KASP marker for identifying or assisting in identifying wheat stalk rust resistance gene Sr9b and application of KASP marker

By developing SNP markers based on KASP technology and designing primers using polymorphic sites in the Sr9b gene, the problem of lacking high-throughput molecular markers for wheat stem rust resistance genes was solved, enabling efficient and accurate breeding identification and selection, and improving breeding efficiency.

CN120989295APending Publication Date: 2025-11-21SHANDONG AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511498029.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-20
Publication Date
2025-11-21

AI Technical Summary

Technical Problem

The lack of high-throughput molecular markers for wheat stem rust resistance genes in existing technologies hinders their effective use in breeding, and existing molecular marker-assisted selection methods are difficult to quickly and accurately identify resistance genes in wheat breeding.

Method used

A KASP-based SNP marker was developed. Primers were designed using polymorphic sites in the Sr9b gene sequence. Wheat stem rust resistance was identified by PCR amplification and fluorescence signal detection. Sr9b-KASP markers, including Sr9b-KASP-F, Sr9b-KASP-H and Sr9b-KASP-R primers, were designed to identify wheat stem rust resistance.

Benefits of technology

This method enables efficient and accurate identification of the wheat stem rust resistance gene Sr9b, improving breeding efficiency, allowing for accurate selection and aggregation of superior resistance genes at an early stage, and simplifying the breeding process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120989295A_ABST
    Figure CN120989295A_ABST
Patent Text Reader

Abstract

The invention discloses a KASP marker for identifying or assisting in identifying a wheat stalk rust resistance gene Sr9b and application of the KASP marker, and belongs to the technical field of wheat molecular breeding. On the basis of SNP (Single Nucleotide Polymorphism) between the Sr9b and a homologous gene of the Sr9b, the KASP marker capable of diagnosing the wheat stem rust resistance gene Sr9b is developed and designed, and the KASP marker comprises a primer Sr9b-KASP-F, a primer Sr9b-KASP-H and a primer Sr9b-KASP-R. The KASP primer is simple, convenient and rapid in detection, good in result accuracy, high in analysis flux, suitable for efficient detection of large-scale breeding materials, free of limitation of crop growth stages, capable of conducting early identification on the disease resistance character of harvested wheat, shortening breeding time, improving selection efficiency and helping polymerization of dominant haplotypes and other excellent characters, and has a good application prospect. The breeding of a new wheat variety with outstanding disease-resistant quality and excellent comprehensive characters is accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of wheat molecular breeding technology, specifically to a method for identifying or assisting in the identification of wheat stem rust resistance genes. Sr9b The KASP tag and its application. Background Technology

[0002] wheat( Triticum aestivum Wheat rust (L.) is an important source of energy and protein for humans, and its production is crucial to global food security. Puccinia graminis f. sp. tritici , Pgt Straw rust, a fungal disease caused by *Straw rust*, occurs in wheat-growing areas worldwide. The pathogen can infect the leaf sheaths, leaves, stems, and ears of wheat. Under suitable temperature, humidity, and wind-borne conditions, the disease develops very rapidly, and in severe epidemic years, it can lead to yield reductions of 50-70% in susceptible wheat varieties. Among numerous control measures, breeding high-level resistant varieties is the most effective and sustainable solution for controlling wheat stem rust.

[0003] Breeding practice has proven that marker-assisted selection (MAS) can rapidly and accurately analyze the genetic composition of individuals at the DNA level, providing precise and stable results. It can assist in the identification and selection of target traits and the aggregation of functional genes, thus accelerating the breeding process. KASP (Kompetitive Allele Specific PCR), a novel homogenization technique based on fluorescence signals, can detect single nucleotide polymorphisms (SNPs) and boasts advantages such as high throughput, low cost, and high accuracy. In recent years, it has been increasingly applied to genetic research on wheat yield, disease resistance, quality, and other traits, as well as to marker-assisted breeding.

[0004] However, due to the large and complex wheat genome, only 18 stem rust resistance genes have been successfully cloned so far, and few high-throughput molecular markers for their use have been reported, hindering their application in practical wheat breeding programs. Recently, genes derived from common wheat... Sr9b (NCBI GenBank Sr9b The serial number (OP219803) has been successfully cloned and developed. Sr9b The diagnostic high-throughput molecular markers can help promote the effective use of this gene in wheat rust resistance breeding and are of positive and important significance for achieving the aggregation of multiple genes. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide a method for identifying or assisting in the identification of wheat stem rust resistance genes. Sr9bThe KASP tag and its application.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides an SNP marker associated with resistance to wheat stem rust, wherein the nucleotide sequence of the SNP marker is shown in SEQ ID No. 1, and the 297th base from the 5' end of the sequence shown in SEQ ID No. 1 is a polymorphic site, the base of which is T or C.

[0007] The specific nucleotide sequences marked by SNPs are as follows: ATGTCGGGGTTGCTTGGCACGGTGGTTGATGCAGCAATAGGATGGCTGGTGCAAAGCATCCTTGACAGTTTCTTTACTGAACGTATGGAAGCATGGACTCGTGAAATCGGGCTTGCTGAAGATGTGGAGAAGCTCAAGTTTCAGATGAGGTATGTGCAGATGGTTCTTGCTGCTGCCAAGGGAAGGAGTATTGACAATATGCCTCTGGCCCA GTCACTGGATGATCTCAGAGGGCTGATTTATGACTCAGAGGACGTGATGGACGAGCTTGACTACTACCGACTCGAGCAACAGAT[T / C]ATAGAAGGTGCTTCATATTTCTTTACTGTTTCATTTTTATTGCTTTCAGTTTCTTTTATGTAGGCGTAATATGTAACCAAGAGTAGCTGAATATCGTAGGCACCACCTCTCAGATTATCTCT. (SEQ ID No.1) Note: The nucleotides in bold shaded areas in the sequence are SNP sites, and the nucleotide polymorphism is T / C, which is represented by "y" in the sequence listing.

[0008] This invention relates to wheat stem rust resistance genes. Sr9b The gene sequence (NCBI Genbank ID OP219803) was compared with the whole genome sequence information of 19 hexaploid wheat germplasms in the wheat pangenome, and it was found that... Sr9b The 297th base of the gene sequence is a polymorphic site with a base polymorphism of T>C. Further research revealed that this polymorphic site is significantly associated with wheat stem rust resistance. Based on this polymorphic site, this invention first designed a SNP marker associated with wheat stem rust resistance, the nucleotide sequence of which is shown in SEQ ID No. 1. This SNP marker can be used to identify wheat stem rust resistance genes. Sr9bIn addition, the resistance of wheat to stem rust was identified.

[0009] Wheat with the TT genotype at the SNP locus contains the stem rust resistance gene. Sr9b It exhibits resistance to stem rust.

[0010] A second aspect of the present invention provides the application of the above-mentioned SNP marker in the following (1) or (2): (1) Identification or auxiliary identification of stem rust resistance genes in wheat Sr9b ; (2) Select wheat varieties resistant to stem rust.

[0011] A third aspect of the present invention provides a method for identifying or assisting in the identification of wheat stem rust resistance genes. Sr9b The KASP marker is named Sr9b-KASP; it includes the primers shown in SEQ ID No. 2, SEQ ID No. 3, and SEQ ID No. 4; specifically as follows: Sr9b-KASP-F (with added FAM signal sequence): 5'-GAAGGTGACCAAGTTCATGCTCCGACTCGAGCAACAGATC-3'; (SEQ ID No. 2) Sr9b-KASP-H (with added HEX signal sequence): 5'-GAAGGTCGGAGTCAACGGATTCCGACTCGAGCAACAGATT -3'; (SEQ ID No. 3) Sr9b-KASP-R: 5'-ATCTGAGAGGTGGTGCCT-3'. (SEQ ID No.4) Of the primers mentioned above, Sr9b-KASP-F and Sr9b-KASP-H are upstream typing primers, and Sr9b-KASP-R is a downstream universal primer.

[0012] A fourth aspect of the invention provides the application of the above-described KASP mark in any one of (1)-(3): (1) Identification or auxiliary identification of wheat stem rust resistance genes Sr9b ; (2) To identify wheat resistance to stem rust; (3) Select and breed wheat varieties resistant to stem rust.

[0013] A fifth aspect of the present invention provides a method for identifying or assisting in the identification of wheat resistance to stem rust, comprising the following steps: Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using KASP markers, and the fluorescence signal of the amplification product was detected. If a HEX fluorescence signal (green) was detected, it indicates that the wheat to be tested contains the wheat stem rust resistance gene. Sr9b The phenotype is resistance to stem rust; if FAM fluorescence signal (blue) is detected, it means that the wheat sample does not contain the wheat stem rust resistance gene. Sr9b The phenotype is susceptible to stem rust.

[0014] Furthermore, the PCR reaction system consisted of: 2 μL template DNA at a concentration of 20 ng / μL, 1.94 μL 2X PACE™ Mix (3CR Bioscience, Harlow, England, UK), and 0.06 μL Primer Mix, for a final total reaction volume of 4 μL. The Primer Mix was prepared as follows: 12 μL of 100 μM primer Sr9b-KASP-F, 12 μL of 100 μM primer Sr9b-KASP-H, 30 μL of 100 μM primer Sr9b-KASP-R, and ddH2O to a final volume of 100 μL.

[0015] The PCR reaction conditions were as follows: 94℃ heat activation for 15 min; 94℃ denaturation for 20 s, annealing and extension at 65-57℃ for 60 s; 10 touch-down cycles, decreasing the temperature by 0.8℃ per cycle; 94℃ denaturation for 20 s, 57℃ annealing and extension for 60 s, for 35 cycles.

[0016] The beneficial effects of this invention are: (1) This invention identifies a gene that is resistant to wheat stem rust. Sr9b The relevant specific SNP site, based on which, can be effectively distinguished. Sr9b The identification of resistance and susceptibility alleles is crucial for improving wheat disease-resistant varieties, especially in selective breeding to ensure the accurate transmission of superior resistance genes. This invention provides a method for identifying or assisting in the identification of wheat stem rust resistance genes. Sr9b The KASP molecular marker is simple, fast, accurate, and has high throughput for detecting the genotype of wheat samples, making it ideal for simultaneous detection of a large number of samples.

[0017] (2) Using the KASP molecular markers provided by this invention, detection in wheat germplasm demonstrates that the molecular markers and implementation methods provided by this invention can correctly distinguish wheat germplasm. Sr9b The resistance allele and susceptibility allele. This illustrates that the molecular markers provided by this invention can achieve... Sr9bThis can facilitate early identification and assisted selection of wheat for breeding targets, improving breeding efficiency; it can also help... Sr9b The resistance alleles are combined with other desirable traits to accelerate the breeding of new wheat varieties with outstanding disease resistance and excellent overall traits. Attached Figure Description

[0018] Picture 1 This is a schematic diagram showing the location of the SNP corresponding to the KASP molecular marker developed in this invention.

[0019] In this diagram: the blue area represents the Exon, and the black solid line area represents the Intron. They represent the exon and intron regions of the gene where the SNP is located, respectively; the red-marked SNPs are the functional SNPs corresponding to the KASP markers and their locations.

[0020] Picture 2 Different wheat germplasm Sr9b Differences between homologous gene sequences and Sr9b sequences.

[0021] Picture 3 The results of amplification and detection of the test materials using the KASP molecular marker developed in this invention are shown in Example 2. The X-axis represents the FAM signal, and the Y-axis represents the HEX signal. Black dots represent the negative control (NTC) (i.e., ddH2O), and blue and green dots represent different genotypes. Detailed Implementation

[0022] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0023] As mentioned earlier, the discovery and screening of resistance genes are extremely important for disease resistance breeding. Currently, most stem rust resistance genes have not been cloned and lack high-throughput molecular markers, which seriously hinders the effective utilization of resistance genes in wheat stem rust resistance improvement breeding.

[0024] The inventors discovered a wheat rust resistance gene during their research. Sr9b While the gene has been successfully cloned, it still lacks high-throughput diagnostic molecular markers. To better utilize this wheat stem rust resistance gene, this invention identifies a specific SNP site for the gene and develops a KASP marker based on this site. This marker can detect the genotype of wheat materials at this SNP site, thereby efficiently screening for those carrying the wheat stem rust resistance gene. Sr9b This invention is proposed to accelerate the breeding process by identifying individual individuals.

[0025] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0026] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions.

[0027] Example 1: Used for identifying or assisting in the identification of wheat stem rust resistance genes Sr9b Development of KASP tags 1. Acquisition of functional SNPs: (1) Obtain the successfully cloned wheat stem rust resistance gene Sr9b The gene sequence. Sr9b The full-length gene sequence is 6,347 bp and contains 3 exons. Its NCBI GenBank accession number is OP219803. See details... Picture 1 This information comes from the NCBI database, website: https: / / www.ncbi.nlm.nih.gov / nuccore / OP219803.1 / .

[0028] (2) Sr9b The gene sequence was compared with the whole genome sequences (pan-genomes) of 19 hexaploid wheat germplasms in the WheatOmics database (BLASTN, e-1 value <0.0001) (Ma et al., 2021) to determine... Sr9b Homologous genes.

[0029] (3) Using Snapgene software to... Sr9b The gene sequence was compared with its homologous genes to identify single nucleotide polymorphisms and screen for functional SNPs that could completely distinguish between wheat stem rust resistance and susceptibility and had KASP polymorphism.

[0030] according to Sr9b One SNP located in an exon region was identified by sequence alignment with its homologous gene. Picture 1 The SNP site is located at Sr9b The 297th base of the gene sequence is identified as a functional SNP because exon mutations can cause changes in the composition or sequence of bases in the coding region, thereby affecting gene structure and leading to changes in gene function. Sr9b The nucleotide at this site is "T", and its homologous gene at this site has the nucleotide "C / -".

[0031] 2. Development of KASP-labeled primers according to Sr9b Functional SNPs between the KASP and its homologous genes were identified using Primer3 v4.1.0 (https: / / bioinfo.ut.ee / primer3-0.4.0 / ). Three sets of KASP markers were designed. Each set included two forward competing primers and one reverse universal primer. Considering factors such as KASP primer sequence length, GC content, and amplification difficulty, and after multiple manual tests and screenings, a set of KASP markers with good amplification performance and high specificity was finally obtained, as follows: Sr9b-KASP-F (with added FAM signal sequence): 5'-GAAGGTGACCAAGTTCATGCTCCGACTCGAGCAACAGATC-3'; (SEQ ID No. 2) Sr9b-KASP-H (with added HEX signal sequence): 5'-GAAGGTCGGAGTCAACGGATTCCGACTCGAGCAACAGATT -3'; (SEQ ID No. 3) Sr9b-KASP-R: 5'-ATCTGAGAGGTGGTGCCT-3'. (SEQ ID No. 4).

[0032] Using designed KASP primers, 19 different primers were identified in 19 wheat germplasms. Sr9b All five wheat germplasm materials carry homologous genes derived from the B genome. Sr9b The resistance alleles are Kariega ( Sr9b + Landmark Sr9b + ), Mace ( Sr9b + Stanley Sr9b + Mattis Sr9b + The remaining 14 wheat germplasm materials all carried Sr9b The susceptibility alleles are listed in Table 1. Two homologous genes from wheat germplasm materials Cadenza and Paragon have a "T" nucleotide at this SNP site, but both homologous genes lack [a specific nucleotide sequence]. Sr9b The reverse primer was not used, so it could not amplify and generate a signal normally during PCR. Therefore, based on the KASP genotyping results, it can be classified as a type that does not contain Sr9b (Table 1 and ). Picture 2 ) Table 1: Sr9b Types of functional SNPs in 19 common wheat germplasms Note: Sr9b The gene sequence is the reference sequence; "-" indicates deletion.

[0033] Example 2: Verification of Sr9b-KASP markers This embodiment is used to verify the accuracy and high resolution of the KASP molecular marker developed in Example 1 for detecting SNP sites. Sr9b-KASP The tag pair contains Sr9b Genes and without Sr9b Genotyping was performed on common wheat parents with different genes.

[0034] 1. Genomic DNA extraction from the tested wheat varieties When wheat reached the two-leaf stage, three 2-cm-long sections of young wheat leaf tissue were cut and placed in 1.3 mL 96-well plates pre-loaded with steel balls. The collected leaf tissues were freeze-dried for 48 hours in a freeze dryer (Harvest Right, Salt Lake City, UT, USA), and then ground into a fine powder by shaking the plate at 30 times per second for 3 minutes in a high-speed tissue homogenizer (SPEX SamplePrep, NJ, USA). Genomic DNA was then isolated from the dried leaf tissue using a modified cetyltrimethylammonium bromide (CTAB) protocol.

[0035] 2. PCR amplification PCR amplification system: 2 μL template DNA at a concentration of 20 ng / μL, 1.94 μL 2X PACE™ Mix (3CRBioscience, Harlow, England, UK), 0.06 μL Primer Mix, with a final total reaction volume of 4 μL; wherein, the Primer Mix is ​​prepared as follows per 100 μL: 12 μL of primer Sr9b-KASP-F at a concentration of 100 μM, 12 μL of primer Sr9b-KASP-H at a concentration of 100 μM, 30 μL of primer Sr9b-KASP-R at a concentration of 100 μM, and ddH2O to a final volume of 100 μL.

[0036] PCR amplification reaction program: 94℃ heat activation for 15 min; 94℃ denaturation for 20 s, 65-57℃ annealing and extension for 60 s; 10 touch-down cycles, decreasing the temperature by 0.8℃ per cycle; 94℃ denaturation for 20 s, 57℃ annealing and extension for 60 s, 35 cycles.

[0037] Genotyping: Fluorescence signals of PCR amplification products were detected using a FLUOstar Omega microplate reader (BMG Labtech Inc., Cary, NC, USA), and SNPs were detected using Klustercaller software v3.4.1.39 (LGC Biosearch Technologies, Middlesex, UK). Specifically: Genotypes of samples clustered near the Y-axis (showing green) represented alleles with HEX fluorescent linkers; genotypes of samples clustered near the X-axis (showing blue) represented alleles with FAM fluorescent linkers; and samples clustered near the origin (showing black) served as blank controls. In detail, as follows: Using wheat DNA as a template and KASP molecular markers as primers, PCR amplification was performed to obtain PCR amplification products. The fluorescence signals of the amplification products were scanned and genotyped using a quantitative real-time PCR instrument. If the fluorescence signal data of the wheat amplification products appeared green in the obtained genotyping clustering diagram after scanning analysis, the genotype of the wheat at the functional SNP site in Example 1 was considered to be "T", indicating that it contained the stem rust resistance gene. Sr9b If the result is blue in the genotyping clustering diagram, the wheat being tested is considered to have a genotype of "C" at the functional SNP site in Example 1, indicating that it does not contain the stem rust resistance gene. Sr9b .

[0038] This invention uses for... Sr9b-KASP The tag pair contains Sr9b Genes and without Sr9b The genes were genotyped, and the results were as follows: Picture 3 As shown.

[0039] Simultaneously, the above-mentioned wheat materials were inoculated with stem rust fungus at the seedling stage, and rust resistance phenotypes were identified. The results showed that the genotyping results were consistent with the phenotypic identification results of stem rust fungus at the seedling stage, indicating that the KASP molecular marker developed in this invention is accurate and efficient for identifying stem rust resistance. This demonstrates the successful development of the KASP marker and its applicability to accurate, high-throughput detection of breeding materials.

[0040] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A SNP marker associated with resistance to wheat stem rust, wherein the nucleotide sequence of the SNP marker is shown in SEQ ID No. 1, and the 297th base from the 5' end of the sequence shown in SEQ ID No. 1 is a polymorphic site with a base of T or C.

2. The SNP marker according to claim 1, characterized in that, Wheat with the TT genotype at the SNP locus contains the stem rust resistance gene. Sr9b It exhibits resistance to stem rust.

3. The application of the SNP marker of claim 1 in either (1) or (2): (1) Identification or auxiliary identification of stem rust resistance genes in wheat Sr9b ; (2) Select wheat varieties resistant to stem rust.

4. A method for identifying or assisting in the identification of wheat stem rust resistance genes. Sr9b The KASP mark, characterized in that, include: The primers shown in SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No.

4.

5. The application of the KASP mark as described in claim 4 in any one of (1)-(3): (1) Identification or auxiliary identification of wheat stem rust resistance genes Sr9b ; (2) To identify wheat resistance to stem rust; (3) Select and breed wheat varieties resistant to stem rust.

6. A method for identifying or assisting in the identification of wheat resistance to stem rust, characterized in that, Includes the following steps: Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the KASP marker described in claim 4, and the fluorescence signal of the amplification product was detected. If a HEX fluorescence signal was detected, it indicates that the wheat to be tested contains a wheat stem rust resistance gene. Sr9b The phenotype is resistance to stem rust; if FAM fluorescence signal is detected, it means that the wheat sample does not contain the wheat stem rust resistance gene. Sr9b The phenotype is susceptible to stem rust.

7. The method according to claim 6, characterized in that, The PCR reaction system includes: 2 μL DNA template, 1.94 μL 2X PACE™ Mix, and 0.06 μL mixed primers; The mixed primers consist of the primers shown in SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No.

4.

8. The method according to claim 6, characterized in that, The PCR reaction conditions were as follows: 94℃ heat activation for 15 min; 94℃ denaturation for 20 s, annealing and extension at 65-57℃ for 60 s; 10 touch-down cycles, decreasing the temperature by 0.8℃ per cycle; 94℃ denaturation for 20 s, annealing and extension at 57℃ for 60 s, for 35 cycles.