Reagent combination for visually detecting Newcastle disease virus based on RPA-CRISPR / Cas12a as well as kit and application thereof

By using RPA-CRISPR/Cas12a detection technology, combined with crRNA and primer pairs, the Cas12a protein is used to recognize and cleave NDV target DNA, solving the problems of long detection time and low sensitivity in existing NDV detection technologies, and realizing rapid, sensitive and highly specific on-site detection.

CN120989304APending Publication Date: 2025-11-21MINJIANG NORMAL COLLEGE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511098699.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-06
Publication Date
2025-11-21

AI Technical Summary

Technical Problem

Existing NDV detection methods are time-consuming, have low sensitivity, require expensive instruments, and are complex to operate, making it difficult to achieve rapid, portable, sensitive, and highly specific on-site detection.

Method used

The RPA-CRISPR/Cas12a detection technology, combined with crRNA and primer pairs, utilizes the Cas12a protein to recognize and cleave target DNA under the guidance of crRNA, and achieves rapid detection of NDV through fluorescence signal or test strip method.

Benefits of technology

It achieves efficient, sensitive, and highly specific NDV detection within 45 minutes, enabling accurate on-site detection of NDV without the need for laboratory instruments, with a detection limit of 5.96 × 10⁻¹ copies/μL.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120989304A_ABST
    Figure CN120989304A_ABST
Patent Text Reader

Abstract

The invention relates to a reagent combination and a kit for visually detecting a Newcastle disease virus based on RPA-CRISPR / Cas12a. The reagent combination comprises a primer pair and crRNA, the primer pair is any one pair of NDV-RPA-L-F1 / NDV-RPA-L-R1, NDV-RPA-L-F1 / NDV-RPA-L-R2, NDV-RPA-L-F1 / NDV-RPA-L-R3, NDV-RPA-L-F2 / NDV-RPA-L-R1, NDV-RPA-L-F3 / NDV-RPA-L-R3, and NDV-RPA-L-F4 / NDV-RPA-L-R3, and the primer pair is any one pair of NDV-RPA-L-R1, the primer pair is any one pair of NDV-RPA-L-F3 / NDV-RPA-L-R1, the primer pair is any The primer sequence is shown as SEQ ID NO: 1-7, the crRNA is one of crRNA-1 and crRNA-2, the sequence is shown as SEQ ID NO: 8-9, and an RPA-CRISPR / Cas12a detection system established by the reagent combination has extremely high specificity and sensitivity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial detection, specifically relating to reagent combinations, kits and detection methods for the detection of Newcastle disease virus (NDV) RPA-CRISPR / Cas12a. Background Technology

[0002] Newcastle disease (ND) is a highly contagious and fatal disease caused by Newcastle disease virus (NDV), primarily affecting chickens, turkeys, wildfowl, and ornamental birds. NDV belongs to the genus *Orthoavulavirus* within the subfamily Avulaviruses of the family Paramyxoviridae. Its nucleic acid is a single-stranded negative-sense RNA containing six major open reading frames encoding six virus-specific structural proteins (L, NP, P, HN, F, and M) and two non-structural proteins (V and W proteins). NDV is highly pathogenic; clinical necropsy findings in infected chickens primarily show enlarged, hemorrhagic, and necrotic livers and kidneys. The morbidity and mortality rates are both 100%. Currently, this disease remains one of the most significant infectious diseases threatening the sustainable and healthy development of the poultry industry.

[0003] Recombinase polymerase amplification (RPA) technology mainly relies on three enzymes: recombinases that bind to single-stranded nucleic acids, single-strand binding proteins, and strand displacement DNA polymerases. It mimics DNA replication in vivo and can be performed within a temperature range of 37℃-42℃. Due to its mild reaction conditions, high amplification efficiency, and simple equipment, RPA has been widely developed and applied in recent years for the detection of pathogens such as viruses, mycoplasma, chlamydia, bacteria, and parasites, and is suitable for both basic and field detection of pathogens.

[0004] The CRISPR-Cas system originates from the bacterial immune defense system against viral invasion and can cleave target DNA via the Cas protein. CRISPR / Cas12a, as an emerging molecular biology tool, can be used for rapid isothermal detection of pathogens. Researchers have discovered that Cas12a, guided by crRNA, can specifically recognize and cleave dsDNA targets containing PAM sequences. Once its trans-cleavage activity is activated, it can also cleave single-stranded DNA sequences labeled with fluorescent groups that are not the target DNA. The results can be determined based on the generated fluorescence signal.

[0005] Currently, the detection methods of NDV mainly include pathogenic identification, serological test and polymerase chain reaction (PCR) and other related technologies. Among them, the pathogenic identification and serological test are time-consuming and have problems of low sensitivity, need of valuable instruments and difficulty in operation. Therefore, it is necessary to study a rapid, portable, high-sensitivity, high-specificity and simple operation NDV on-site detection method. SUMMARY

[0006] The present application aims at overcoming the deficiencies of the prior art, and provides a CRISPR / Cas12a reagent combination, kit and detection method for NDV on-site detection, which can efficiently, sensitively and specifically detect NDV.

[0007] The object of the present application is achieved by the following technical solutions:

[0008] The present application provides a crRNA for NDV detection, which is any one of crRNA-1 and crRNA-2, the sequence of the crRNA-1 is as follows: 5'-UAAUUUCUACUAAGUGUAGAUUGAGAUGUGCUGCUGUAGAAGAU-3',

[0009] The sequence of the crRNA-2 is as follows: 5'-UAAUUUCUACUAAGUGUAGAUCCAGGGCAUCUACUAAUCGCAGA-3'

[0010] On the other hand, the present application provides a primer set for NDV detection, and the sequence of the primer set is as follows:

[0011]

[0012] Through experiments, the present application finally selects a reagent combination for detecting NDV based on RPA-CRISPR / Cas12a, which includes a primer pair and a crRNA;

[0013] The primer pair is any one of the following six primer pairs: NDV-RPA-L-F1 / NDV-RPA-L-R1, NDV-RPA-L-F1 / NDV-RPA-L-R2, NDV-RPA-L-F1 / NDV-RPA-L-R3, NDV-RPA-L-F2 / NDV-RPA-L-R1, NDV-RPA-L-F3 / NDV-RPA-L-R3 and NDV-RPA-L-F4 / NDV-RPA-L-R3;

[0014] The nucleotide sequences of the primers NDV-RPA-L-F1, NDV-RPA-L-F2, NDV-RPA-L-F3, NDV-RPA-L-F4, NDV-RPA-L-R1, NDV-RPA-L-R2 and NDV-RPA-L-R3 are respectively as follows:

[0015] NDV-RPA-L-F1: 5'-GAACTTGTATTGATGTATGCGGATATGATG-3'; NDV-RPA-L-F2: 5'-ATATAAAACAAGTCCAAAGGCATCTGATT-3'; NDV-RPA-L-F3: 5'-GGACATGGTCAATATAATATCTTCTACAGC-3'; NDV-RPA-L-F4: 5'-CGAGAAAATTGATGATATTCTGCGATTAGT-3'; NDV-RPA-L-R1: 5'-CAGAATATCATCAATTTTCTCGGATAGGTT-3'; NDV-RPA-L-R2: 5'-ATTAATGCTACAACGTCATAGACTTGATTA-3'; NDV-RPA-L-R3: 5'-ATATTATTTGGGAGGAGTTCGATTAAAGTG-3';

[0016] The crRNA is any one of crRNA-1 and crRNA-2, and the nucleotide sequences of the crRNA-1 and crRNA-2 are respectively as follows:

[0017] crRNA-1:

[0018] 5'-UAAUUUCUACUAAGUGUAGAUUGAGAUGUGCUGCUGUAGAAGAU-3'; crRNA-2:

[0019] 5'-UAAUUUCUACUAAGUGUAGAUCCAGGGCAUCUACUAAUCGCAGA-3'.

[0020] Preferably, the reagent combination for detecting NDV based on RPA-CRISPR / Cas12a comprises the primer pair NDV-RPA-L-F1 / NDV-RPA-L-R2 and the crRNA-1.

[0021] The reagent combination for detecting NDV based on RPA-CRISPR / Cas12a further comprises an ssDNA probe, and the nucleotide sequence of the ssDNA probe is 5'-TTTTTTTATTTTTTT-3'.

[0022] The two ends of the ssDNA probe are respectively connected with a fluorescent group, a quenching group, or the two ends of the ssDNA probe are respectively connected with a fluorescent group and biotin; the fluorescent group is 6-FAM, the quenching group is BHQ1, and the biotin is Biotin.

[0023] The 5' end of the ssDNA probe 1 is labeled with 6-FAM and the 3' end is labeled with BHQ1, that is, the ssDNA probe sequence is 5'-FAM-TTTTTTTATTTTTTT-BHQ1-3', which is mainly used in fluorescence method; the 5' end of the ssDNA probe 2 is labeled with 6-FAM and the 3' end is labeled with Biotin, that is, the ssDNA probe sequence is 5'-FAM-TTTTTTTATTTTTTT-Biotin-3', which is mainly used in test strip method.

[0024] An RPA-CRISPR / Cas12a detection kit for detecting NDV, comprising the reagent combination.

[0025] The RPA-CRISPR / Cas12a detection kit further comprises RNA nucleic acid isothermal amplification reagent, crRNA transcription reagent and Cas12a enzyme.

[0026] The RNA nucleic acid isothermal amplification reagent comprises a combination enzyme, and the combination enzyme comprises an RNA reverse transcriptase and an RPA enzyme. The RNA reverse transcriptase and the RPA enzyme are both commercial reagents, which are not described herein.

[0027] The RPA-CRISPR / Cas12a detection kit further comprises an ssDNA probe, and the ssDNA probe is any one of ssDNA probe 1 and ssDNA probe 2, the nucleotide sequence of the ssDNA probe 1 is 5'-FAM-TTTTTTTATTTTTTT-BHQ-3', and the nucleotide sequence of the ssDNA probe 2 is 5'-FAM-TTTTTTTATTTTTTT-Biotin-3'

[0028] The RPA-CRISPR / Cas12a detection kit is used in the detection of NDV for non-diagnostic purposes.

[0029] The application comprises the following steps:

[0030] (1) extracting viral RNA of a sample to be detected as an RPA amplification template;

[0031] (2) adding the template RNA obtained in step (1) into an RPA reaction system and mixing thoroughly, and performing a nucleic acid amplification reaction by using a primer pair; the nucleic acid amplification reaction is a recombinase-mediated isothermal nucleic acid amplification reaction, including an RPA amplification reaction;

[0032] The system and reaction conditions of the RPA amplification reaction are as follows:

[0033] The RPA amplification system: 10 μL of Rehydration Buffer, 1 μL of each of the upper and lower primers in a primer pair with a concentration of 10 μM, 2-5 μL of RNA template with a concentration of 100 ng / uL, supplemented with ddH2O to 18 μL, and finally 2 μL of Starter were added to the RPA reaction tube containing the freeze-dried enzyme powder, so that the total reaction system was 20 μL;

[0034] The RPA reaction conditions: the above RPA reaction system was mixed thoroughly, and was amplified at 37-42°C for 10-30 min.

[0035] Preferably, the RPA reaction conditions are 37-40°C for 10-20 min, and more preferably, the reaction temperature is 39°C and the reaction time is 20-30 min.

[0036] (3) mixing the crRNA, ssDNA probe and Cas12a enzyme with the RPA product obtained in step (2) to perform a Cas12a fluorescence detection reaction; wherein the Cas12a fluorescence detection reaction system is as follows:

[0037] The reaction system contains 2-5 μL of RPA product, 2 μL of reaction buffer, 2 μL of crRNA with a concentration of 1 μM, 2 μL of LbaCas12a with a concentration of 1 μM, and 1.2 μL of ssDNA probe 1 (5'-FAM-TTTTTTTATTTTTTT-BHQ-3') with a concentration of 4 μM, supplemented with ddH2O to 20 μL;

[0038] The Cas12a fluorescence detection reaction conditions are: incubation at 35-40°C for 10-40 min, and fluorescence detection can be photographed under blue light, and the fluorescence signal can be detected by an enzyme marker instrument. Preferably, incubation at 37°C for 20-25 min, and photography under blue light.

[0039] Of course, the RPA product can also be subjected to a Cas12a test strip detection reaction, at which time ssDNA probe 2 (5'-FAM-TTTTTTTATTTTTTT-Biotin-3') is used, and the other components and amounts of the reaction mixture are the same as those of the fluorescence detection method.

[0040] The Cas12a test strip detection reaction conditions are: incubation at 35-40°C for 10-40 min, and test strip detection can be judged according to the detection line. Preferably, incubation at 37°C for 20-25 min.

[0041] Take 10-20 μL of the Cas12a test strip enzyme digestion product, add diluent to 50-100 μL, mix well and drop into the sample well on the test strip, and read the detection result within 5-10 min. The "line showing method" test strip is used for detection. After the crRNA recognizes the RPA product, the LbaCas12a protein is activated and cuts the ssDNA probe to release the signal. Under the premise that there is a band on the quality control line, if a band appears on the detection line, it is determined to be positive; otherwise, it is negative.

[0042] In the present application, RPA is a commonly used isothermal amplification technology. During the amplification process, recombinase, single-strand binding protein and DNA polymerase are used, and nucleic acid rapid amplification is carried out at 39°C. The recombinase of the RPA system is derived from T4 phage. In some examples of the present application, commercially available nucleic acid amplification reagents of the RPA system can be used for reaction.

[0043] In the present application, CRISPR / Cas12a is a new molecular biology tool that can be applied to rapid isothermal detection of pathogens. Researchers have found that Cas12a can specifically recognize and cut dsDNA targets containing PAM sequences under the guidance of crRNA, activate transcleavage activity to cut non-target single-strand DNA carrying a fluorescent group, and determine the results according to the generated fluorescent signal. The main features of this method are high efficiency and speed, simple operation, strong specificity, high sensitivity, and suitability for on-site detection. Using test strip detection method, the results can be determined by directly observing the bands of the test strip with the naked eye. This method is suitable for use at the grassroots level and does not require expensive laboratory equipment for detection.

[0044] Compared with the prior art, the present application has the following advantages: the present application provides a primer pair and crRNA combined RPA-CRISPR / Cas12a detection system, which has extremely high specificity and sensitivity, and can accurately detect NDV on site, and is negative for detection of other common waterfowl viruses; the detection method of the present application uses RPA-CRISPR / Cas12a technology to complete efficient gene amplification and result interpretation within 45 min, and the RPA-CRISPR / Cas12a detection system established by the primer pair NDV-RPA-L-F1 / NDV-RPA-L-R2 and crRNA-1 has a minimum detection limit of 5.96 x 10 -1 copies / μL of NDV DNA, which is short in time, easy to operate, high in sensitivity and simple in result judgment. BRIEF DESCRIPTION OF DRAWINGS

[0045] Figure 1The results of RPA amplification using the primer pairs in Table 2 are as follows: 1, 3, 5, 7, 9, 11 templates are NDV nucleic acids, and the primers correspond to primer pairs 1-6, respectively; 2, 4, 6, 8, 10, 12 templates are ddH2O.

[0046] Figure 2 PAM site map, where PAM 1 is a crRNA-1 recognition site, and PAM 2 is a crRNA-2 recognition site.

[0047] Figure 3 The results of RPA-CRISPR / Cas12a detection system fluorescence detection of different primer combinations and two crRNAs in experimental examples 1-1 to 6-2 are shown in the table. Among them, Figure 3 A is the fluorescence signal detection results of experimental examples 1-1 to 6-2 and the NC group with ddH2O as the template; Figure 3 B is the fluorescence signal detection results of experimental examples 1-1 to 6-2 and the NC group with ddH2O as the template; Figure 3 C is the fluorescence signal value of the corresponding reaction solution of experimental examples 1-1 to 6-2 and the NC group with ddH2O as the template.

[0048] Figure 4 The results of RPA-CRISPR / Cas12a detection system fluorescence detection of different concentrations of crRNA and Cas12a protein are shown in the table. Among them, Figure 4 A is the fluorescence signal detection results of RPA-CRISPR / Cas12a detection system with different concentrations of crRNA and Cas12a protein; Figure 4 B is the fluorescence signal value of the corresponding reaction solution.

[0049] Figure 5 The results of RPA-CRISPR / Cas12a fluorescence detection system sensitivity screening test and the corresponding fluorescence signal value are shown in the table. The template concentration is diluted to 5.96 x 10 5 -5.96 x 10 -1 copies / μL 7 concentration gradients for RPA-CRISPR / Cas12a reaction, detection sensitivity.

[0050] Figure 6 The results of RPA-CRISPR / Cas12a fluorescence detection system specificity detection are shown in the table. NDV, AIV, IBV, ALV, MDV, CIAV, FADV-4 nucleic acids and ddH2O were used as templates for the NC group for RPA-CRISPR / Cas12a reaction, respectively. Figure 6 A is the fluorescence photo, Figure 6 B is the measured corresponding fluorescence signal value.

[0051] Figure 7 Figure for RPA-CRISPR / Cas12a test strip method sensitivity detection results.

[0052] Figure 8 Figure for RPA-CRISPR / Cas12a test strip method specificity detection results. DETAILED DESCRIPTION

[0053] The concept and technical effects of the present application will be described below in conjunction with examples, so as to fully understand the purpose, features and effects of the present application. Obviously, the described examples are only part of the examples of the present application, but not all examples. Based on the examples of the present application, other examples obtained by those skilled in the art without creative labor are within the scope of protection of the present application. Unless otherwise specified, the experimental methods used in the examples are conventional methods; unless otherwise specified, the materials, reagents, etc. used are commercially available reagents and materials.

[0054] The terms "comprise", "include", "contain" are used interchangeably and include not only the closed definition, but also the semi-closed and open definition. In other words, the terms include "consist of", "consist essentially of". The term "crRNA" refers to CRISPR RNA.

[0055] The experimental methods in the following examples without specific conditions are selected according to conventional methods and conditions in the art, or according to the instructions of the product. The reagents and raw materials in the following examples without specific components are commercially available. The quantitative test in the following examples sets up three repeated experiments.

[0056] The present application will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application. The experimental methods in the following examples without specific conditions are generally according to conventional conditions, or according to the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are calculated by weight. Primers and crRNA are synthesized by Shenguo Bioengineering (Shanghai) Co., Ltd. Freeze-dried enzyme powder and RPA amplification reagent are purchased from RPA (RNA) isothermal amplification reagent kit of Shenzhen Yizhi Biological Company.

[0057] Example 1: Determination of RPA primer

[0058] 1.1 Design and synthesis of RPA primer.

[0059] The L gene conservative sequence of NDV was obtained as the target sequence by analyzing the 50 representative NDV whole genome sequences isolated from different countries and regions downloaded from NCBI using MegAlign software, as shown below (5'-3'):

[0060] CTCCATATAAAACAAGTCCAAAGGCATCTGATTGTAGCAGCAAGGACAAGGTCTGCAGTCAACAAGTTAGTAACATTAAGTCATAAGATAGGCCACGTCTTTGTTACTCCTGAGCTTGTCATTGTGACACATACAGATGAGAACAAGTTCACATGCCTCACCCAGGAACTTGTATTGATGTATGCGGATATGATGGAAGGCAGGGACATGGTCAATATAATATCTTCTACAGCAGCACATCTCAGAAACCTATCCGAGAAAATTGATGATATTCTGCGATTAGTAGATGCCCTGGCAAAGGACTTAGGTAATCAAGTCTATGACGTTGTAGCATTAATGGAGGGATTCGCATACGGTGCTGTTCAGCTGCTTGAGCCATCAGGTACATTTGCAGGAGATTTCTTTGCATTTAACCTACAGGAGCTCAAAGACACTTTAATCGAACTCCTCCCAAATAATATAGC

[0061] According to the above sequence, 7 RPA primers were designed and synthesized; 6 primer pairs were combined, namely: NDV-RPA-L-F1 / NDV-RPA-L-R1 (abbreviated as NDV-RPA-L-F1 / R1), NDV-RPA-L-F1 / NDV-RPA-L-R2 (abbreviated as NDV-RPA-L-F1 / R2), NDV-RPA-L-F1 / NDV-RPA-L-R3 (abbreviated as NDV-RPA-L-F1 / R3), NDV-RPA-L-F2 / NDV-RPA-L-R1 (abbreviated as NDV-RPA-L-F2 / R1), NDV-RPA-L-F3 / NDV-RPA-L-R3 (abbreviated as NDV-RPA-L-F3 / R3), and NDV-RPA-L-F4 / NDV-RPA-L-R3 (abbreviated as NDV-RPA-L-F4 / R3).

[0062] The primer sequences are shown in Table 1.

[0063] Table 1 The present application relates to sequences

[0064]

[0065] Table 2 primer pairs

[0066]

[0067] 1.2 RPA primer detection NDV verification.

[0068] NDV nucleic acid samples preserved in the laboratory as a template, while setting a negative control, using the above table 1 RPA primer RPA amplification.

[0069] RPA amplification system as follows: to contain lyophilized enzyme powder RPA reaction tube added Rehydration Buffer 10 μL, primer pairs in the upstream and downstream primer each 1 μL (10 μM), template 2-5 μL (100 ng / ul), supplemented with ddH2O to 18 uL, finally added 2 μL Starter, total reaction system 20 μL.

[0070] RPA reaction conditions: the above RPA reaction system is fully mixed, under the condition of 39℃, amplification 20-30 min.

[0071] Purified amplification products and molecular markers DL 2000 DNA Marker in 3% agarose gel 120V-180V electrophoresis 20-25 min, as Figure 1 shown.

[0072] Electrophoresis results show that NDV-RPA-L-F1 / R1, NDV-RPA-L-F1 / R2, NDV-RPA-L-F1 / R3, NDV-RPA-L-F2 / R1, NDV-RPA-L-F3 / R3, NDV-RPA-L-F4 / R3, six groups of primers can successfully amplify the target fragment.

[0073] Example 2 crRNA design and RPA-CRISPR / Cas12a detection system

[0074] 2.1 crRNA sequence design.

[0075] According to the above six groups of primer pairs and their containing PAM site (TTTV, V is G, A, C) amplification product sequence, designed two crRNA sequences. PAM site as Figure 2 shown.

[0076] crRNA sequence is:

[0077] crRNA-1:

[0078] 5'-UAAUUUCUACUAAGUGUAGAUUGAGAUGUGCUGCUGUAGAAGAU-3' (SEQ ID NO: 8);

[0079] crRNA-2:

[0080] 5'-UAAUUUCUACUAAGUGUAGAUCCAGGGCAUCUACUAAUCGCAGA-3' (SEQ ID NO: 9);

[0081] The 5' end (UAAUUUCUACUAAGUGUAGAU) of the above crRNA can form a hairpin structure recognized by Cas12a, followed by a 23 bp linear target gene sequence, which can recognize the target gene and activate the non-specific cleavage activity of Cas12a to initiate the occurrence of subsequent reactions.

[0082] 2.2 Primer pair matching with crRNA is preferred.

[0083] According to the primer amplification sequence as the target, the corresponding crRNA is selected for Cas12a reaction, and the primer pair and crRNA combination relationship is shown in Table 2.

[0084] Table 3. Primer combination and crRNA detection

[0085]

[0086] The primer pairs and crRNA combinations used in experimental examples 1-1 to 6-2 in Table 3 are listed, and the above different combinations of experimental examples are subjected to RPA-CRISPR / Cas12a detection for preliminary screening and verification.

[0087] Among them, the RPA reaction system and reaction conditions are the same as in Example 1. The RPA product obtained by RPA reaction is mixed with crRNA, ssDNA probe and Cas12a enzyme respectively, and Cas12a fluorescence detection reaction is carried out.

[0088] The Cas12a fluorescence detection reaction system is as follows: 20 μL reaction mixture contains 2-5 μL RPA product, 2 μL Reaction Buffer (10x), 2 μL 1 μM crRNA, 2 μL 1 μM LbaCas12a and 1.2 μL ssDNA probe with a concentration of 4 μM, supplemented with ddH2O to 20 uL, incubated at 37°C for 20-25 min, and photographed under blue light.

[0089] Among them, the ssDNA probe is ssDNA probe 1, and its sequence is 5'-FAM-TTTTTTTATTTTTTT-BHQ1-3'.

[0090] The results are shown in Figure 3 As shown in

[0091] As shown in Figure 3 The combinations of experimental examples 1-1 to 5-1, 2-2, 3-2, 5-2, and 6-2 can all observe obvious fluorescence. Among them, Figure 3 The fluorescence signal value measured by the detection reaction solution of experimental example 2-1 is the highest, indicating that the fluorescence signal of experimental example 2-1 is the strongest.

[0092] In summary, the above results show that the combination of NDV-RPA-L-F1 / R2 and crRNA-1 is the best, which can activate the ssDNA cleavage in the system, release the fluorescence signal and test strip detection signal, and realize the rapid visual detection of NDV.

[0093] Example 4 Optimization of RPA-CRISPR / Cas12a concentration ratio

[0094] In order to realize the rapid detection of RPA-CRISPR / Cas12a detection system, the concentrations of Cas12a and crRNA were optimized based on the above primer screening.

[0095] Add 2-5 μL of template (100 ng / μL) to the RPA reaction system and mix well, use NDV-RPA-L-F1 / R2 primer pair for RPA reaction, and the reaction system and reaction conditions are the same as in Example 1.

[0096] The results are shown in Figure 4 As shown in

[0097] Example 5 Sensitivity detection of RPA-CRISPR / Cas12a fluorescence detection system

[0098] Take the synthesized NDV-L gene recombinant plasmid (5.96 x 10 9 copies / μL) as the template. The template solution was diluted according to a 10-fold concentration gradient, and 5.96 x 10 5 -5.96 x 10 -1 copies / μL 7 concentration gradients.

[0099] 2-5 μL template was added to the RPA reaction system and mixed well, and RPA reaction was performed using NDV-RPA-L-F1 / R2 primer set, and the reaction system and reaction conditions were the same as in Example 1.

[0100] 2-5 μL RPA reaction product was added to the Cas12a fluorescence detection reaction system, 20 μL reaction mixture contained 2-5 μL RPA product, 2 μL Reaction Buffer (10x), 2 μL 1 μM crRNA-1, 2 μL 1 μM LbaCas12a and 1.2 μL ssDNA probe with a concentration of 4 μM, and ddH2O was added to 20 uL, incubated at 37°C for 20-25 min, photographed under blue light and measured the fluorescence signal value. The ssDNA probe 1 was 5'-FAM-TTTTTTTATTTTTTT-BHQ-3'.

[0101] The results are shown in Figure 5 Using the detection system established by NDV-RPA-L-F1 / R2 primer pair and crRNA-1, the template amount of 5.96x10 5 -5.96x10 -1 copies / μL can detect fluorescence signal, thus the minimum detection limit of the system is 5.96x10 -1 copies / μL. The experiment proves that the detection system of NDV-RPA-L-F1 / R2 primer pair and crRNA-1 can realize high sensitivity and visual detection of NDV.

[0102] Example 6 Specificity of RPA-CRISPR / Cas12a fluorescence detection system

[0103] NDV and another six common infectious disease viruses of chickens, avian influenza (AIV), infectious bronchitis virus (IBV), avian leukemia virus (ALV), Marek's disease virus (MDV), chicken infectious anemia virus (CIAV) and avian adenovirus type 4 (FADV-4), DNA or RNA was extracted, each viral nucleic acid template was diluted to 100 ng / μL, and the RPA-CRISPR / Cas12a detection system established by NDV-RPA-L-F1 / R2 primer pair and crRNA-1 was used for amplification detection, blue light photography and fluorescence signal value determination to determine the specificity of the detection method.

[0104] As Figure 6As shown, the preferred primer pair NDV-RPA-L-F1 / R2, crRNA-1 concentration and Cas12a protein concentration were used as the RPA-CRISPR / Cas12a detection system for detection, only NDV showed strong fluorescence and high fluorescence signal value, and other viruses were not detected obvious strong fluorescence and fluorescence signal value, which proved that the detection method had good specificity for NDV detection, and could distinguish NDV and other common waterfowl viruses.

[0105] Example 7 Sensitivity detection of RPA-CRISPR / Cas12a test strip method

[0106] The synthesized NDV-L gene recombinant plasmid (5.96 x 10 9 copies / μL) was used as the template. The template solution was diluted according to 10 times concentration, and 5.96 x 10 5 -5.96 x 10 -1 copies / μL 7 concentration gradients.

[0107] 1 μL of the template was added to the RPA reaction system and mixed thoroughly, and the RPA reaction was carried out using the primer set NDV-RPA-L-F1 / R2, and the reaction system and reaction conditions were the same as in Example 1.

[0108] The Cas12a test strip adopts a chromatographic double antibody sandwich method, which can quickly and specifically detect the signal generated by the Cas protein cutting ssDNA, and the test results can be determined by observing the appearance of the strip. The probe for Cas12a test strip detection reaction is ssDNA probe 2 (5'-FAM-TTTTTTTATTTTTTT-Biotin-3'), and the other components and amounts of the reaction mixture are the same as in Example 5. The amplification products obtained above were detected using the test strip, and the specific detection method was as follows: the product of the Cas12a test strip detection reaction was supplemented with diluent to 50-100 uL, mixed thoroughly, and then dropped into the sample well on the test strip, and the detection results were read within 5-10 min.

[0109] As shown in Figure 7 , the preferred primer pair NDV-RPA-L-F1 / R2, Cas12a protein and crRNA-1 and their concentrations were used as the RPA-CRISPR / Cas12a detection system for detection, and the template amount was 5.96 x 10 5 -5.96 x 10 -1 copies / μL, the band of the quality control line on the test strip could be observed, indicating that the test strip was effective. When the template amount was diluted to 5.96 x 10 -1 copies / μL, the detection line band of the test strip was not "visible", and thus the lowest detection limit of the system was 5.96 x 10 0copies / μL. The test proved that the test strip detection system of the application has good sensitivity and can realize high-sensitivity on-site detection of NDV.

[0110] Example 8 Specific detection of RPA-CRISPR / Cas12a test strip method

[0111] NDV and another six waterfowl viruses, AIV, IBV, ALV, MDV, CIAV and FADV-4 DNA or RNA (reverse transcribed into DNA) were taken, each viral DNA template was diluted to 100 ng / μL, and the RPA-CRISPR / Cas12a test strip detection system established by using NDV-RPA-L-F1 / R2 primer pair and crRNA-1 was used for amplification detection, and the test results were determined by test strip detection to determine the specificity of the detection method.

[0112] As shown in Figure 8 , the preferred primer pair NDV-RPA-L-F1 / R2, Cas12a protein and crRNA-1 and their concentrations were used for detection as the RPA-CRISPR / Cas12a detection system, and no band was observed on the quality control line of the test strip, indicating that the test strip was effective. On the detection line, only the NDV experiment successfully "showed lines", and no obvious bands were observed in the experimental examples of other viruses, proving that the test strip detection method has good specificity and can effectively distinguish NDV from other several common infectious disease viruses of chickens.

[0113] Example 9 Detection of DuCV clinical samples by RPA-CRISPR / Cas12a detection system

[0114] In order to verify the reliability of the NDV-RPA-L-F1 / R2 primer pair and crRNA-1 established RPA-CRISPR / Cas12a test strip method of the application, the RPA-CRISPR / Cas12a test strip method established by the application was used to detect 54 samples of nucleic acid, and the detection results of the RPA-CRISPR / Cas12a test strip method are shown in Table 3. Among the samples detected, 9 were positive and 45 were negative, while 9 were positive and 45 were negative by fluorescence quantitative PCR. The coincidence rate of the two was 100.00%. The comparison of the detection results of CRISPR and fluorescence PCR is shown in Table 4.

[0115] Table 4. Consistency comparison of NDV detection results of CRISPR and fluorescence PCR

[0116]

[0117]

[0118] From the above results, using the preferred primer pair NDV-RPA-L-F1 / R2, Cas12a protein and crRNA-1 and its concentration as the RPA-CRISPR / Cas12a detection system for detection, the high specificity and high sensitivity of the on-site visual detection of NDV can be realized, and strong technical support is provided for the monitoring and disease prevention and control of NDV.

[0119] The embodiments of the application are described in detail above with reference to the drawings, but the application is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the purpose of the application. In addition, the embodiments of the application and the features in the embodiments can be combined with each other without conflict.

Claims

1. A reagent combination for detecting Newcastle disease virus based on RPA-CRISPR / Cas12a, characterized in that: It comprises a primer pair and a crRNA; The primer pair is any one of the following six primer pairs: NDV-RPA-L-F1 / NDV-RPA-L-R1, NDV-RPA-L-F1 / NDV-RPA-L-R2, NDV-RPA-L-F1 / NDV-RPA-L-R3, NDV-RPA-L-F2 / NDV-RPA-L-R1, NDV-RPA-L-F3 / NDV-RPA-L-R3, and NDV-RPA-L-F4 / NDV-RPA-L-R3; The nucleotide sequences of the primers NDV-RPA-L-F1, NDV-RPA-L-F2, NDV-RPA-L-F3, NDV-RPA-L-F4, NDV-RPA-L-R1, NDV-RPA-L-R2, and NDV-RPA-L-R3 are respectively as follows: NDV-RPA-L-F1: 5'-GAACTTGTATTGATGTATGCGGATATGATG-3'; NDV-RPA-L-F2: 5'-ATATAAAACAAGTCCAAAGGCATCTGATT-3'; NDV-RPA-L-F3: 5'-GGACATGGTCAATATAATATCTTCTACAGC-3'; NDV-RPA-L-F4: 5'-CGAGAAAATTGATGATATTCTGCGATTAGT-3'; NDV-RPA-L-R1: 5'-CAGAATATCATCAATTTTCTCGGATAGGTT-3'; NDV-RPA-L-R2: 5'-ATTAATGCTACAACGTCATAGACTTGATTA-3'; NDV-RPA-L-R3: 5'-ATATTATTTGGGAGGAGTTCGATTAAAGTG-3'; The crRNA is any one of crRNA-1 and crRNA-2, wherein the nucleotide sequences of the crRNA-1 and the crRNA-2 are respectively as follows: crRNA-1: 5'-UAAUUUCUACUAAGUGUAGAUUGAGAUGUGCUGCUGUAGAAGAU-3' crRNA-2: 5'-UAAUUUCUACUAAGUGUAGAUCCAGGGCAUCUACUAAUCGCAGA-3'.

2. The reagent combination for detecting Newcastle disease virus based on RPA-CRISPR / Cas12a according to claim 1, characterized in that: It comprises the primer pair NDV-RPA-L-F1 / NDV-RPA-L-R2 and the crRNA-1.

3. The reagent combination for detecting Newcastle disease virus based on RPA-CRISPR / Cas12a according to claim 1 or 2, characterized in that: It further comprises an ssDNA probe, and the nucleotide sequence of the ssDNA probe is 5'-TTTTTTTATTTTTTT-3'.

4. The reagent combination for detecting Newcastle disease virus based on RPA-CRISPR / Cas12a according to claim 3, characterized in that: The two ends of the ssDNA probe are respectively connected with a fluorescent group and a quenching group, or the two ends of the ssDNA probe are respectively connected with a fluorescent group and biotin; the fluorescent group is 6-FAM, the quenching group is BHQ1, and the biotin is Biotin.

5. A RPA-CRISPR / Cas12a detection kit for detecting Newcastle disease virus, characterized in that: It comprises the reagent combination of claim 1.

6. The RPA-CRISPR / Cas12a detection kit of claim 5, wherein: It also comprises an RNA nucleic acid isothermal amplification reagent, a crRNA transcription reagent, and a Cas12a enzyme.

7. The RPA-CRISPR / Cas12a test kit of claim 6, wherein: The RNA nucleic acid isothermal amplification reagent comprises a combination enzyme comprising an RNA reverse transcriptase and an RPA enzyme.

8. The RPA-CRISPR / Cas12a detection kit according to claim 5 or 6, further comprising an ssDNA probe, wherein the ssDNA probe is any one of ssDNA probe 1 and ssDNA probe 2; the nucleotide sequence of the ssDNA probe 1 is 5'-FAM-TTTTTTTATTTTTTT-BHQ-3', and the nucleotide sequence of the ssDNA probe 2 is 5'-FAM-TTTTTTTATTTTTTT-Biotin-3'.

9. Use of the RPA-CRISPR / Cas12a detection kit according to claim 8 in non-diagnostic purpose detection of Newcastle disease virus.

10. Use according to claim 9, characterized in that: The method comprises the following steps: (1) extracting viral RNA of a sample to be detected as an RPA amplification template; (2) adding the template RNA obtained in step (1) into an RPA reaction system and mixing thoroughly, and performing a nucleic acid amplification reaction using a primer pair; the nucleic acid amplification reaction is a recombinase-mediated isothermal nucleic acid amplification reaction, comprising an RPA amplification reaction; The RPA amplification reaction system and reaction conditions are as follows: The RPA amplification system: 10 μL of Rehydration Buffer, 1 μL of each of the upper and lower primers in the primer pair, the concentration of the upper and lower primers being 10 μM, 2-5 μL of RNA template with a concentration of 100 ng / μL, supplemented with ddH2O to 18 μL, and finally 2 μL of Starter, so that the total reaction system is 20 μL; The RPA reaction conditions: mix the above RPA reaction system thoroughly, and amplify at 37-42°C for 10-30 min; (3) mixing crRNA, ssDNA probe, and Cas12a enzyme with the RPA product obtained in step (2) to perform a Cas12a fluorescence detection reaction; the Cas12a fluorescence detection reaction system is as follows: The reaction system comprises 2-5 μL of RPA product, 2 μL of reaction buffer, 2 μL of crRNA with a concentration of 1 μM, 2 μL of LbaCas12a protein with a concentration of 1 μM, and 1.2 μL of ssDNA probe 1 with a concentration of 4 μM, supplemented with ddH2O to 20 μL, and the sequence of the ssDNA probe 1 is 5'-FAM-TTTTTTTATTTTTTT-BHQ-3'; The Cas12a fluorescence detection reaction conditions are as follows: incubate at 35-40°C for 10-40 min, and take a photo under blue light for fluorescence detection, and an enzyme label instrument can be used to detect the fluorescence signal.