Primer, kit and method for rapidly detecting tetracycline drug-resistant gene Tet (M) by adopting cross primer isothermal amplification technology

Abstract

The invention discloses primers, a kit and a method for rapidly detecting a tetracycline drug-resistant gene Tet (M) by adopting a cross primer isothermal amplification technology, and belongs to the technical field of biology. According to the primer or the kit designed by the invention, the detection of the Tet (M) gene can be quickly completed within 1 hour through a cross primer isothermal amplification technology, the reaction is efficient, the consumed time is short, and the primer or the kit has the advantages of high sensitivity and high specificity. In addition, the method does not need to depend on expensive or special equipment, is low in detection cost, and is particularly suitable for product self-inspection and other field detection scenes of small and medium-sized food enterprises. According to the method, the detection limit of a tetracycline-tolerant strain carrying a tetracycline drug-resistant gene Tet (M) is 30.0 fg / mu L. The invention provides important contribution to research, development and popularization of a novel isothermal amplification technology, and provides an innovative solution for convenient and accurate field detection.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a primer, kit and method for rapidly detecting whether a tetracycline-resistant strain carries a tetracycline resistance gene Tet(M) by using cross primer isothermal amplification technology. BACKGROUND

[0002] Tetracyclines are commonly used antibiotics for treating bacterial infections. However, the widespread use of tetracyclines has led to the emergence of antibiotic-resistant strains. Tetracyclines can bind to ribosomes to interfere with protein translation, thereby exerting an inhibitory effect on bacteria. The mechanisms of tetracycline resistance in bacteria include active efflux of tetracycline from cells, production of ribosome protection proteins, reduced drug permeability, target mutations, and enzymatic degradation of antibiotics. The tetracycline resistance genes carried by tetracycline-resistant strains are closely related to the increased risk of drug-resistant infections, and the transmission efficiency of these resistance genes in the environment and food samples has also been improved.

[0003] The detection of tetracycline resistance gene Tet(M) mainly relies on molecular biology techniques, including conventional polymerase chain reaction (PCR), real-time fluorescent quantitative PCR (qPCR), loop-mediated isothermal amplification (LAMP), and nucleic acid hybridization. Although PCR, qPCR, LAMP and other molecular biology methods have high specificity and sensitivity in the detection of tetracycline resistance genes, their long time consumption, high equipment requirements and complex operation limit their widespread application.

[0004] Cross primer isothermal amplification technology (CPA) is also a molecular biology technique based on nucleic acid isothermal amplification, which is used for rapid and sensitive detection of target nucleic acid sequences. Compared with other isothermal amplification techniques and gene detection techniques, it has higher sensitivity and accuracy. Therefore, it is of great significance to establish a detection method for tetracycline resistance gene Tet(M) using cross primer isothermal amplification technology with independent intellectual property rights. SUMMARY

[0005] In order to overcome the shortcomings and deficiencies of the prior art, the primary purpose of the present application is to provide a primer for rapidly detecting tetracycline resistance gene Tet(M) by using cross primer isothermal amplification technology.

[0006] Another purpose of the present application is to provide a kit for rapidly detecting tetracycline resistance gene Tet(M) by using cross primer isothermal amplification technology.

[0007] Still another purpose of the present application is to provide a method for rapidly detecting tetracycline resistance gene Tet(M) by using cross primer isothermal amplification technology.

[0008] The object of the present application is achieved by the following technical solutions.

[0009] A set of primers for rapidly detecting tetracycline resistance gene Tet(M) by using cross primer isothermal amplification technology, which is composed of stripping primers 4s and 5a, cross primer 2a1s, specific primers 2a and 3a, and the nucleotide sequences are as follows:

[0010] Stripping primer 4s: 5'-AGTTTTAGATGGGGCAAT-3'(SEQ ID NO. 1);

[0011] Stripping primer 5a: 5'-ATCCTGATAAACCGTTGA-3'(SEQ ID NO. 2);

[0012] Cross primer 2a1s: 5'-CCATTTTGGTCAATCTTACAAGCACAAACTCGTATA-3'(SEQ ID NO. 3);

[0013] Specific primer 2a: 5'-CCATTTTGGTCAATCTTA-3'(SEQ ID NO. 4);

[0014] Specific primer 3a: 5'-AGATTGTGGGAATCCCCA-3'(SEQ ID NO. 5).

[0015] A kit for rapidly detecting tetracycline resistance gene Tet(M) by using cross primer isothermal amplification technology, comprising the primers for rapidly detecting tetracycline resistance gene Tet(M) by using cross primer isothermal amplification technology.

[0016] The concentration of the primers in the kit is 10 μM.

[0017] The kit further comprises the following components:

[0018] A, 2x reaction buffer: 40.5 mM Tris-HCl, 20.0 mM ammonium sulfate, 20.0 mM potassium chloride, 16.0 mM magnesium sulfate, 0.2% (v / v) Tween 20, 1.6 M betaine, 2.8 mM dNTPs;

[0019] B, Bst DNA polymerase;

[0020] C, CPA reaction color developing agent;

[0021] The Bst DNA polymerase in component B is preferably a Bst DNA polymerase aqueous solution with a concentration of 8 U / μL.

[0022] The CPA reaction developer in component C is a mixed solution of calcein and manganese chloride (MnCl2). Preferably, the concentration of calcein in the CPA reaction developer is 3-4 mM, and the molar ratio of calcein to manganese ions is 1:2-6. Further preferably, the concentration of calcein is 3.5 mM, and the molar ratio of calcein to manganese ions is 1:2.

[0023] The application of the primer for rapid detection of tetracycline-resistant gene Tet(M) by cross primer isothermal amplification technology or the kit for rapid detection of tetracycline-resistant gene Tet(M) by cross primer isothermal amplification technology in rapid detection of whether a tetracycline-resistant strain carries tetracycline-resistant gene Tet(M).

[0024] A method for detecting a tetracycline-resistant strain carrying tetracycline-resistant gene Tet(M) for non-disease diagnosis purposes according to the kit, comprising the following steps:

[0025] (1) Extracting DNA of the strain to be tested as a template, and ensuring that the OD 260 / OD 280 value of the template DNA aqueous solution is in the range of 1.8-2.0;

[0026] (2) Establishing a cross primer isothermal amplification reaction system for detecting tetracycline-resistant gene Tet(M), and performing cross primer isothermal amplification reaction in a water bath at 51-66°C for 45-60 minutes;

[0027] The cross primer isothermal amplification reaction system is as follows: 2x reaction buffer 12.5 μL, 10 μM of stripping primer 4s and 10 μM of stripping primer 5a each 1.5 μL, 10 μM of cross primer 2a1s 2.5 μL, 10 μM of specific primer 2a and 10 μM of specific primer 3a each 1.25 μL, DNA template 1.0 μL, 8 U / μL of Bst DNA polymerase 1.0 μL, and deionized water is added to make up the volume to 25 μL; finally, 1 μL of CPA reaction developer with the above concentration is added.

[0028] Preferably, the cross primer isothermal amplification reaction conditions are incubation in a water bath at 63°C for 60 minutes.

[0029] (3) After the reaction is completed, observe the color change of the developer and / or take the amplified product for agarose gel electrophoresis; if the color is green, it indicates that the strain to be tested contains tetracycline-resistant gene Tet(M); if the color is orange, it indicates that the strain to be tested does not contain tetracycline-resistant gene Tet(M); if the electrophoresis result shows ladder-shaped bands, it indicates that the strain to be tested contains tetracycline-resistant gene Tet(M); if the electrophoresis result shows no bands, it indicates that the strain to be tested does not contain tetracycline-resistant gene Tet(M).

[0030] The present application has the following advantages and effects relative to the prior art:

[0031] (1) The cross primer isothermal amplification detection method for tetracycline resistance genes provided by the present application overcomes the shortcomings of long detection time, insufficient sensitivity, complex operation, high cost and limited on-site application in the prior art, and fills the gap in specific detection of tetracycline resistance genes in the field of rapid detection.

[0032] (2) The method of the present application is carried out under isothermal conditions, without the need for temperature variation steps, greatly shortening the detection time, and the amplification and results can be obtained within 60 minutes, which has obvious advantages in detection speed compared to other isothermal amplification techniques, and has important value for the development of new isothermal amplification techniques and the application of on-site microbial detection. In addition, the method does not require expensive or special equipment, and the detection cost is low, which is particularly suitable for small and medium-sized food enterprises to conduct product self-inspection and other on-site detection scenarios. Meanwhile, the present application also discloses a specific target sequence for the conserved region of the tetracycline resistance gene Tet(M), and a set of specific primers are designed to ensure the accuracy and reliability of the detection results.

[0033] (3) Using the primers or kits designed by the present application, the detection of Tet(M) gene can be completed within 1 hour by cross primer isothermal amplification technology, which is efficient, time-saving, and has the advantages of high sensitivity and high specificity. The present application provides an important contribution to the research and development of new isothermal amplification techniques, and provides an innovative solution for convenient and accurate on-site detection. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 CPA reaction gel map under different concentrations of calcein treatment; wherein A-H are 0.5mM, 1mM, 1.5mM, 2mM, 2.5mM, 3mM, 3.5mM, 4mM calcein concentration, 1-8 represent the molar ratio of calcein to manganese ions in the color developing solution as 1:16, 1:14, 1:12, 1:10, 1:8, 1:6, 1:4, 1:2; "+" : experimental group, "-" : blank control group.

[0035] Figure 2 CPA reaction color development map of different concentrations of calcein under natural light; wherein A-H are 0.5mM, 1mM, 1.5mM, 2mM, 2.5mM, 3mM, 3.5mM, 4mM calcein concentration, 1-8 represent the molar ratio of calcein to manganese ions in the color developing solution as 1:16, 1:14, 1:12, 1:10, 1:8, 1:6, 1:4, 1:2; "+" : experimental group, "-" : blank control group.

[0036] Figure 3Figures 1 and 2 are gel electrophoresis and color development results of the cross primer isothermal amplification reaction technology for detecting tetracycline resistance gene Tet(M) at different reaction times; wherein, 1-8 represent the results of the CPA reaction of Tet(M) gene at 63℃ for 25, 30, 35, 40, 45, 50, 55, and 60 min, respectively.

[0037] Figure 4 Figures 3 and 4 are gel electrophoresis and color development results of the cross primer isothermal amplification reaction technology for detecting tetracycline resistance gene Tet(M) at different reaction temperatures; wherein, 1-11 represent the results of the CPA reaction of Tet(M) gene at 45℃, 48℃, 51℃, 54℃, 57℃, 60℃, 63℃, 66℃, 69℃, 72℃, and 75℃ for 1 h, respectively.

[0038] Figure 5 Figures 5 and 6 are gel electrophoresis and color development results of the sensitivity experiment of the cross primer isothermal amplification reaction technology for detecting tetracycline resistance gene Tet(M); wherein, lanes (reaction tubes) 1-8 are 30 ng / μL, 300 pg / μL, 30 pg / μL, 3.0 pg / μL, 300 fg / μL, 30 fg / μL, 3.0 fg / μL, and negative control, respectively. DETAILED DESCRIPTION

[0039] The present application will be further described in conjunction with the following examples and drawings, but the embodiments of the present application are not limited thereto. Unless otherwise specifically indicated, the reagents, methods and devices used in the present application are conventional reagents, methods and devices in the art. Unless otherwise specifically indicated, the reagents and materials used in the present application can be obtained through commercial channels.

[0040] Example 1 Design of primers for detecting tetracycline resistance gene Tet(M) using the cross primer isothermal amplification reaction technology

[0041] (1) All sequences of tetracycline resistance gene Tet(M) were downloaded in Bacterial Antimicrobial Resistance Reference Gene Database. All downloaded Tet(M) sequences in the database were read in FASTA file using Linux, and subjected to multiple sequence alignment, calculation of entropy value, and extraction of the most conservative sequence (region with the lowest information entropy and length in the range of 200-1000 bp); (2) All Tet(M) sequences were constructed into a database, and the extracted conservative sequence was subjected to blastn with the database, thereby obtaining the alignment identity and coverage value of the conservative sequence of Tet(M) in all Tet(M) sequences. After Clustalw of all downloaded Tet(M) sequences using MAGE, the conservation of the extracted conservative sequence was analyzed. Through the above analysis, the highest conservation region in Tet(M) was obtained, and used for primer design.

[0042] TTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGCACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATGGAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCT

[0043] (4) According to the reaction principle of cross primer isothermal amplification, the primer is designed for the most conservative region of Tet(M) using Primer Premier software; the nucleotide sequence is as follows:

[0044] Stripping primer 4s: 5'-AGTTTTAGATGGGGCAAT-3'(SEQ ID NO. 1);

[0045] Stripping primer 5a: 5'-ATCCTGATAAACCGTTGA-3'(SEQ ID NO. 2);

[0046] Cross primer 2a1s: 5'-CCATTTTGGTCAATCTTACAAGCACAAACTCGTATA-3'(SEQ ID NO. 3);

[0047] Specific primer 2a: 5'-CCATTTTGGTCAATCTTA-3'(SEQ ID NO. 4);

[0048] Specific primer 3a: 5'-AGATTGTGGGAATCCCCA-3'(SEQ ID NO. 5).

[0049] Example 2: Optimization of reaction color developing agent design for detecting Tet(M) gene by cross primer isothermal amplification reaction technology

[0050] (1) Reagents required:

[0051] a. The concentration of stripping primer 4s, 5a, cross primer 2a1s, and specific primer 2a, 3a is 10 μM, and the primer sequence is shown in SEQ ID NO. 1-5 in Example 1;

[0052] b. Preparation of 2x reaction buffer:

[0053] 2x reaction buffer: 40.5 mM Tris-HCl, 20.0 mM ammonium sulfate, 20.0 mM potassium chloride, 16.0 mM magnesium sulfate, 0.2% (v / v) Tween 20, 1.6 M betaine, 2.8 mM dNTPs;

[0054] c. Bst DNA polymerase (large fragment, NEB) aqueous solution with a concentration of 8 U / μL.

[0055] d. CPA reaction developer with different concentrations of calcein and MnCl2 ratio.

[0056] (2) Prepare a calcein solution with a concentration of 5 mM and a MnCl2 solution with a concentration of 100 mM. Add different volumes of calcein solution and MnCl2 solution, and finally add pure water to 1 mL to prepare developer with different concentrations of calcein and MnCl2 ratio. The concentration of calcein is set to 0.5 mM, 1 mM, 1.5 mM, 2 mM, 2.5 mM, 3 mM, 3.5 mM, and 4 mM. Each concentration is set to 8 kinds of molar ratio of calcein to manganese ion, which are 1:16, 1:14, 1:12, 1:10, 1:8, 1:6, 1:4 and 1:2. The results are identified by whether the developer changes color or not. Finally, the best developer concentration in CPA reaction is determined.

[0057] (3) Extract DNA of the strain to be tested as template DNA:

[0058] This example sets up an experimental group (+) and a blank control group (-) at the same time. The experimental group is Serratia marcescens Smar231229, which is purchased from the "South China University of Technology-Fench Bio-Technology Co., Ltd. Joint Laboratory" Microbial Resource Center. The Serratia marcescens Smar231229 is from freshwater products, and it contains Tet(M) as verified by PCR before. Nucleic acid-free water is used as a blank control.

[0059] Bacterial genomic DNA extraction kit (Guangdong Dongsheng Biological Technology Co., Ltd.) is used to extract bacterial DNA, and the kit instructions are followed. The OD 260 / OD 280 value (absorbance ratio at 260 nm and 280 nm) of the bacterial DNA aqueous solution obtained from the experimental group is 1.8.

[0060] (4) Establish the cross primer isothermal amplification reaction system for detecting Tet(M) gene:

[0061] The cross primer isothermal amplification reaction system with a total volume of 25 μL was prepared in a reaction tube: 2x reaction buffer 12.5 μL, 4s and 5a mixed primer mixture 3.0 μL, cross primer 2a1s 2.5 μL, specific primer 2a and 3a mixed solution 2.5 μL, Bst DNA polymerase 1 μL, DNA template 1.0 μL, and deionized water was added to make up the volume to 25 μL; finally, 1 μL of CPA chromogenic solution with the above concentration was added and mixed well. At this time, the concentrations of each substance were: Tris-HCl 20.25 mM, ammonium sulfate 10.0 mM, potassium chloride 10.0 mM, magnesium sulfate 8.0 mM, Tween 20 0.1% (v / v), betaine 0.8 M, dNTPs 1.4 mM, Bst DNA polymerase 8 U / system, stripping primer 4s, 5a each 0.6 μM, cross primer 2a1s 1.0 μM, specific primer 2a and 3a each 0.5 μM. The reaction tube was placed in a 63℃ water bath for 60 minutes.

[0062] The electrophoresis results and color development results are shown in Figure 1 、 Figure 2 The concentrations of calcein in the chromogenic solution were 0.5 mM (A), 1 mM (B), 1.5 mM (C), 2 mM (D), 2.5 mM (E), 3 mM (F), 3.5 mM (G), and 4 mM (H), respectively. 1-8 represent the molar ratio of calcein to manganese ions in the chromogenic solution as 1:16, 1:14, 1:12, 1:10, 1:8, 1:6, 1:4, and 1:2, respectively. The results show that the color development effect is best when the concentration of calcein is 3.5 mM and the concentration ratio of calcein to manganese ions is 1:2.

[0063] Example 3: Optimization of reaction conditions for detecting Tet(M) gene using cross primer isothermal amplification reaction technology

[0064] The reaction conditions include reaction time and reaction temperature. To explore the optimal reaction time, the amplification time was set at 25, 30, 35, 40, 45, 50, 55, and 60 minutes, respectively, and the reaction temperature was 63℃. To explore the optimal reaction temperature, the amplification temperature was set at 45, 48, 51, 54, 57, 60, 63, 66, 69, 72℃, and 75℃, respectively, and the reaction time was 1 hour. The results were identified by color change of the chromogenic agent and agarose gel electrophoresis simultaneously, and the optimal CPA reaction conditions were finally determined.

[0065] The results are shown in Figure 3 、 Figure 4As shown, when the reaction time is 45-60 min and the reaction temperature is 51-66°C, the CPA reaction of the Tet(M) gene can be carried out, and a bright band is formed, and the color difference between positive and negative can be obviously seen under natural light.

[0066] Example 4: Sensitivity comparison test of the method for detecting tetracycline-resistant strains carrying tetracycline resistance gene Tet(M) by using cross primer isothermal amplification reaction technology

[0067] The genomic DNA of the tetracycline-resistant strain Serratia marcescens Smar231229 carrying the tetracycline resistance gene Tet(M) was diluted by 10 times to obtain 30 ng / μL, 300 pg / μL, 30 pg / μL, 3.0 pg / μL, 300 fg / μL, 30 fg / μL, and 3.0 fg / μL. A negative control (nucleic acid-free water) was also set. The cross isothermal amplification method was constructed according to the reaction system in Example 2, and the amplification product was subjected to 2% agarose gel electrophoresis to determine the sensitivity of the detection method.

[0068] The electrophoresis results are shown in Figure 5 As shown, the results show that the cross primer isothermal amplification reaction method for the tetracycline resistance gene Tet(M) established in the present application can detect the tetracycline-resistant strain carrying the tetracycline resistance gene Tet(M) with a DNA concentration of 30.0 fg / μL in the sample.

[0069] Conclusion:

[0070] From the above experimental results, the cross isothermal amplification reaction amplification method has the following advantages compared with the existing detection methods:

[0071] Fast and accurate: the target sequence is rapidly isothermally amplified by the cross primer isothermal amplification reaction, and positive results can be obtained within 1 h. Meanwhile, since more primers are required for the reaction, the detection result is extremely accurate.

[0072] High specificity: the presence or absence of the target gene can be determined by whether the amplification reaction occurs, thereby completing the specific detection of the tetracycline resistance gene Tet(M). The problem that the tetracycline resistance gene Tet(M) is difficult to be specifically detected in the current rapid detection field is solved.

[0073] High sensitivity: the detection limit of the method for the tetracycline-resistant strain carrying the tetracycline resistance gene Tet(M) is 30.0 fg / μL, which is more than 100 times more sensitive than conventional PCR.

[0074] The above embodiments are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above embodiments, and any changes, modifications, substitutions, combinations, simplifications, etc. made without departing from the spirit and principles of the present application should be equivalent replacement manners and should be included in the protection scope of the present application.

Claims

1. A set of primers for rapid detection of the tetracycline resistance gene Tet(M) using cross-primer isothermal amplification technology, characterized in that, It consists of stripping primers 4S and 5A, cross primer 2A1S, and specific primers 2A and 3A, and its nucleotide sequence is as follows: 4S primer stripping: 5'-AGTTTTAGATGGGGCAAT-3'; Peeling primer 5a: 5'-ATCCTGATAAACCGTTGA-3'; Cross primer 2a1s: 5'-CCATTTTGGTCAATCTTACAAGCACAAACTCGTATA-3'; Specific primer 2a: 5'-CCATTTTGGTCAATCTTA-3'; Specific primer 3a: 5'-AGATTGTGGGAATCCCCA-3'.

2. A kit for rapid detection of the tetracycline resistance gene Tet(M) using cross-primer isothermal amplification technology, characterized in that, Includes the primers for rapid detection of the tetracycline resistance gene Tet(M) using the cross-primer isothermal amplification technique as described in claim 1.

3. The reagent kit according to claim 2, characterized in that: The concentration of primers in the kit is 10 μM.

4. The reagent kit according to claim 2, characterized in that: The kit also includes the following components: A. 2× reaction buffer: 40.5 mM Tris-HCl, 20.0 mM ammonium sulfate, 20.0 mM potassium chloride, 16.0 mM magnesium sulfate, 0.2% Tween 20, 1.6 M betaine, 2.8 mM dNTPs; B, Bst DNA polymerase; C. CPA reaction colorimetric reagent; The CPA reaction colorimetric agent described in component C is a mixed solution of calcein and manganese chloride.

5. The reagent kit according to claim 4, characterized in that: The Bst DNA polymerase described in component B is an aqueous solution of Bst DNA polymerase at a concentration of 8 U / μL.

6. The reagent kit according to claim 4, characterized in that: The concentration of calcein in the CPA reaction colorimetric reagent is 3-4 mM, and the molar ratio of calcein to manganese ions is 1:2-6.

7. The reagent kit according to claim 6, characterized in that: The concentration of calcein in the CPA reaction colorimetric reagent is 3.5 mM, and the molar ratio of calcein to manganese ions is 1:

2.

8. The use of the primers of claim 1 or the kits of any one of claims 2 to 7 in the rapid detection of whether tetracycline-resistant strains carry the tetracycline resistance gene Tet(M).

9. A method for detecting tetracycline-resistant strains carrying the tetracycline resistance gene Tet(M) for non-disease diagnostic purposes using a kit according to any one of claims 2 to 7, characterized in that, Includes the following steps: (1) Extract DNA from the test strain as a template, and ensure the OD of the template DNA aqueous solution is within the specified range. 260 / OD 280 The value is in the range of 1.8 to 2.0; (2) Establish a cross-primer isothermal amplification reaction system for detecting the tetracycline resistance gene Tet(M), and carry out the cross-primer isothermal amplification reaction by incubating in a water bath at 51℃~66℃ for 45~60 minutes. (3) After the reaction is complete, observe the color change of the chromogenic reagent and / or take the amplified product for agarose gel electrophoresis; if the color is green, it indicates that the test strain contains the tetracycline resistance gene Tet(M); if the color is orange, it indicates that the test strain does not contain the tetracycline resistance gene Tet(M); if the electrophoresis result shows a ladder-shaped band, it indicates that the test strain contains the tetracycline resistance gene Tet(M); if the electrophoresis result shows no band, it indicates that the test strain does not contain the tetracycline resistance gene Tet(M).

10. The method according to claim 9, characterized in that: In step (2), the cross-primer isothermal amplification reaction system is as follows: 12.5 μL of 2× reaction buffer, 1.5 μL each of 10 μM stripping primer 4s and 10 μM stripping primer 5a, 2.5 μL of 10 μM cross primer 2a1s, 1.25 μL each of 10 μM specific primer 2a and 10 μM specific primer 3a, 1.0 μL of DNA template, 1.0 μL of 8 U / μL Bst DNA polymerase, and the volume is made up to 25 μL with deionized water; finally, 1 μL of CPA reaction colorimetric reagent is added. In step (2), the conditions for the cross-primer isothermal amplification reaction are to keep it in a water bath at 63°C for 60 minutes.

Images