Primers and methods for rapid detection of dictyostelium discoideum

Abstract

The application discloses a primer and a method for rapidly detecting Dictyostelium discoideum, belongs to the technical field of microorganism detection, and specifically relates to a pair of specific primers and a rapid detection and quantitative method based on the primers, which overcome the defects of low detection efficiency, poor specificity and incapability of rapid quantification of the prior art, realize efficient and accurate detection of the Dictyostelium discoideum in environmental samples, and provide technical support for the rapid detection of the Dictyostelium discoideum, environmental sample analysis, public health threat assessment and research on the interaction between the Dictyostelium discoideum and other microorganisms.

Description

Technical Field

[0001] This invention belongs to the field of microbial detection technology, and in particular relates to a primer and method for rapid detection of *Dendrobium discoideum*. Background Technology

[0002] *Dictyostelium discoideum*, also known as a social amoeba, is an important model organism. Due to its relatively well-defined genetic background, it offers significant advantages over organisms with unknown genetic backgrounds in studies of cell motility, intercellular signal transduction, medical pathology and pharmacology, cell type specialization, and eukaryotic cell development. Furthermore, as a soil amoeba, the interaction between *Dictyostelium discoideum* and the soil environment has attracted considerable attention. Studies have shown that its environmental fitness affects soil sand composition and soil moisture content, and its interaction with environmental pollutants alters soil texture and physical structure. In addition, *Dictyostelium discoideum* can interact with bacteria and environmental pollutants, further influencing soil physical structure. Therefore, rapid detection of *Dictyostelium discoideum* is of significant practical importance for assessing soil environmental quality and potential pollution.

[0003] Besides soil environments, amoebas are widely distributed in both natural and artificial environments. Recent studies have found that they are ubiquitous in tap water and are a major component of protozoa in tap water. They are commonly found in hospitals, swimming pools, cooling towers, and various water systems. Although amoebas are easily overlooked as waterborne pathogens, the potential pathogens they carry pose a serious threat to human health. Furthermore, water treatment facilities such as ultrafiltration membranes have even become ideal habitats for amoebas, further exacerbating the issue of drinking water biosafety.

[0004] While *Dendrobium distichum* itself is non-toxic and harmless to organisms and the environment, and non-pathogenic, it can coexist with bacteria and may carry pathogens within its body, thus indirectly causing pathogenicity. This impacts biosafety and environmental safety such as soil and water sources. The cell membrane and thick cell wall of amoeba provide a physical barrier for the pathogenic microorganisms residing inside, enhancing their adaptability and resistance in the environment. This makes amoeba an environmental carrier for pathogen transmission, helping pathogens survive, spread, and proliferate under harsh environmental stress. Therefore, rapid detection of *Dendrobium distichum* is not only crucial for assessing soil environmental quality but also helps avoid potential health risks.

[0005] However, current research on protozoa such as *Dendrobium distichum* is insufficient, especially in terms of the significant deficiencies in related detection technologies. Existing commonly used *Dendrobium* detection techniques are based on conventional PCR amplification of 18S rDNA. This method amplifies stable, conserved gene fragments in *Dendrobium* and obtains the sequence results through sequencing. This method requires collecting samples containing *Dendrobium* from the environment (such as soil, water, or biological tissue), isolating and purifying the *Dendrobium*, extracting its DNA, and then performing PCR amplification and sequencing. Although the amplified DNA fragments are generally applicable within the *Dendrobium* class, it cannot quickly screen samples to obtain specific species of *Dendrobium*. Detection of specific *Dendrobium* species is inefficient, requiring extensive repetitive work, and thus fails to meet the needs of rapid assessment of environmental quality and biosafety. Summary of the Invention

[0006] The technical problem to be solved by this invention is to overcome the shortcomings of existing technologies in detecting *Dendrobium distichum*, such as low efficiency, poor specificity, and inability to quickly quantify it. This invention provides a pair of specific primers and a rapid detection and quantification method based on these primers, enabling efficient and accurate detection of *Dendrobium distichum* in environmental samples. This provides technical support for environmental sample analysis, public health threat assessment, and research on the interaction between *Dendrobium distichum* and other microorganisms.

[0007] The technical solution adopted in this invention is as follows: a primer and method for rapid detection of *Discocephalus discocephalus*, comprising a specific primer pair for detecting *Discocephalus discocephalus*, wherein the primer pair is obtained by screening the *Discocephalus discocephalus* genome as a target gene, comprising an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2; the sequence of the upstream primer SEQ ID NO.1 is 5'-GAGCCTAGTCTGAA-3', and the sequence of the downstream primer SEQ ID NO.2 is 5'-GCCAGTAGCCGATAGGAACTTGTT-3'.

[0008] Furthermore, the primer pair has an annealing temperature of 60±5℃, a primer length of 20-25bp, and a GC content of 40-60%.

[0009] A method for detecting and quantifying *Dendrobium discoideum*, using the specific primer pair described in claim 1 or 2, combined with real-time quantitative PCR technology, includes the following steps:

[0010] S1. Extract genomic DNA from the sample to be tested, wherein the sample to be tested includes soil samples, water samples, or culture media or suspensions of *Dendrobium distichum*.

[0011] S2. Using the extracted genomic DNA as a template, perform a real-time quantitative PCR reaction using the specific primer pair;

[0012] S3. Based on the CT value obtained from the real-time quantitative PCR reaction, the copy concentration of *Dendrobium discoideum* in the sample to be tested is calculated in conjunction with the standard curve, and then the bacterial concentration is obtained.

[0013] Furthermore, in step S1, genomic DNA is extracted using the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit, and the specific operation is as follows:

[0014] ① Take an appropriate amount of culture medium containing *Dendrobium discoideum*, centrifuge at 12,000 rpm for 2 minutes, and discard the supernatant;

[0015] ② Add 180 μL Buffer GB, 20 μL Proteinase K and 10 μL Rnase A to the centrifuge tube, mix well and incubate at 56°C for 10-30 minutes.

[0016] ③ Add 200 μL of anhydrous ethanol and mix thoroughly by suction and whisking;

[0017] ④ Transfer the mixture to the adsorption column, centrifuge at 12000 rpm for 2 minutes, and discard the filtrate;

[0018] ⑤ Add 500 μL of Buffer WA, centrifuge at 12000 rpm for 1 minute, and discard the filtrate;

[0019] ⑥ Add 700 μL Buffer WB, centrifuge at 12000 rpm for 1 minute, discard the filtrate, and repeat this step once;

[0020] ⑦ Centrifuge the empty adsorption column at 12000 rpm for 2 minutes, then place it on a new 1.5 mL centrifuge tube, add 30 μL of sterile water or preheated Elution Buffer at 65 °C to the center of the adsorption column, and let it stand at room temperature for 5 minutes.

[0021] ⑧ Centrifuge at 12000 rpm for 2 minutes to elute the DNA. Store the obtained genomic DNA at 4℃ for a short period or at -40℃ for a long period.

[0022] Further, in step S2, the real-time quantitative PCR reaction system, in 20 μL increments, includes 10 μL of 2×Q5 SYBRqPCR Master Mix, 0.4 μL of 10 μM upstream primer, 0.4 μL of 10 μM downstream primer, 1 μL of DNA template, and 8.2 μL of ddH2O.

[0023] Furthermore, the real-time quantitative PCR reaction program in step S2 is as follows: pre-denaturation at 95°C for 30 seconds; 40 cycles, each cycle including denaturation at 95°C for 10 seconds and annealing extension at 60°C for 30 seconds.

[0024] Furthermore, the method for creating the standard curve in step S3 is as follows:

[0025] ① The genome of *Dendrobium discoideum* was amplified using the specific primer pair described in claim 1 to obtain the target fragment. The target fragment was then ligated into the pEASY-T&B Zero Cloning Vector plasmid vector, transformed into competent DH5α cells, recombinants were screened, and plasmids were extracted.

[0026] ② Determine the plasmid concentration and dilute it to a gradient concentration of 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, and 1 pg / μL as standard samples;

[0027] ③ Perform real-time quantitative PCR on the standard samples. Plot a standard curve with the logarithm of DNA amount on the x-axis and the corresponding CT value on the y-axis. The standard curve equation is Y = -3.444x + 48.47, R0 2 =0.997.

[0028] Further, the formula for calculating the copy concentration in step S3 is: Copy number (copies / μL) = [(X ng / μL × 10 -9 ) × (6.02 × 10 23 ] ÷ (number of bases × 660); The conversion relationship for cell concentration is: cell concentration (cells / mL) = copy concentration (copies / μL) ÷ 1.51 × 10 7 copies / μL×10 6 cells / mL.

[0029] The beneficial effects of the present invention after adopting the above structure are as follows:

[0030] (1) The designed specific primer pair (SEQ ID NO.1-2) was verified by multiple strains of Dictyophora to specifically amplify only Dictyophora discoidosa and did not cross-react with other Dictyophora species, effectively solving the problem of poor detection specificity in the prior art and accurately distinguishing Dictyophora discoidosa from other closely related species.

[0031] (2) Compared with the traditional conventional PCR combined with sequencing detection method, the present invention uses real-time fluorescence quantitative PCR technology, which only takes a few hours from genomic DNA extraction to obtaining quantitative results, greatly shortening the detection time and meeting the needs of rapid assessment of environmental quality and biosafety;

[0032] (3) By constructing a standard curve (R) 2=0.997, high linearity), achieving accurate quantification of *Discocephalus discoidus*, accurately determining the bacterial concentration of *Discocephalus discoidus* in environmental samples, with small error and good repeatability, providing reliable quantitative data for *Discocephalus discoidus* related research;

[0033] (4) The dye-based real-time fluorescence quantitative PCR method does not require the design of specific probes, the operation steps are simple, the reagent cost is low, and the instrument requirements are not high, making it easy to promote and apply in routine laboratories.

[0034] (5) It can be used for the detection and quantification of *Dendrobium distichum* in various environmental samples such as soil and water. It can not only provide technical support for soil environmental quality assessment, but also help with the monitoring of drinking water biosafety and the early diagnosis, dynamic monitoring and precise control of diseases related to pathogens carried by *Dendrobium distichum*. It has important practical value and broad application prospects. Attached Figure Description

[0035] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used together with the embodiments of the invention to explain the invention and do not constitute a limitation thereof.

[0036] Figure 1 This is the result of primer gradient amplification gel imaging, DIS ID NO.1-2 ( Figure 1 A), DIS ID NO.5-6 ( Figure 1 B), DIS ID NO.9-10 ( Figure 1 B), DIS ID NO.13-14 ( Figure 1 C), DIS ID NO.15-16 ( Figure 1 C), DIS IDNO. 17-18 ( Figure 1 D), M: DNA marker 2000bp;

[0037] Figure 2 The results are from conventional PCR amplification with primer specificity. M: DNA marker 2000bp, lanes 1-6 of AB are different templates.

[0038] Figure 3 For the construction of the standard plasmid, A: M: DNA marker 2000bp, lane 1 shows the amplification results of the *Dendrocalamus discoideus* genome using the specific primer DIS IDNO.1-2; B: M: DNA marker 2000bp, lane 1 shows the plasmid validation results; C: Standard plasmid sequence alignment results.

[0039] Figure 4 A: Amplification curve of plasmid standard; B: Standard curve of *Dendrocalamus scoparia*.

[0040] Figure 5 The amplification curves and melting curves of samples with different concentrations are shown. The amplification curve is "S" shaped, and the melting curve has a strong single peak.

[0041] Figure 6 This is the amplification curve for a random sample. Detailed Implementation

[0042] Figure 1 Preliminary screening results for gradient PCR amplification using primers designed based on the genome of *Dendrobium distichum* were obtained. A total of 6 primer pairs were qualified. Among them, 8 temperature gradients were designed, and the conventional PCR annealing temperatures for lanes 1-8 of AD were 55.0 ℃, 55.5 ℃, 56.2 ℃, 57.0 ℃, 58.1 ℃, 59.1 ℃, 59.7 ℃, and 60.0 ℃.

[0043] Figure 2 Based on the results of routine PCR amplification of the initial screening primers, DIS ID NO.1-2, DIS ID NO.13-14, and DIS ID NO.17-18 are the preferred specific primer pairs.

[0044] Lanes AB 1-6 are respectively: Water, Corydalis scabra, Corydalis grayishmi, Corydalis maxima, Corydalis scabra, and Corydalis purpureus.

[0045] Figure 3 The results of target fragment amplification, standard plasmid construction and sequence alignment show that the lengths of the target fragment and plasmid standard are correct. The sequencing results are compared with the sequence, and the lengths are correct, indicating successful plasmid construction.

[0046] Figure 4 Amplification curves and standard curves of plasmid standards from *Dendrobium discoideum*, R 2 =0.997, indicating a good linear fit.

[0047] Figure 5 Amplification and melting curves of different concentrations of *Dendrobium discoidum* samples.

[0048] Figure 6 The amplification results of random samples of *Dendrobium discoideum* show that random samples can be amplified and corresponding CT values ​​can be obtained.

[0049] I. Design and Screening of Specific Primers for *Dendrobium discoideum*

[0050] 1. Sample preparation

[0051] All strains used were reticulate slime molds cultured and preserved by the Engineering Research Center for Edible and Medicinal Fungi of the Ministry of Education, Jilin Agricultural University.

[0052] 2. Extract genomic DNA from the test strain

[0053] DNA was extracted from all five preserved *Gastromyxobolus* strains using the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver. 5.0.

[0054] (1) Take 5 ml of bacterial culture medium, centrifuge at 12000 rpm for 2 minutes, and discard the supernatant;

[0055] (2) Add 180 μL of Buffer GB, 20 μL of Proteinase K and 10 μL of RNase A to the tube, mix well by pipetting, and incubate in a water bath at 56 °C for 10 minutes.

[0056] (3) Add 200 μL of anhydrous ethanol to it and mix well by suction and whisking;

[0057] (4) Transfer the above liquid to the adsorption column, centrifuge at 12000 rpm for 2 min, and then discard the filtrate;

[0058] (5) Add 500 μL of Buffer WA, centrifuge at 12000 rpm for 1 minute, and discard the filtrate;

[0059] (6) Add 700 μL of Buffer WB to it, centrifuge at 12000 rpm for 1 min, and discard the filtrate;

[0060] (7) Repeat step (6);

[0061] (8) Centrifuge the empty adsorption column at 12,000 rpm for 2 min, then place it on a new 1.5 cm centrifuge tube, add 30 μL of sterile water to the center, and let it stand at room temperature for 5 minutes.

[0062] (9) Centrifuge again at 12000 rpm for 2 minutes to elute DNA;

[0063] (10) Detect the concentration of genomic DNA using a spectrophotometer and store it in a 4 ℃ refrigerator for later use (if not used on the same day, store it in a -40 ℃ refrigerator).

[0064] 3. Primers for the genome-specific features of *Dendrobium discoideum* were designed using Primer 6 software. Following the principles of primer design, the primers were designed with an annealing temperature of 60 ± 5 ℃, a primer length of 20-25 bp, and a GC content of 40-60%. Based on these conditions, a total of 12 primer pairs were designed.

[0065] 4. Using the genome of *Dendrobium discoideum* as a template, preliminary screening of qualified primer pairs was performed by gradient amplification using conventional PCR. The primer pairs were DIS ID NO. 1-2 (…). Figure 1 A), DIS ID NO.5-6 ( Figure 1 B), DIS ID NO.9-10 ( Figure 1 B), DIS IDNO. 13-14 ( Figure 1 C), DIS ID NO.15-16 ( Figure 1 C), DIS ID NO.17-18 ( Figure 1 D), the standard PCR reaction system is shown in Table 1.

[0066] Table 1. Conventional PCR reaction system

[0067] Composition Dosage 2×Magic Green Taq SuperMix 12.5μL upstream primer 1μL Downstream primer 1μL DNA template 1μL <![CDATA[ddH2O]]> 9.5μL

[0068] The PCR reaction program is as follows: pre-denaturation: 95 ℃, 3 min; 35 cycles: denaturation: 95 ℃, 30 sec; annealing: 55~60 ℃, 30 sec; extension: 72 ℃, 1 min; final extension: 72 ℃, 5 min.

[0069] 5. Based on the amplified gel imaging results ( Figure 1 The specific primer pairs obtained from conventional PCR were used as templates for specific amplification by conventional PCR with *Aquaticus spp.*, *Dermatophyte spp.*, *Dermatophyte glaucum*, *Dermatophyte macrocarpa*, *Dermatophyte aureosulcata*, and *Dermatophyte purpureus*. DIS ID NO. 5-6 and DIS ID NO. 9-10, in addition to *Dermatophyte spp.*, could also amplify *Dermatophyte glaucum* and *Dermatophyte macrocarpa*; DIS ID NO. 15-16 could also amplify *Dermatophyte glaucum*, *Dermatophyte macrocarpa*, *Dermatophyte aureosulcata*, and *Dermatophyte purpureus*. The best primer sequences obtained were DIS ID NO. 1-2, DIS ID NO. 13-14, and DIS ID NO. 17-18, as these three primer sequences showed the strongest specificity and were less susceptible to interference from other bacterial species. Figure 2 ).

[0070] II. Detection and Quantification of *Dendrobium discoideum*

[0071] 1. Obtaining the target fragment: The genome of *Discotyledioides spp.* was amplified by PCR using the genome-specific primers DIS ID NO. 1-2 to obtain the target fragment. Figure 3 A), rubber cutting and recycling.

[0072] 2. Ligation of the target gene into the plasmid vector: Using the pEASY-T&B Zero Cloning Kit, the target fragment was ligated into the pEASY-T&B Zero Cloning Vector plasmid vector. The cloning reaction system is shown in Table 2.

[0073] Table 2 Cloning reaction system

[0074] Composition Dosage PCR target fragment 0.5 μL -T&B Zero Cloning Vector 1 μL

[0075] The pEASY-T&B Zero Cloning Vector was ligated to the target fragment at a ratio of 1:7. After mixing, the mixture was placed in a PCR instrument and reacted at 25 °C for 10 min. After the reaction, the centrifuge tubes were placed on ice.

[0076] 3. Transformation and screening of recombinants:

[0077] (1) Take the competent DH5α from the -80℃ freezer and quickly insert it into the ice box to allow it to melt slowly;

[0078] (2) After adding the ligation product, mix gently and then let stand on ice for 30 min;

[0079] (3) Place the centrifuge tube in a 42°C water bath for 45 seconds, then quickly transfer it back to ice and keep it on for 2 minutes. Be careful not to shake it.

[0080] (4) Add 700 μL of antibiotic-free LB medium, mix gently, and incubate at 37°C and 180 rpm for 1 h.

[0081] (5) Spread the transformed bacterial culture evenly on LB plates containing antibiotics, incubate at 37°C upright until the liquid is completely absorbed, and then incubate upside down overnight.

[0082] (6) Select single clones for expansion culture and further utilize universal detection primers for plasmids.

[0083] (Forward primer: GAGCTAGTCTGAA; Reverse primer: GCCAGAGCCGATAGGAACTTGTT), perform conventional PCR. Figure 3 B) Preliminary verification showed that the results after testing were () Figure 3 C), the full-length sequence is 141bp, with no base mismatches, and is a standard quality grain.

[0084] 4. Procedure for plasmid extraction using the BBI EZ-10 Spin Column Plasmid Mini-Preps Kit from Sangon Biotech:

[0085] (1) Collect bacterial cells: Take 5 mL of bacterial solution, add it to a centrifuge tube, centrifuge at 12000 rpm for 1 min, collect the bacterial cell precipitate, and then discard the supernatant;

[0086] (2) Lysis of cells: Add 200 μL of buffer S1 (RNase A has been added) to the cell pellet, shake well to lyse the cells and remove RNA;

[0087] (3) Add lysis buffer: Add 200 μL of Buffer S2 to the centrifuge tube and gently invert the centrifuge tube 10 times to fully lyse the cells;

[0088] (4) Neutralization lysis buffer: Add the specified amount of neutralization buffer S3, gently invert the centrifuge tube 10 times to mix thoroughly;

[0089] (5) Centrifugation: Centrifuge at 12000 rpm for 10 min to precipitate impurities. The supernatant contains plasmid DNA.

[0090] (6) Adsorption and washing: Carefully transfer the supernatant to the adsorption column, add 500 μL of 75% ethanol to the adsorption column, centrifuge at 8000 rpm for 1 min, then discard the filtrate, and repeat the washing step once to remove impurities;

[0091] (7) Drying the adsorption column: Place the adsorption column in a new centrifuge tube and let it stand at room temperature for 10 min to completely evaporate any residual alcohol and avoid affecting the subsequent dissolution of plasmids;

[0092] (8) Elution of plasmid: Add an appropriate amount of ddH2O to the center of the adsorption membrane, place at room temperature for 5 min, then centrifuge at an appropriate speed for 2 min, and collect the plasmid solution into a centrifuge tube.

[0093] 5. Constructing a standard curve: High-concentration plasmids were extracted to obtain concentrations of 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, and 1 pg / μL as standard test samples. A quantitative real-time PCR reaction was performed to obtain a standard curve. The amplification curve should be S-shaped. Figure 4 A) Three replicates were performed, showing good repeatability. Based on the linear relationship between the logarithm of DNA quantity (x) and the corresponding CT value (y), Y = -3.444x + 48.47, R 2 =0.997 ( Figure 4 B).

[0094] 6. Preparation of the sample to be tested

[0095] One bottle of *Dendrobium distichum* cells in liquid suspension was randomly selected and counted using a hemocytometer. The bacterial concentration was 4.25 × 10⁶ cells / mL. Subsequently, cell suspensions with volumes of 200 μL and concentrations of 4.25 × 10⁶ cells / mL, 3.23 × 10⁶ cells / mL, 2.15 × 10⁶ cells / mL, and 1.08 × 10⁶ cells / mL were prepared using the mother liquor. Genomic DNA was then extracted.

[0096] 7. Extract genomic DNA from the test strain

[0097] DNA extraction was performed using the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit.

[0098] (1) Cell lysis: Take an appropriate amount of bacterial culture medium, add 180 μL Buffer GB, 20 μL Proteinase K and 10 μL RNase A to a centrifuge tube, mix well and incubate at 56 ℃ for 30 min;

[0099] (2) Add 200 μL of anhydrous ethanol to it and mix thoroughly by suction and whisking;

[0100] (3) Transfer the above mixture to an adsorption column, centrifuge at 12000 rpm for 2 min, and discard the filtrate;

[0101] (4) Add 500 μL of Buffer WA to it, centrifuge at 12000 rpm for 1 min, and then discard the filtrate;

[0102] (5) Add 700 μL of Buffer WB to it, centrifuge at 12000 rpm for 1 min, and then discard the filtrate;

[0103] (6) Repeat step (5);

[0104] (7) Centrifuge the empty adsorption column at 12000 rpm for 2 min to remove residual liquid, then place it on a new 1.5 mL centrifuge tube, add 30 μL of preheated Elution Buffer at 65 ℃ to the center of the adsorption column, and let it stand at room temperature for 5 min.

[0105] (8) Centrifuge at 12000 rpm for 2 min, collect the eluted genomic DNA, and store the obtained genome in a -40 ℃ freezer for later use.

[0106] Then, a real-time quantitative PCR reaction system was prepared.

[0107] 8. Quantitative Real-Time PCR Reaction

[0108] The primer concentration for the real-time PCR reaction system was 10 μM, and the annealing temperature for the cycling reaction was 60 °C. The reaction system is shown in Table 3 below.

[0109] Table 3. Real-time PCR reaction system

[0110] Composition Dosage 2×Q5 SYBR qPCR Master Mix 10 μL Upstream primer (10 μM) 0.4 μL Downstream primer (10 μM) 0.4 μL DNA template 1 μL ddH2O 8.2 μL

[0111] The reaction procedure is as follows: Pre-deformation: 95 ℃, 30 sec; 40 cycles: 95 ℃, 10 sec, 60 ℃, 30 sec. The amplification results and melting curves for different concentrations were obtained. Figure 5 ).

[0112] 9. Using the copy number (copies / μL) = [(X ng / μL × 10]... -9 ) × (6.02 × 10 23 The CT value obtained by dividing the number of bases by 660 can be calculated according to the standard curve formula. The CT value is then correlated with the copy concentration to achieve quantification of the standard sample strain.

[0113] The bacterial cell concentration and copy concentration of the sample to be tested are converted.

[0114] The average value of the calculated correspondence is 1×10. 6 The average copy concentration corresponding to a bacterial cell concentration of 1.51 × 10⁻⁶ cells / mL was 1.51 × 10⁻⁶. 7 copies / μL.

[0115] III. Random Sample Detection of *Dendrobium discoideum*

[0116] Genomic DNA was extracted from random samples according to the specific implementation method (extraction of genomic DNA from the test strain), with three replicates for each sample, followed by quantitative real-time PCR (qPCR). Figure 6 According to the formula, copy concentration (copies / μL) / average copy concentration ≈ cell concentration (cells / mL), the copy concentration is calculated from the obtained sample CT values, and then the cell concentration in the random sample is obtained. The corresponding results are shown in the table below:

[0117] Table 4. Cell Concentration and Copy Concentration

[0118] sample Average CT value Copy concentration (copies / μL) Bacterial cell concentration (×10⁶ cells / mL) Actual count concentration (×10⁶ cells / mL) Sample 1 21.52 <![CDATA[6.81×10 7 ]]> 4.51 4.3 Sample 2 22.09 <![CDATA[4.65×10 7 ]]> 3.08 3.23 Sample 3 22.20 <![CDATA[4.33×10 7 ]]> 2.87 2.15 Sample 4 23.90 <![CDATA[1.38×10 7 ]]> 0.92 1.08

[0119] Although embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents. In conclusion, if those skilled in the art, inspired by this description, design similar structural methods and embodiments without departing from the inventive spirit of the invention, such designs should fall within the protection scope of the present invention.

Claims

1. A specific primer pair for detecting *Discotyledone spp.*, wherein the primer pair is obtained by screening for target genes in the *Discotyledone spp.* genome, characterized in that: It includes an upstream primer and a downstream primer, the nucleotide sequence of which is shown in SEQ ID NO.1 and the nucleotide sequence of which is shown in SEQ ID NO.2; the sequence of the upstream primer SEQ ID NO.1 is 5'-GAGCCTAGTCTGAA-3' and the sequence of the downstream primer SEQ ID NO.2 is 5'-GCCAGTAGCCGATAGGAACTTGTT-3'.

2. A method for detecting and quantifying *Dendrobium discoideum*, using the specific primer pair described in claim 1, combined with real-time quantitative PCR technology, characterized in that: Includes the following steps: S1. Extract genomic DNA from the sample to be tested; S2. Using the extracted genomic DNA as a template, perform a real-time quantitative PCR reaction using the specific primer pair; S3. Based on the CT value obtained from the real-time quantitative PCR reaction, the copy concentration of *Dendrobium discoideum* in the sample to be tested is calculated in conjunction with the standard curve, and then the bacterial concentration is obtained.

3. The method for detecting and quantifying *Dendrobium discoideum* according to claim 2, characterized in that: The real-time quantitative PCR reaction system in step S2, in 20 μL increments, includes 10 μL of 2×Q5 SYBR qPCR Master Mix, 0.4 μL of 10 μM upstream primer, 0.4 μL of 10 μM downstream primer, 1 μL of DNA template, and 8.2 μL of ddH2O.

4. The method for detecting and quantifying *Dendrobium discoideum* according to claim 3, characterized in that: The real-time quantitative PCR reaction program in step S2 is as follows: pre-denaturation at 95°C for 30 seconds; 40 cycles, each cycle including denaturation at 95°C for 10 seconds and annealing extension at 60°C for 30 seconds.

5. The method for detecting and quantifying *Dendrobium discoideum* according to claim 3, characterized in that: The method for creating the standard curve in step S3 is as follows: ① The genome of *Dendrobium discoideum* was amplified using the specific primer pair described in claim 1 to obtain the target fragment. The target fragment was then ligated into the pEASY-T&B Zero Cloning Vector plasmid vector, transformed into competent DH5α cells, recombinants were screened, and plasmids were extracted. ② Determine the plasmid concentration and dilute it to a gradient concentration of 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, and 1 pg / μL as standard samples; ③ Perform real-time quantitative PCR on the standard samples, plot the standard curve with the logarithm of DNA amount as the x-axis and the corresponding CT value as the y-axis, and obtain the standard curve equation.

6. The method for detecting and quantifying *Dendrobium discoideum* according to claim 3, characterized in that: The conversion relationship for cell concentration is: Cell concentration (cells / mL) = Copy concentration (copies / μL) ÷ 1.51 × 10⁻⁶ 7 copies / μL×10 6 cells / mL.

7. The method for detecting and quantifying *Dendrobium discoideum* according to claim 3, characterized in that: The samples to be tested include soil samples and culture media or suspensions of *Diplostomum truncatum* in water samples.

Images