Molecular marker of qsgc.a8-1 significantly associated with brassica napus seed glucosinolate content and application thereof

Abstract

The application belongs to the technical field of molecular biology and genetic breeding, and discloses a molecular marker of a site significantly related to Brassica napus seed glucosinolate and application qSGC.A8-1 The site significantly related to the content of Brassica napus seed glucosinolate qSGC.A8-1 and a peak SNP marker Bn-A08-p2660414 thereof, which is located at the 2,088,727th base of the A08 chromosome of the Brassica napus DarmorV4.1 reference genome, can explain 8.8% of the average phenotypic variance and has an average additive effect of-12.0 μmol / g. The detection of the PARMS marker designed by using the SNP on Brassica napus germplasm resources shows that the operation is simple and the typing is clear, and the average glucosinolate content of the seed of the A genotype is lower than that of the G genotype, so the Brassica napus seed glucosinolate has a good selection effect.

Description

Technical Field

[0001] This invention belongs to the field of biological breeding technology, specifically relating to a molecular marker qSGC.A8-1, a site significantly associated with glucosinolate content in rapeseed seeds, and its application. Background Technology

[0002] Currently, the main goals of rapeseed breeding include resistance, yield, and quality. These traits are complex quantitative traits, regulated by numerous genes and easily influenced by environmental conditions. Traditional breeding methods and techniques struggle to achieve precise improvement of these traits. However, the rapid advancement of molecular marker technology and the widespread application of emerging biotechnologies such as gene editing have made molecular modification of these traits possible.

[0003] The quality traits of rapeseed mainly include the oil content, erucic acid, and glucosinolate (thioglucosinolate) content of rapeseed seeds. Glucosinolates are a class of sulfur-containing secondary metabolites, with a core structure consisting of a β-thioglucosyl group, a sulfonyl oxime group, and a side chain R group derived from different amino acids. Glucosinolates are mainly found in cruciferous plants, such as rapeseed, broccoli, and cauliflower. Glucosinolates have various positive effects in human cancer prevention, plant disease and pest control, and imparting special flavors to vegetables (Xie Zhaoqi, 2023). However, glucosinolates in rapeseed meal are toxic to livestock, so the glucosinolate content in rapeseed grains determines the value of rapeseed meal as animal feed.

[0004] Using linkage and / or association mapping methods, a number of QTLs controlling glucosinolate content in rapeseed seeds have been identified (Chao et al., 2022; Zhang et al., 2024), mostly distributed on chromosomes A9, C2, C7, and C9, primarily corresponding to genes such as GTR2 and MYB28 (Zhang et al., 2024). However, these QTLs are insufficient to explain the variation in glucosinolate content in rapeseed germplasm resources, indicating that new glucosinolate content regulatory sites still need to be discovered.

[0005] This invention utilizes high-density SNP genotype data from a core associated population of rapeseed and seed glucosinolate content phenotypic data from eight environments to conduct genome-wide association analysis, aiming to find new and stable association sites and develop practical, high-throughput, low-cost molecular markers for molecular improvement of glucosinolate content in rapeseed seeds. Summary of the Invention

[0006] The purpose of this invention is to provide a reagent for detecting the 2,088,727th base on chromosome A08 of Brassica napus and its application in the screening and breeding of glucosinolate content in Brassica napus seeds.

[0007] Another objective of this invention is to provide the application of primers for detecting base position 2,088,727 on chromosome A08 of Brassica napus in the screening and breeding of glucosinolate content in Brassica napus seeds.

[0008] The final objective of this invention is to provide a method for screening and breeding rapeseed seeds for glucosinolate content.

[0009] To achieve the above objectives, the present invention adopts the following technical measures:

[0010] The glucosinolate content in rapeseed seeds was significantly associated with the acquisition of PARMS markers:

[0011] (1) Total DNA was extracted from 331 materials of the core associated population of Brassica napus (Li et al., 2020) constructed by our team, and genotyping was performed on each sample using the Brassica napus 60K SNP chip (Clarke et al., 2016).

[0012] (2) The heterozygous rate, missing rate, and minor allele frequency of the population materials at each locus were calculated using Illumina BeadStudio genotyping software (http: / / www.illumina.com / ). Markers with no polymorphism, high deletion rate, no homozygous genotype, low allele frequency, high heterozygous genotype frequency, uncertain location, and multiple copy markers were removed, resulting in 24,508 high-quality SNP markers for subsequent analysis.

[0013] (3) The 331 materials of the core association population of Brassica napus constructed by our team were planted in eight environments (Nanchang 2014, Wuhan 2012-2016, Zhengzhou 2013-2014) (codes N14, W12, W13, W14, W15, W16, Z13, Z14). At maturity, 10 plants were harvested from each plot, dried and threshed, and the glucosinolate content was determined by near-infrared spectroscopy (Qiu et al., 2006).

[0014] (4) Based on the SNP genotypes, seed glucosinolate content phenotypes, population structure, and phylogenetic data of the core associated population, association analysis was performed using TASSEL 5.0 software (Bradbury et al., 2007). Finally, a site qSGC.A8-1 significantly associated with multiple glucosinolates was obtained on chromosome A08 of the rapeseed DarmorV4 reference genome. Its peak SNP marker, Bn-A08-p2660414, is located at base position 2,088,727 (base A or G) and can be repeatedly detected in five environments.

[0015] (5) Extract 100 bp sequences upstream and downstream of the 2,088,727th base position on the A08 chromosome of rapeseed, and obtain PARMS detection primer sequences according to primer design principles: qSGC.A8-1F: CACCGTCACCTTCTCCATCC; qSGC.A8-1Rt: gaaggtgaccaagttcatgctTCCAATATGTGGTGGTAGATTAAGAT; qSGC.A8-1Rc: gaaggtcgga gtcaacggattTCCAATATGTGGTGGTAGATTAAAAC.

[0016] The scope of protection of this invention includes:

[0017] Application of reagent for detecting base position 2,088,727 on chromosome A08 of Brassica napus in screening and breeding of glucosinolate content in Brassica napus seeds.

[0018] Application of reagent for detecting base position 2,088,727 on chromosome A08 of Brassica napus in the preparation of a screening kit for glucosinolate content in Brassica napus seeds.

[0019] If the base at position 2,088,727 on chromosome A08 of the above-mentioned application is detected to be G, it indicates that the seeds of this variety have a high glucosinolate content.

[0020] If the base at position 2,088,727 on chromosome A08 of Brassica napus is detected as A, it indicates that the glucosinolate content in the seeds of this variety is low.

[0021] The reagents described above are preferably primers.

[0022] The primers described above are preferably PARMS detection primers.

[0023] The primers described above are more preferably the primers provided by the present invention: qSGC.A8-1F: CACCGTCACCTTCTCCATCC, qSGC.A8-1Rt: gaaggtgaccaagttcatgctTCCAATATGTGGTGGTAGATTAAGAT, and qSGC.A8-1Rc: gaaggtcggagtcaacggattTCCAATATGTGGTGGTAGATTAAAAC.

[0024] A method for screening and breeding rapeseed seeds for glucosinolate content includes detecting the 2,088,727th base on chromosome A08 of rapeseed using conventional methods in the art. These conventional methods include, but are not limited to: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SnapShot method, KASP method, PARMS method, gene chip method, or mass spectrometry.

[0025] The method described above is preferably PCR detection, using the following primers: qSGC.A8-1F: CACCGTCACCTTCTCCATCC, qSGC.A8-1Rt: gaaggtgaccaagttcatgctTCCAATATGTGGTGGTAGATTAAGA T, and qSGC.A8-1Rc: gaaggtcggagtcaacggattTCCAATATGTGGTGGTAGATTAAAAC.

[0026] The version number of the Brassica napus genome used in this invention is B. napus Darmor-bzh referencegenome sequence assembly (version 4.1) (Chalhoub et al., 2014).

[0027] Compared with the prior art, the present invention has the following advantages:

[0028] (1) The present invention obtained the site qSGC.A8-1, which is significantly associated with the glucosinolate content of rapeseed seeds and can be repeatedly detected. It can explain an average of 8.8% of the phenotypic variance and the average additive effect is -12.0 μmol / g. It can be effectively applied to the genetic improvement of glucosinolate content in rapeseed seeds.

[0029] (2) The present invention obtains PARMS markers that are significantly associated with the glucosinolate content in rapeseed seeds. The detection method is simple and low cost, and can perform high-throughput screening of the genomic haplotype region of glucosinolates in rapeseed, thereby improving selection efficiency and accuracy. Detailed Implementation

[0030] Unless otherwise specified, the technical solutions described in this invention are all conventional techniques in the field; the reagents or materials described, unless otherwise specified, are all from commercial sources. The version number of the Brassica napus genome used in this invention is B. napusDa rmor-bzh reference genome sequence assembly (version 4.1) (Chalhoub et al., 2014). Most of the materials tested in the embodiments of this application are high-generation inbred lines; unless otherwise specified, there is no data on heterozygous genotypes. Example 1: Obtaining SNP markers that significantly correlate with glucosinolate content in rapeseed seeds.

[0031] (1) 1063 rapeseed inbred lines from various countries around the world were collected (Li et al., 2015), and 331 materials were selected from them to construct a core associated population (Li et al., 2020) based on their genotype and phenotypic data. Single leaves of each line in the associated population were collected, and total DNA was extracted using the CTAB method. Genotyping of each sample was performed using a rapeseed 60K SNP chip (Clarke et al., 2016).

[0032] (2) The heterozygosity rate, missing rate, and minor allele frequency of the population materials at each locus were calculated using Illumina BeadStudio genotyping software (http: / / www.illumina.com / ). Phylogenetic relationships among 331 Brassica napus accessions were calculated using SPAGeDi software (Hardy and Vekemans, 2002). SNP markers were filtered based on criteria including a missing rate ≤0.2, a heterozygosity rate ≤0.2, a minor allele frequency >0.05, and a unique match of the SNP marker in the Brassica napus genome. A total of 24,508 high-quality SNP markers were obtained for genome-wide association analysis.

[0033] (3) 331 strains of the core related population were planted in eight environments (Nanchang 2014, Wuhan 2012-2016, Zhengzhou 2013-2014) (codes: N14, W12, W13, W14, W15, W16, Z13, Z14). At maturity, 10 representative single plants from each plot were harvested, dried, threshed, and their glucosinolate content was determined by near-infrared spectroscopy (Qiu et al., 2006).

[0034] (4) Genome-wide association analysis was performed using TASSEL 5.0 software, combining genotypic data from associated populations and phenotypic data of glucosinolates. By integrating significant association SNP markers detected in different environments and models, the significantly associated and reproducible locus qSGC.A8-1 was obtained on chromosome A08, which could be repeatedly detected in five environments. Its peak SNP marker Bn-A08-p2660414 is located at base 2,088,727 (A or G) in the Darmor V4.1 reference genome, with an average additive effect of -12.0 μmol / g and an average contribution rate of 8.8%.

[0035] Table 1. Information on the qSGC.A8-1 site associated with glucosinolate content in rapeseed seeds.

[0036] Example 2:

[0037] A method for developing and using PARMS markers that are significantly correlated with rapeseed glucosinolate content:

[0038] The association markers obtained in Example 1 were derived from SNP chips and only contained probe sequence information for molecular hybridization. While rapeseed SNP chips can detect tens of thousands of sites at a time, their operation is cumbersome and requires specialized equipment. Furthermore, using rapeseed SNP chips to detect large quantities of intermediate breeding materials is expensive. Therefore, it is necessary to convert them into a simpler and cheaper PCR amplification-based detection method, such as PARMS (Penta-primer Amplification Refractory Mutation System). This marker system includes a pair of universal fluorescent primers (FAM and HEX as reporter fluorescence), a pair of SNP allele-specific primers, and a reverse common primer, enabling rapid and simple SNP allele detection.

[0039] (1) For the peak SNP marker Bn-A08-p2660414 associated with qSGC.A8-1, 100 bp sequences were extracted upstream and downstream of chromosome A08 in the rapeseed DarmorV4.1 reference genome. The PARMS marker detection primer sequences were obtained according to primer design principles as follows:

[0040] qSGC.A8-1F:CACCGTCACCTTCTCCATCC;

[0041] qSGC.A8-1Rt:gaaggtgaccaagttcatgctTCCAATATGTGGTGGTAGATTAAGAT;

[0042] qSGC.A8-1Rc:gaaggtcggagtcaacggattTCCAATATGTGGTGGTAGATTAAAAC.

[0043] The lowercase letters in the primers are fluorescent linkers.

[0044] (2) Using the genomic DNA of the rapeseed-related population as a template, the above primers were used to perform real-time PCR amplification. The FAM and HEX signals were scanned using a Tecan F200 and the results were output. Finally, the results were converted into genotypes.

[0045] Using the primers described above, the sequence amplified in the rapeseed variety Shuang 11 is as follows: CACCGTCACCTTCTCTCAT C C GAAAATGTTGCCCCACCACCGGAAAACAACAACCACAGCG ATCTTAATCTACCACC ACATATTGGGA .

[0046] Using the primers described above, the sequence amplified in rapeseed variety No. 2127 is as follows: CACCGTCACCTTCTCCCATC C GAAAATGTTGCCCCACCACCGGAAAACAACAACCACAGCG GTTTTAATCTACCACCA CATATTGGA .

[0047] The determination method is:

[0048] If the A genotype is detected, it indicates that the glucosinolate content in the seeds of this variety is low; if the G genotype is detected, it indicates that the glucosinolate content in the seeds of this variety is high.

[0049] Example 3: Application of PARMS labeling in the selection of rapeseed glucosinolates

[0050] From 732 non-core related populations (i.e., 1063 rapeseed inbred lines in Example 1 excluding 331 core related populations), 96 were randomly selected (for convenient PCR amplification). Using the PARMS marker qSG C.A8-1 provided in Example 2, 86 of these were identified as AA, 9 as GG, and the rest were heterozygous and not shown here. The seed glucosinolate content of the two genotypes differed significantly across the seven environments, with an average difference of -37.8 μmol / g.

[0051] The following glucosinolates were detected by near-infrared spectroscopy, and the content unit is μmol / g (Qiu et al., 2006).

[0052] Table 2. Comparison of glucosinolate content in seeds of Brassica napus by two PARMS marker qSGC.A8-1 genotypes.

[0053]

[0054]

[0055] The above results are sufficient to demonstrate that the PARMS molecular marker qSGC.A8-1 we prepared is highly correlated with the glucosinolate content of rapeseed seeds and has a good selection effect.

Claims

1. The application of a reagent for detecting the 2,088,727th base on chromosome A08 of Brassica napus in the screening breeding of glucosinolate content in Brassica napus seeds. The determination method in the application process is as follows: if the 2,088,727th base on chromosome A08 of Brassica napus is detected as G, it indicates that the glucosinolate content of the Brassica napus seed is high; if the 2,088,727th base on chromosome A08 of Brassica napus is detected as A, it indicates that the glucosinolate content of the Brassica napus seed is low. The version number of the Brassica napus genome is B. napus Darmor-bzh reference genome sequence assembly version 4.

1.

2. The application of the reagent for detecting the 2,088,727th base on chromosome A08 of *Brassica napus* in the preparation of a screening kit for glucosinolate content in *Brassica napus* seeds. The determination method during application is as follows: if the 2,088,727th base on chromosome A08 of *Brassica napus* is G, it indicates that the glucosinolate content in the *Brassica napus* seed is high; if the 2,088,727th base on chromosome A08 of *Brassica napus* is A, it indicates that the glucosinolate content in the *Brassica napus* seed is low. The version number of the *Brassica napus* genome is *B. napus Darmor-bzh reference genome sequence assembly version 4.1*.

3. The application according to claim 1 or 2, wherein the reagent is a primer.

4. The application according to claim 3, wherein the primer is a PARMS detection primer.

5. In the application according to claim 4, the specific primers in the PARMS detection primers are: qSGC.A8-1F: CACCGTCACCTTCTCCATCC, qSGC.A8-1Rt: gaaggtgaccaagttcatgctTCCAATATGTGGTGGTAGATTAAGAT, and qSGC.A8-1Rc: gaaggtcggagtcaacggattTCCAATATGTGGTGGTAGATTAAGAC.

6. A method for screening and breeding rapeseed seeds based on glucosinolate content, comprising detecting base position 2,088,727 on chromosome A08 of rapeseed, wherein the method comprises: Sequencing, TaqMan probe method, AS-PCR, molecular beacon method, high-resolution melting curve method, CAPS method, SnapShot method, KASP method, PARMS method, gene chip method, or mass spectrometry method are used. The determination method is as follows: if G is detected at position 2,088,727 of chromosome A08 of Brassica napus, it indicates that the glucosinolate content of Brassica napus seeds is high; if A is detected at position 2,088,727 of chromosome A08 of Brassica napus, it indicates that the glucosinolate content of Brassica napus seeds is low. The version number of the Brassica napus genome is B. napus Darmor-bzh referencegenome sequence assembly version 4.

1.

7. The method according to claim 6, wherein the detection method is PCR, and the primers used are: qSGC.A8-1F: CACCGTCACCTTCTCCATCC, qSGC.A8-1Rt: gaaggtgaccaagttcatgctTCCAATATGTGGTGGTAGATTAAGAT and qSGC.A8-1Rc: gaaggtcggagtcaacggattTCCAATATGTGGTGGTAGATTAAAAC.

Images