DNA methylation, and a nucleic acid polymerase, and then amplified by PCR to obtain the methylation Ct value and the unmethylation Ct value of the sample to be tested. The internal reference gene was mixed with a specific probe targeting the internal reference gene, primer pairs for the internal reference gene, and nucleic acid polymerase, and then amplified by PCR to obtain the Ct value of the internal reference gene. The methylation Ct value of the sample to be tested is compared with the Ct value of the internal reference gene, and the unmethylated Ct value of the sample to be tested is compared with the Ct value of the internal reference gene to determine whether the sample to be tested has DNA methylation.

10. The detection method according to claim 9, characterized in that, The method involves comparing the methylation Ct value of the sample to be tested with the Ct value of the internal reference gene, and comparing the unmethylated Ct value of the sample to be tested with the Ct value of the internal reference gene to determine whether the sample to be tested has DNA methylation. Specifically, this involves comparing and analyzing the detection curve obtained from the methylation Ct value of the sample to be tested with the standard curve obtained from the Ct value of the internal reference gene, and comparing and analyzing the detection curve obtained from the unmethylated Ct value of the sample to be tested with the standard curve obtained from the Ct value of the internal reference gene to determine whether the sample to be tested has DNA methylation.

Images