Molecular marker of locus qSGC.A8-1 remarkably associated with glucosinolate content of brassica napus seeds and application of molecular marker

Abstract

The invention belongs to the technical field of molecular biology and genetic breeding, and discloses a molecular marker of a locus qSGC.A8-1 remarkably associated with glucosinolate in brassica napus seeds and application of the molecular marker. The locus qSGC.A8-1 remarkably related to the glucosinolate content of the rape seeds and the peak SNP marker Bn-A08-p2660414 of the locus qSGC.A8-1 are located at the 2nd 088 base and the 727th base of the chromosome A08 of the reference genome of the rape DarmorV4.1, 8.8% of phenotypic variance can be explained on average, and the average additive effect is-12.0 mu mol / g. When the PARMS marker designed by the SNP is used for detecting rape germplasm resources, the PARMS marker is simple and convenient to operate and clear in typing, and the average thioglycoside content of the A genotype material seeds is lower than that of the G genotype material seeds, so that the PARMS marker has a good selection effect on the thioglycoside of the rape seeds.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological breeding, and particularly relates to a molecular marker of a significant correlation site qSGC.A8-1 of Brassica napus seed glucosinolate content and application. BACKGROUND

[0002] At present, the main objectives of rapeseed breeding include resistance, yield and quality. These traits are complex quantitative traits, which are jointly regulated by multiple genes and are easily affected by environmental conditions. Traditional breeding methods and technical means are difficult to achieve precise improvement of these traits. With the rapid progress of molecular marker technology and the wide application of emerging biological technologies such as gene editing, molecular improvement of these traits becomes possible.

[0003] Rapeseed quality traits mainly include rapeseed oil content, erucic acid and glucosinolate content, etc. Glucosinolate is a kind of sulfur-containing secondary metabolite, whose core structure is composed of β-thioglucosyl, a sulfoxime group and a side chain R group from different amino acids. Glucosinolate mainly exists in cruciferous plants such as rapeseed, broccoli and cauliflower. Glucosinolate has various positive effects on cancer prevention in humans, plant pest and disease defense and special flavor of vegetables (Xie, 2023). However, the glucosinolate in rapeseed cake has toxic effects on animals, so the content of glucosinolate in rapeseed determines the value of rapeseed cake as feed.

[0004] Using linkage and / or association mapping methods, a batch of QTLs controlling seed glucosinolate content have been identified in rapeseed (Chao et al., 2022; Zhang et al., 2024), most of which are distributed on A9, C2, C7 and C9 chromosomes, mainly corresponding to GTR2 and MYB28 genes (Zhang et al., 2024). However, these QTLs are not enough to explain the variation of glucosinolate content in rapeseed germplasm resources, which indicates that new glucosinolate content regulatory sites still need to be explored.

[0005] The present application uses high-density SNP genotype data of rapeseed core association population and seed glucosinolate content phenotype data of 8 environments for whole genome association analysis, aiming to find new stable association sites, and accordingly develop practical high-throughput and low-cost molecular markers for molecular improvement of rapeseed seed glucosinolate content. SUMMARY

[0006] The application aims to provide the application of a reagent for detecting the 2,088,727th base on chromosome A08 of Brassica napus in screening and breeding of Brassica napus seed glucosinolate content.

[0007] Another object of the present application is to provide the application of the primer for detecting the base at position 2,088,727 on the A08 chromosome of Brassica napus in the screening breeding of the seed glucosinolate content of Brassica napus.

[0008] A final object of the present application is to provide a method for the screening breeding of the seed glucosinolate content of Brassica napus.

[0009] In order to achieve the above-mentioned objects, the present application adopts the following technical measures:

[0010] Obtaining of the significant association of the seed glucosinolate content of Brassica napus with the PARMS marker:

[0011] (1) Extracting the total DNA of 331 materials of the core association population of Brassica napus constructed by the present team (Li et al., 2020), and performing genotype analysis on each sample by using the Brassica 60K SNP chip (Clarke et al., 2016).

[0012] (2) Calculating the marker heterozygous rate, missing rate, and minor allele frequency of the population materials at each site by using the Illumina BeadStudio genotyping software (http: / / www.illumina.com / ). Removing the markers without polymorphism, high missing rate, no homozygous genotype, low allele frequency, high heterozygous genotype frequency, uncertain position, and multiple copies, and finally obtaining 24508 high-quality SNP markers for subsequent analysis.

[0013] (3) Planting the 331 materials of the core association population of Brassica napus constructed by the present team in Nanchang 2014, Wuhan 2012-2016, and Zhengzhou 2013-2014 (designated as N14, W12, W13, W14, W15, W16, Z13, and Z14), respectively, harvesting 10 plants per plot at the mature stage, drying and threshing, and determining the glucosinolate content by using the near-infrared instrument method (Qiu et al., 2006).

[0014] (4) Performing association analysis by using the TASSEL 5.0 software (Bradbury et al., 2007) in combination with the SNP genotype, seed glucosinolate content phenotype, population structure, and genetic relationship data of the core association population. Finally, the site qSGC.A8-1 significantly associated with multiple glucosinolates on the A08 chromosome of the Brassica DarmorV4 reference genome is obtained, the peak SNP marker Bn-A08-p2660414 is located at position 2,088,727 (the base is A or G), and it can be repeatedly detected in 5 environments.

[0015] (5) extracting the sequence of 100bp upstream and downstream of the 2,088,727th base on the A08 chromosome of Brassica napus, and obtaining the PARMS detection primer sequence according to the principle of primer design: qSGC.A8-1F: CACCGTCACCTTCTCCATCC; qSGC.A8-1Rt: gaaggtgaccaagttcatgctTCCAATATGTGGTGGTAGATTAAGAT; qSGC.A8-1Rc: gaaggtcggagtcaacggattTCCAATATGTGGTGGTAGATTAAAAC.

[0016] The protection scope of the present application includes:

[0017] The reagent for detecting the 2,088,727th base on the A08 chromosome of Brassica napus is applied to the screening breeding of the glucosinolate content of Brassica napus seeds.

[0018] The reagent for detecting the 2,088,727th base on the A08 chromosome of Brassica napus is applied to the preparation of a glucosinolate content screening kit for Brassica napus seeds.

[0019] In the above-mentioned application, if the 2,088,727th base on the A08 chromosome of Brassica napus is G, it indicates that the glucosinolate content in the seeds of the variety is high;

[0020] In the above-mentioned application, if the 2,088,727th base on the A08 chromosome of Brassica napus is A, it indicates that the glucosinolate content in the seeds of the variety is low;

[0021] The reagent described above is preferably a primer.

[0022] The primer described above is preferably a PARMS detection primer.

[0023] The primer described above is more preferably the primer provided by the present application: qSGC.A8-1F: CACCGTCACCTTCTCCATCC, qSGC.A8-1Rt: gaaggtgaccaagttcatgctTCCAATATGTGGTGGTAGATTAAGAT, and qSGC.A8-1Rc: gaaggtcggagtcaacggattTCCAATATGTGGTGGTAGATTAAAAC.

[0024] A method for screening and breeding of Brassica napus seed glucosinolate content, comprising detecting the base at position 2,088,727 on chromosome A08 of Brassica napus by using conventional methods in the art, which include but are not limited to sequencing method, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SnapShot method, KASP method, PARMS method, gene chip method or mass spectrometry method.

[0025] The method described above is preferably PCR detection, and the primers used are: qSGC.A8-1F: CACCGTCACCTTCTCCATCC, qSGC.A8-1Rt: gaaggtgaccaagttcatgctTCCAATATGTGGTGGTAGATTAAGA T and qSGC.A8-1Rc: gaaggtcggagtcaacggattTCCAATATGTGGTGGTAGATTAAAAC.

[0026] The version number of Brassica napus genome used in the present application is B.napus Darmor-bzh reference genome sequence assembly (version 4.1) (Chalhoub et al., 2014).

[0027] Compared with the prior art, the present application has the following advantages:

[0028] (1) The present application obtains the locus qSGC.A8-1 significantly associated with Brassica napus seed glucosinolate content, which can be repeatedly detected, and can explain 8.8% of the average phenotypic variance, with an average additive effect of -12.0 μmol / g, which can be effectively applied to the genetic improvement of Brassica napus seed glucosinolate content.

[0029] (2) The present application obtains a PARMS marker significantly associated with Brassica napus seed glucosinolate content, which has a simple and low-cost detection method, can perform high-throughput screening on the Brassica napus glucosinolate genome haplotype region, and improve the selection efficiency and accuracy. DETAILED DESCRIPTION

[0030] The technical solutions described in the present application are conventional technologies in the art if not specifically stated; the reagents or materials are from commercial channels if not specifically stated. The version number of the Brassica napus genome used in the present application is B. napus Darmor-bzh reference genome sequence assembly (version 4.1) (Chalhoub et al., 2014). Most of the materials detected in the examples of the present application are high-generation inbred lines, and there is no data on heterozygous genotypes if not specifically stated. Example 1: Obtaining SNP markers significantly associated with Brassica napus seed glucosinolate content

[0031] (1) 1063 Brassica napus inbred lines from various countries around the world were collected (Li et al., 2015), and 331 materials were selected from them to construct a core association population (Li et al., 2020) based on their genotypic and phenotypic data. Single-plant leaves of each line in the association population were collected, total DNA was extracted using the CTAB method, and genotypic analysis was performed on each sample using a Brassica napus 60K SNP chip (Clarke et al., 2016).

[0032] (2) The Illumina BeadStudio genotyping software (http: / / www.illumina.com / ) was used to calculate the marker heterozygosity rate, missing rate, and minor allele frequency of each site in the population materials. The SPAGeDi software was used to calculate the genetic relationship among the 331 Brassica napus germplasm resources (Hardy and Vekemans, 2002). The SNP markers were filtered based on the following criteria: missing rate ≤ 0.2, heterozygosity rate ≤ 0.2, minor allele frequency > 0.05, and SNP markers matching only in the Brassica napus genome. A total of 24508 high-quality SNP markers were obtained for whole-genome association analysis.

[0033] (3) The 331 lines of the core association population were planted in Nanchang in 2014, Wuhan in 2012-2016, and Zhengzhou in 2013-2014 (designated as N14, W12, W13, W14, W15, W16, Z13, and Z14, respectively). Ten representative single plants were harvested from each plot at maturity and dried, and the glucosinolate content was determined using the near-infrared instrument method (Qiu et al., 2006).

[0034] (4) Combined with the genotype data and the phenotype data of glucosinolate of the association population, the whole genome association analysis was performed by using TASSEL 5.0 software. By integrating the significant association SNP markers detected in different environments and models, the site qSGC.A8-1 significantly associated with glucosinolate and good in reproducibility was obtained on A08 chromosome, which could be repeatedly detected in five environments, and the peak SNP marker Bn-A08-p2660414 located at the 2,088,727th base (A or G) of the DarmorV4.1 reference genome, with an average additive effect of -12.0 μmol / g and an average contribution rate of 8.8%.

[0035] Table 1, Information of the association site qSGC.A8-1 of glucosinolate content of rapeseed

[0036] Example 2:

[0037] A method for developing and using a PARMS marker significantly associated with glucosinolate content of rapeseed:

[0038] The association marker obtained in Example 1 is derived from the SNP chip, only the probe sequence information for molecular hybridization. The rapeseed SNP chip can detect tens of thousands of sites at a time, but its operation is relatively cumbersome and special equipment is needed. In addition, if the rapeseed SNP chip is used to detect a large number of breeding intermediate materials, the cost is high, so it is necessary to convert it into a simple and low-cost PCR amplification-based detection method, such as the PARMS (Penta-primer Amplification Refractory Mutation System) marker. The marker system includes a pair of fluorescent universal primers (FAM and HEX as the reporter fluorescence), a pair of SNP allele-specific primers and a reverse common primer, which can quickly and simply detect the SNP allele type.

[0039] (1) For the peak SNP marker Bn-A08-p2660414 associated with qSGC.A8-1, the sequence of 100 bp upstream and downstream of the 2,088,727th base of the A08 chromosome of the rapeseed DarmorV4.1 reference genome was extracted. According to the primer design principle, the PARMS marker detection primer sequence is obtained as follows:

[0040] qSGC.A8-1F: CACCGTCACCTTCTCCATCC;

[0041] qSGC.A8-1Rt: gaaggtgaccaagttcatgctTCCAATATGTGGTGGTAGATTAAGAT;

[0042] qSGC.A8-1Rc: gaaggtcggagtcaacggattTCCAATATGTGGTGGTAGATTAAAAC.

[0043] The lower case letters in the primer are fluorescent linkers.

[0044] (2) Using the genomic DNA of the Brassica-associated population as a template, the above primer is used for fluorescence quantitative PCR amplification, and the Tecan F200 is used to scan the FAM and HEX signals and output the results, and finally converted into genotypes.

[0045] The sequence amplified in Brassica variety Zhongshuang 11 using the above primer is: CACCGTCACCTTCTCCAT C C GAAAATGTTGCCCCACCACCGGAAAACAACAACCACAGCG ATCTTAATCTACCACC ACATATTGGA .

[0046] The sequence amplified in Brassica variety No. 2127 using the above primer is: CACCGTCACCTTCTCCATC C GAAAATGTTGCCCCACCACCGGAAAACAACAACCACAGCG GTTTTAATCTACCACCA CATATTGGA .

[0047] The determination method is:

[0048] If the A genotype is detected, it indicates that the glucosinolate content in the seeds of the variety is low; if the G genotype is detected, it indicates that the glucosinolate content in the seeds of the variety is high.

[0049] Example 3: Application of PARMS marker in Brassica glucosinolate selection

[0050] From the 732 materials of the non-core associated population (i.e., 1063 Brassica selfing lines in Example 1 except for 331 core associated population), 96 (convenient for PCR amplification) were randomly selected, and the materials with genotype AA detected by the PARMS marker qSG C.A8-1 provided in Example 2 were 86, and the materials with genotype GG were 9, and the rest were heterozygous, which are not shown here. The seed glucosinolate content of the two genotypes of materials has significant difference in 7 environments, and the average difference is -37.8 μmol / g.

[0051] The detection method of each glucosinolate below is near-infrared method, and the content unit is μmol / g (Qiu et al., 2006).

[0052] Table 2, Comparison of two genotypes of PARMS marker qSGC.A8-1 on Brassica napus seed glucosinolate content

[0053]

[0054]

[0055] The above results are sufficient to show that the PARMS molecule marker qSGC.A8-1 prepared by us is highly correlated with the content of glucosinolate in the seeds of Brassica napus and has good selection effect.

Claims

1. Application of reagent for detecting base position 2,088,727 on chromosome A08 of Brassica napus in screening and breeding of glucosinolate content in Brassica napus seeds.

2. Application of reagent for detecting bases at positions 2,088,727 on chromosome A08 of Brassica napus in the preparation of a screening kit for glucosinolate content in Brassica napus seeds.

3. The method of determination in the application process according to claim 1 or 2 is as follows: if the base at position 2,088,727 on chromosome A08 of Brassica napus is detected as G, it indicates that the glucosinolate content in the seeds of this variety is high; if the base at position 2,088,727 on chromosome A08 of Brassica napus is detected as A, it indicates that the glucosinolate content in the seeds of this variety is low.

4. The application according to claim 1 or 2, wherein the reagent is a primer.

5. The application according to claim 5, wherein the primer is a PARMS detection primer.

6. The application according to claim 6, wherein the PARMS detection primers are: qSGC.A8-1F: CACCGTCACCTTCTCCATCC, qSGC.A8-1Rt: gaaggtgaccaagttcatgctTCCAATATGTGGTGGTAGATTAAGAT, and qSGC.A8-1Rc: gaaggtcggagtcaacggattTCCAATATGTGGTGGTAGATTAAGAC.

7. A method for screening and breeding rapeseed seeds based on glucosinolate content, comprising detecting base position 2,088,727 on chromosome A08 of rapeseed, the method comprising: Sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SnapShot method, KASP method, PARMS method, gene chip method, or mass spectrometry method.

8. The method according to claim 7, wherein the detection method is PCR, and the primers used are: qSGC.A8-1F: CACCGTCACCTTCTCCATCC, qSGC.A8-1Rt: gaaggtgaccaagttcatgctTCCAATATGTGGTGGTAGATTAAGAT and qSGC.A8-1Rc: gaaggtcggagtcaacggattTCCAATATGTGGTGGTAGATTAAAAC.

Images