VTN protein as senescence marker and application of VTN protein in senescence phenotype improvement
By screening and applying VTN protein as an aging biomarker, the problem of lacking an effective assessment of the aging process in existing technologies has been solved, enabling reliable assessment of the degree of aging and diagnosis of related diseases, and providing a foundation for the research and development of anti-aging products.
Patent Information
- Application Number
- CN202511035458.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-25
- Publication Date
- 2025-11-21
AI Technical Summary
Current technologies lack effective biomarkers for quantitative assessment of the aging process, especially the application of VTN protein in age-related diseases has not been fully explored, making it difficult to support the development of aging assessment and anti-aging products.
Through macroscopic phenotypic feature analysis and in-depth horizontal and vertical data mining, VTN protein was screened as an aging-related molecular biomarker. Its expression level was used to assess the degree of aging, and related products such as kits were developed to detect or regulate VTN protein expression and apply them to human biological samples for diagnosis or auxiliary diagnosis of aging and related diseases.
VTN protein, a reliable molecular biomarker, can significantly reflect the degree of aging. Individual aging can be assessed by detecting or regulating its expression level, and cellular aging can be alleviated. It has broad application prospects in aging assessment and diagnosis of related diseases.
Smart Images

Figure CN120992954A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and particularly relates to VTN protein (Vitronectin) as a marker of aging and its application in improving aging phenotype. BACKGROUND
[0002] Population aging has become a global challenge. Although it is impossible to stop the aging process, by identifying signs of aging early and taking appropriate intervention or treatment measures to delay aging, it helps to reduce the incidence of aging-related diseases, improve the quality of life in the elderly stage, and reduce the burden on families and society. Aging refers to the gradual decline of physiological functions and the degenerative changes in tissue structure of living organisms over time, which is an important inducement for a variety of chronic diseases such as cardiovascular disease, Alzheimer's disease, osteoporosis and cirrhosis. Given the complexity of aging itself and the special case of the lack of a gold standard for judgment, one of the current challenges in the field is to find biomarkers that can quantitatively assess the aging process.
[0003] Proteins, as the main executors of life activities, play a core role in various physiological functions such as cell structure construction, metabolic regulation and signal transmission. Studies have shown that the decline in protein stability is one of the important characteristics of mammalian aging. With age, the synthesis, folding and degradation processes of proteins gradually become unbalanced, leading to the accumulation of misfolded proteins and the reduction of functional proteins, which directly reflects the aging state of the body.
[0004] In recent years, many studies have been devoted to identifying molecular markers associated with aging through proteomics technology. Dunston et al. compared the proteomes of young and old people and found that the expression of iron transport proteins, complement C3b and thyroxine-binding globulin changed significantly. Tang et al. analyzed 7,565 serum samples from a cohort of 3,796 middle-aged and elderly people and identified 86 proteins associated with aging, which were significantly associated with 32 clinical characteristics and 14 aging-related diseases. However, these studies are mostly based on single populations or cross-sectional comparisons, which are difficult to effectively reflect the dynamic changes in the aging process and lack of animal and cell experimental verification. Some published patent inventions also mention some aging-related protein markers, but there is currently no research or patent invention that reports VTN protein as an aging marker, and there is a lack of application exploration of the correlation between VTN protein and aging phenotype. SUMMARY
[0005] The purpose of the present application is to provide an aging-related biomarker and its application in improving aging phenotype, to support aging assessment and anti-aging product development.
[0006] The application explores the molecular characteristics in the aging process by comprehensively analyzing macroscopic phenotype characteristics and deeply mining horizontal and longitudinal data, and further screens and accurately identifies that the VTN protein has significant correlation with the aging process.
[0007] The application provides an application of the VTN protein in a human biological sample as a molecular marker for diagnosing or assisting in diagnosing aging or an aging-related disease.
[0008] The aging-related disease is a cardiovascular disease, Alzheimer's disease, osteoporosis or cirrhosis.
[0009] Further, the expression amount of the VTN protein in the human biological sample is negatively correlated with the aging degree.
[0010] The human biological sample comprises one or more of human plasma, serum and liver tissue samples.
[0011] The expression of the VTN protein has at least one of the following effects: protecting mitochondrial function, improving cell metabolic activity and resisting cell damage, and the expression can relieve cell aging and tissue aging.
[0012] Correspondingly, the application also provides a biomarker for aging evaluation, which contains the VTN protein.
[0013] The application also provides an application of a substance for detecting the expression amount of the VTN protein in preparing any of the following functional products:
[0014] a) diagnosing or assisting in diagnosing aging:
[0015] b) identifying or assisting in identifying aging cells;
[0016] c) screening or assisting in screening young cells;
[0017] d) evaluating or assisting in evaluating individual aging, organ / tissue aging or cell aging.
[0018] Further, the product comprises a kit containing a reagent for detecting the expression amount of the VTN protein in a sample.
[0019] Correspondingly, the application also provides an application of a product for increasing the content or activity of the VTN protein in improving the aging phenotype.
[0020] Further, the product comprises any of the following:
[0021] a) a nucleic acid molecule, a kit, a vector, a cell or a supplement for increasing the expression of the VTN protein;
[0022] b) a nucleic acid molecule, a kit, a vector, a cell or a supplement for interfering with the expression of the VTN protein.
[0023] Accordingly, the present application also provides a kit for diagnosing or assisting in diagnosing aging or aging-related diseases, wherein the kit contains reagents for detecting the expression level of VTN protein in a human biological sample.
[0024] Further, the human biological sample is one or more of human plasma, serum, and liver tissue sample.
[0025] Compared with the prior art, the present application has the following beneficial effects:
[0026] The present application provides VTN protein as a molecular biomarker of aging and its application in improving aging phenotype. The present application first confirms that VTN protein can be used as a reliable molecular biomarker of aging process, and its expression level is significantly negatively correlated with the degree of aging. Experimental data show that during the aging process of human body, the expression of plasma VTN protein is significantly down-regulated; further population and animal model studies find that VTN protein in the liver where VTN comes from is down-regulated with age. Further application of cell experiments, by overexpressing VTN, it is found that VTN can alleviate the changes of related indicators in the process of cell aging; by knocking down VTN, it is found that the process of cell aging presents the characteristics of acceleration. Finally, Mendelian randomization study further verifies the significant association of VTN protein with aging-related diseases. Using this finding, the expression level of VTN protein can be detected to evaluate or assist in the diagnosis of aging and related diseases, and related products for increasing the expression level of VTN protein can be prepared to carry out anti-aging. The application of these VTN protein related detection technologies and the research and development of related products have broad prospects. BRIEF DESCRIPTION OF DRAWINGS
[0027] Figure 1 The related results of RLAS proteomics screening of aging markers are shown.
[0028] Figure 2 The related results of VTN as a molecular biomarker of liver aging are shown.
[0029] Figure 3 The related results of the expression changes of VTN in rat and human liver are shown.
[0030] Figure 4 The related results of the effects of gene knockout and overexpression on cell aging in HepG2 cell line with high expression of VTN are shown.
[0031] Figure 5 The related results of the effects of overexpression on cell aging in L-O2 cell line with low expression of VTN are shown.
[0032] Figure 6 The related results of potential causal association analysis of VTN with aging and related diseases are shown. Detailed Implementation
[0033] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Reagents not specifically described in detail herein are all conventional reagents and are commercially available; methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art.
[0034] The VTN (human) involved in this invention, also known as V75, VN, or VNT, has the following NCBI database IDs: gene ID 7448, nucleotide sequence number NM_000638.4, and protein sequence NP_000629.3. The Vtn (rat), also known as Aa1018 or Vn, has the following NCBI database IDs: gene ID 29169, nucleotide sequence number NM_019156.2, and protein sequence NP_062029.2.
[0035] The present application will be further described below with reference to non-limiting embodiments. Those skilled in the art will understand that although the following embodiments illustrate some implementations of the present application, they are given by way of example only and do not limit the implementation of the present application.
[0036] I. Materials and Methods
[0037] 1. Data sources for the study population
[0038] The data for this study came from the Rugao Longitudinal Aging Study (RLAS), a population-based longitudinal cohort study covering 31 villages in Rugao City, Jiangsu Province. The study recruited 1788 participants aged 70 and older through a baseline survey in November 2014. Follow-up assessments were conducted in May 2017 (three years after baseline), November 2019, and November 2021. During this process, trained nurses and physicians performed thorough physical examinations on participants and collected blood biosamples. The RLAS study was approved by the Ethics Committee of the School of Life Sciences, Fudan University (approval number: BE1815). All participants or their relatives signed informed consent forms, and the study strictly adhered to ethical guidelines. In the final analysis, this study included 41 healthy participants (a total of 164 replicates) who did not have serious chronic diseases such as cardiovascular disease, cancer, dementia (including Alzheimer's disease), or stroke in the four surveys (2014, 2017, 2019, and 2021).
[0039] 2.4D-DIA proteomics
[0040] Four microliters of pre-washed magnetic beads were added to 100 microliters of serum or plasma sample, mixed well and incubated on a magnetic stand for 2 hours. After incubation, the supernatant was discarded and the magnetic beads were retained and subjected to a rigorous washing procedure. To digest the proteins attached to the magnetic beads, a solution digestion procedure was employed. First, the proteins on the magnetic beads were lysed using UA lysis buffer (8 M urea, 150 mM Tris-HCl, pH 8.0) and after the addition of Dithiothreitol (DTT) at a concentration of 20 mM, the sample was incubated at 37 °C for 60 minutes with gentle shaking to reduce disulfide bonds. After incubation, the sample was cooled to room temperature and alkylated with 50 mM Iodoacetamide (IAA) for 30 minutes at room temperature in the dark to alkylate cysteines. Subsequently, the protein sample was diluted with 50 mM Ammonium bicarbonate (NH4HCO3) to reduce the urea concentration to <1.5 M and the supernatant was collected after centrifugation. Next, the sample was digested with Trypsin (enzyme: protein ratio 1 :50) for 16 hours at 37 °C.
[0041] The digested peptides from each sample were desalted using C18 cartridges (Empore TM SPE Cartridges C18, standard density, bed I.D. 7 mm, volume 3 mL, Sigma) and then concentrated by vacuum centrifugation and re-dissolved in 20 microliters of 0.1% (v / v) formic acid solution. To calibrate the peptides in the DIA experiment, iRT (index retention time) marker peptides were added to each sample. The digested peptides from each sample were pooled in equal amounts to make a pool sample (referred to as pool sample) for the generation of a DDA (Data Dependent Acquisition) library and quality control. The pool sample was fractionated using a Thermo Scientific TM Pierce TM High pH reversed phase peptide fractionation kit. Each fractionated sample was desalted using a C18 cartridge and re-dissolved in 20 microliters of 0.1% (v / v) formic acid solution.
[0042] All fractionated samples were analyzed using a TIMS TOF mass spectrometer (Bruker, Germany) coupled to an Evosep One liquid chromatograph (Evosep, Denmark). The mass spectrometer was operated in data-dependent mode with ion kinetic enhanced spectral library generation. The mass spectrometer parameters were set as follows: accumulation and scan times of 100 ms, mass spectrum recording range of m / z 100-1700, positive electrospray mode, dynamic exclusion time of 24.0 seconds. The ion source voltage was set to 1500 V, the temperature was 180 °C, and the dry gas flow was 3 L / min. The ion kinetic scan range was 0.75 to 1.35 Vs / cm2, followed by 8 rounds of PASEF MS / MS scans, with a screening threshold of sample count greater than or equal to 40 to execute the DDA procedure.
[0043] For DIA analysis, the peptides of each sample were analyzed by TIMS TOF mass spectrometer coupled to an Evosep One liquid chromatograph in data independent acquisition (DIA) mode. The mass spectrometer collected ion kinetic mass spectral data with a mass range of m / z 100-1700. Up to 4 windows were defined for each 100 ms TIMS scan according to the m / z-ion kinetic plane. During PASEF MS / MS scans, the collision energy was linearly increased from 20 eV at 1 / K0 = 0.85 Vs / cm2to 59 eV at 1 / K0 = 1.30 Vs / cm2. In the analysis of mass spectral data, for DDA library data, FASTA sequence database searches were performed using Spectronaut™ 16 software (Biognosys). The database was downloaded from http: / / www.uniprot.org and iRT peptide sequences were added (Biognosys | iRT Kit |). The mass spectrometry analysis parameters were as follows: trypsin was used, the maximum number of missed cleavages was 1, the fixed modification was chloromethylation (C), and the dynamic modifications included oxidation (M) and acetylation (protein N-terminus). All reported data were based on a protein identification confidence of 99%, with a FDR (false discovery rate) set to 1%. DIA data were analyzed by Spectronaut™ 16 software, searching the above spectral library. The software parameters were set as follows: the retention time prediction type was dynamic iRT, MS2 level interference correction was enabled, and cross-run normalization was enabled. All results were filtered with a Q-value cutoff of 0.01, which corresponds to FDR < 1%.
[0044] 3. Identifying molecular biomarkers associated with aging
[0045] In proteomic analysis, we adjusted for sex and body mass index (BMI). Proteomic data were log2 transformed and standardized. In cross-sectional analysis, Spearman correlation analysis was applied for feature selection to identify age-associated protein markers. In longitudinal analysis, longitudinal plasma protein data were collected in the same cohort in 2014, 2017, 2019, and 2020; mixed linear effect models were applied to identify significant molecular biomarkers longitudinally associated with aging. Linear mixed effect model analysis was performed using the “blme” package in R software with the Nelder-Mead method. The formula of the mixed effect model is as follows:
[0046] Longitudinal: analyte ~ age + (1 + age | participant) + covariates
[0047] 4. Animals and materials
[0048] Male Sprague-Dawley (SD) rats used in this study were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). These rats were housed in the Experimental Animal Center of the First Affiliated Hospital of Zhejiang University School of Medicine, with a 12-hour light / 12-hour dark cycle and food and water provided ad libitum. Young (12 months) and old (24 months) rats were used in the study to investigate age-related changes. All experiments involving animals were approved by the Animal Ethics Committee of the First Affiliated Hospital of Zhejiang University School of Medicine and strictly followed the guidelines and regulations for the ethical treatment of animals.
[0049] 5. Antibodies and reagents
[0050] A series of antibodies and reagents were used in this study, including: anti-acetyl-p53 (2525), anti-p21 (2947), anti-p16 (18769), and anti-mouse IgG (7076) antibodies, all purchased from Cell Signaling Technology; anti-β-actin (AF5003), anti-VTN (AF1753), and anti-Bax (AF0054) antibodies, purchased from Beyotime; anti-GAPDH (AC033) and anti-rabbit IgG (AS014) antibodies, purchased from ABclonal; anti-Cleaved Caspase-3 (C-CASP3) and anti-p53 (EM20603) antibodies, purchased from HUABIO; anti-Histone H2A.X (Phospho-Ser139) (M63324) antibody, purchased from Abmart. The mitochondrial membrane potential kit (JC-1, C2003), senescence β-galactosidase staining kit (C0602), and reactive oxygen species (ROS) detection kit (S0033) were all purchased from Beyotime; Bleomycin Sulfate (A8331) was purchased from Apexbio. Recombinant lentivirus pCMV-VTN (human)-3xFLAG-Neo and recombinant lentivirus vector pCMV-T7-MCS-3xFLAG-Neo were purchased from MiaoLing Bio; siRNA targeting NC and siRNA targeting VTN were both provided by Qiangke Biotechnology Co., Ltd.
[0051] 6. Enriched pathways between high VTN expression group and low VTN expression group
[0052] To detect the enriched pathways between high-VTN expression group and low-VTN expression group from GSE10143 dataset, gene set variation analysis (GSVA) was performed using “GSVA” R package. The “c2.cp.kegg.V6.2.symbols” file was downloaded from MSigDB database for GSVA analysis. By using “limma” package for analysis, the adjusted P value less than 0.05 indicated that the difference between different subgroups was statistically significant.
[0053] 7. Related results of VTN gene knockdown and overexpression delaying cell senescence
[0054] (1) Cell source and culture conditions
[0055] Human hepatocyte cell lines HepG2 and L-O2 were provided by Professor Zhu Lijun, Medical College of Zhejiang University. HepG2 cells were cultured in high glucose DMEM medium supplemented with 10% fetal bovine serum (FBS, Gibco) and 100 IU / mL penicillin / streptomycin (Beyotime Biotechnology), and L-O2 cells were cultured in RPMI-1640 medium (Gibco) supplemented with 10% fetal bovine serum and 100 IU / mL penicillin / streptomycin. All cells were cultured in a constant temperature incubator at 37°C and 5% CO2, and the culture medium was replaced regularly to maintain cell growth. All cell lines were detected by standard PCR method to be free of mycoplasma contamination. The cell lines were used within 20 generations after thawing, and the continuous culture time was not more than six months. (2) siRNA for silencing human VTN gene
[0056] From the human VTN gene transcript, the "AA" dinucleotide sequence was screened starting from the AUG start codon, and the 3' end 19 bases were recorded as potential siRNA target sites, ensuring that the GC content was 30%-60%, and avoiding the start codon or nonsense region. By BLAST comparison, the sequences homologous to other coding sequences / ESTs were excluded, and finally specific siRNA was synthesized. The siRNA-1 sequence for silencing human VTN gene is: sense strand 5'-3': GGAUGAGUACACGGUCUA; antisense strand 5'-3': AUAGACCGUGUACUCAUCC; the siRNA-2 sequence for silencing human VTN gene is: sense strand 5'-3': GACAAGUACUACCGAGUCA; antisense strand 5'-3': UGACUCGGUAGUACUUGUC.
[0057] (3) VTN gene silenced hepatocyte treatment
[0058] When the cell confluence reached 60-70%, the old culture medium was aspirated and DMEM high glucose base culture medium was added. siRNA transfection was performed using lip8000 transfection reagent according to the instructions, and the process was as follows: an appropriate amount of siRNA was added to lip8000 transfection reagent, and the two were gently mixed and incubated at room temperature for 5 min, then added to the corresponding six-well plate; the transfection reagent was aspirated after 12 h of transfection, and fresh complete culture medium was replaced for continued culture for 24-48 h.
[0059] (4) VTN overexpression treatment of hepatocytes
[0060] The pCMV-VTN (human)-3xFLAG-Neo plasmid was purchased from MBL, and when the confluence of HepG2 cells reached 40%, the old culture medium was removed and replaced with DMEM high-sugar basic culture medium. The VTN overexpression plasmid was transfected using lip8000 transfection reagent according to the instructions, and the two were gently mixed at room temperature for 5 min, then incubated at room temperature for 15 min. Then the plasmid and transfection reagent were co-incubated with HepG2 cells. After 12 hours of transfection, the fresh culture medium was replaced.
[0061] (5) Construction of a liver cell aging model
[0062] When HepG2 and L-O2 cells grew to 20% confluence, the VTN overexpression plasmid or VTN-targeted siRNA was transfected, respectively. After 12 hours of transfection, HepG2 and L-O2 cells were treated with 10 μg / ml and 5 μg / ml of bleomycin (BLM), respectively, for two days. Subsequently, ROS detection, JC-1 experiment, and detection of P53, P21, and P16 protein expression were performed. Then the BLM drug was removed, and the cells were cultured for another day, and finally β-galactosidase (β-Gal) staining was performed to complete the construction of the aging model.
[0063] (6) Construction of a liver cell injury model
[0064] When HepG2 and L-O2 cells grew to 50% confluence, the VTN overexpression plasmid or VTN-targeted siRNA was transfected, respectively. After 12 hours of transfection, HepG2 and L-O2 cells were treated with 100 μg / ml and 50 μg / ml of BLM, respectively, for one day. Subsequently, apoptosis staining and detection of BAX, C-CASP3, and γH2A.X protein expression were performed.
[0065] (7) β-galactosidase (β-gal) staining
[0066] After the liver cells were treated with VTN gene silencing or overexpression, the old culture medium in the 6-well plate was removed, and the cells were washed with PBS twice for 5 min each time. Then the cells were fixed with 4% paraformaldehyde at room temperature for 15 min. After removing the fixing solution, the cells were washed with PBS twice for 5 min each time. Freshly prepared staining working solution (940 μL staining solution A + 10 μL staining solution B + 50 μL X-gal) was added, and the 6-well plate was sealed with sealing film and placed in a 37°C oven for overnight staining. The next day, the staining solution was removed, and PBS was added. The cells were photographed under an inverted microscope, and the proportion of β-gal positive cells was calculated.
[0067] (8) JC-1 staining of liver cells
[0068] After the hepatocytes are treated by VTN gene silencing or overexpression, the old culture medium in the 6-well plate is aspirated, and the cells are rinsed with PBS for 5 min twice. Then, 1 mL of JC-1 staining working solution (diluted with JC-1 staining buffer according to the instructions) is added, and the cells are incubated at 37°C in the dark for 20 min. After the staining solution is aspirated, the cells are rinsed with JC-1 staining buffer for 5 min twice. Then, 2 mL of complete culture medium is added, and the fluorescence microscope or flow cytometry is used for detection immediately. The mitochondrial membrane potential state is evaluated by the change in the ratio of red to green fluorescence.
[0069] (9) Hepatocyte ROS assay
[0070] After the hepatocytes are treated by VTN gene silencing or overexpression, the old culture medium in the 6-well plate is aspirated, and the cells are rinsed with PBS for 5 min twice. Then, DCFH-DA probe diluted with serum-free medium (final concentration 10 μM) is added, and the cells are incubated at 37°C in the dark for 20-30 min. After the probe solution is aspirated, the cells are rinsed with serum-free medium for 5 min twice. Then, complete culture medium is added, and the fluorescence microscope or microplate reader is used for detection (excitation / emission: 488 / 525 nm), and the oxidative stress state of the cells is evaluated by the change in the fluorescence signal.
[0071] 8. Western blot
[0072] First, the cell samples and tissue samples are treated with RIPA lysis buffer, and protease inhibitors Cooktial, PMSF, and phosphatase inhibitors are added. The prepared lysate is centrifuged at 12000g for 15 minutes at 4°C, and the supernatant is collected. Then, the protein content is determined by BCA method, and equal amounts of protein samples are taken for SDS-PAGE separation according to the experimental requirements. The separated proteins are transferred to a PVDF membrane by electroblotting. Next, the PVDF membrane is placed in a 5% skim milk solution and blocked at room temperature for 1 hour. 1xTBS solution containing 3% BSA and 1% sodium azide is used as the antibody diluent, and the primary antibody is diluted at an appropriate ratio. The membrane is incubated with the primary antibody at 4°C overnight. Then, the corresponding secondary antibody is diluted at a ratio of 1:10000 using the same diluent, and the membrane is incubated with the secondary antibody at room temperature for 1 to 2 hours. Finally, the chemiluminescence detection system is used for development analysis. The experimental data are quantitatively analyzed by Image J software for the gray value of the target protein band, and the data visualization processing is performed by GraphPad Prism 8.0 software.
[0073] 9. Source and treatment of liver tissue sections
[0074] Liver tissue sections were derived from patients diagnosed with hepatic hemangioma, which were provided by the Second Affiliated Hospital of Zhejiang University. All experiments were approved by the Ethics Committee of the Second Affiliated Hospital of Zhejiang University Medical College. Immunohistochemical staining of liver tissue sections was completed by AiFang Biotechnology Company.
[0075] 10. qRT-PCR
[0076] Firstly, total RNA was extracted from cell or tissue samples, and the concentration and purity of the extracted RNA were detected using a Nanpdorp device. Subsequently, cDNA synthesis was performed using the All-in-one Reverse Transcription Kit produced by NuCyton Biosciences, and the reaction system was configured as follows: 0.5 μL enzyme mixture, 2 μL 5x All-in-one qRT SuperMix, 2 μL RNA solution (500 ng / μL), and 5.5 μL DEPC-treated water, with a final reaction volume of 10 μL. The reverse transcription process was completed in a thermal cycler, and the temperature program was set as follows: 50°C for 15 minutes, 85°C for 5 minutes, and finally 4°C for 5 minutes. For real-time fluorescence quantitative PCR (qRT-PCR) detection, the SYBR Green Master MIX reagent produced by NuCyton Biosciences was used, and the reaction system was prepared according to the product instructions, which included: 5 μL 2x SYBR Green Master MIX, 0.5 μL forward primer, 0.5 μL reverse primer, 2 μL cDNA template, and 2 μL DEPC-treated water. 2 μL of cDNA solution was added to the corresponding well of a 384-well plate, and the remaining reaction components were mixed and added to each well. A special transparent sealing film was used to seal the reaction plate, which was then centrifuged at 3000 rpm for 1 minute. The reaction plate was placed in a real-time fluorescence quantitative PCR instrument and run according to the preset program: initial 95°C pre-denaturation for 5 minutes; followed by 35 cycles of amplification reaction, each cycle including 95°C denaturation for 10 seconds, 95°C annealing for 10 seconds, and 72°C extension for 10 seconds; finally 72°C extension for 5 minutes and collection of melting curve data. After the experimental data was exported from the instrument, the 2 -△△CtThe expression level of the target gene relative to the internal reference gene was calculated. Data visualization was performed using GraphPad Prism 8.0 software. The PCR primer sequence information involved in this method is: The primers used for rat Vtn are (forward: CAATCCGAGAACACCTCTCT; reverse: CCCTGACAGTTGATGCGAGT); the primers for Actb are (forward: GATATCGCTGCGCTCGTCG; reverse: TCCGGAGTCCATCACAATGC); the primers used for mouse Vtn are (forward: CAACCCGAGAACACCTCTCC; reverse: CCCTGACAGTTGATGCGAGT); the primers for Actb are (forward: GATATCGCTGCGCTGGTCG; reverse: TCCGGAGTCCATCACAATGC); the primers used for human VTN are (forward: TCCCTGCCCATAGCTACAGT; reverse: CACAAGCCAGTCCATCCTGT); the primers for ACTB are (forward: CTCCATCCTGGCCTCGCTGT; reverse: GCTGTCACCTTCACCGTTCC).
[0077] 11. Flow cytometry
[0078] First, the sample was prepared into a single cell suspension. For surface antigen detection, the cells were directly incubated with fluorescently conjugated antibodies; during the staining process, pre-cooled DMEM (2% BSA or 2% FBS can be added) was used to wash the cells to remove unbound antibodies and impurities, reduce non-specific binding and background interference. After staining was completed, the cells were resuspended in PBS, filtered through a filter screen, and then detected on the machine. The cells were excited by the laser of the flow cytometer to generate fluorescent signals, and the detector captured the signals and generated FCS format data files containing multiple parameter information such as the fluorescence intensity of each cell. FlowJo software was used to analyze the data, calculate the percentage of positive cells and the mean fluorescence intensity, and evaluate the characteristics and distribution of the cells.
[0079] 12. Mendelian randomization analysis of two samples
[0080] Summary statistics for genetic associations on circulating protein levels were from a genome-wide association study (GWAS) of plasma quantitative traits (pQTL) conducted by Ferkingstad et al. that included 35,559 Icelanders (Ferkingstad et al. Nat Genet 2021). Full results data on outcomes can be found at https: / / gwas.mrcieu.ac.uk / , DNA methylation GrimAge acceleration (ebi-a-GCST9001430), intrinsic epigenetic age acceleration (ebi-a-GCST90014302), and DNA methylation Hannum age acceleration (ebi-a-GCST90014301) data were derived from the literature (McCartney et al. Genome Biol 2021). Cirrhosis (ebi-a-GCST90018826) was derived from the literature (Sakaue et al. Nat Genet 2021), and 2,803 disease outcomes were derived from the R5 release of the FinnGen cohort (https: / / r5.risteys.finngen.fi / ).
[0081] Exposures and outcomes were derived from different datasets, meeting the requirements for two-sample Mendelian randomization analysis. The criteria for selecting instrumental variables and proteins were as follows: (i) selecting SNPs associated with proteins (P < 5 x 10 -8 ); (ii) excluding SNPs located within the major histocompatibility complex (MHC) region (chr6:25.5-34.0 Mb) because of the complex linkage disequilibrium (LD) structure in this region; (iii) then performing LD clustering analysis to identify independent pQTLs for proteins (r 2 <0.001); (iv) using R 2 and F statistics (R 2 = 2 x EAF x (1-EAF) x beta 2 ; F = R 2 x (N-2) / (1-R 2 )) to estimate the strength of genetic instruments, further filtering out instrumental variables with F statistics greater than 10. MR analysis was performed using the “TwoSampleMR” package.
[0082] 13. External data validation
[0083] External validation data were from the Zhejiang Aging Healthy Longitudinal Study (JASHA) (Wang et al. BMC Psychiatry 2024). Data supporting the results of this study were not publicly available due to sensitivity reasons and were accessible upon reasonable request.
[0084] II. Results analysis
[0085] 1. VTN as a molecular marker of aging
[0086] The RLAS data of this example is shown in Figure 1 A. This example identified 105 proteins significantly associated with age (P<0.05) by Spearman correlation analysis, and further applied mixed linear effect model to find 38 proteins longitudinally associated with age (FDR<0.05). Combining the results of the two models, we identified a reported biomarker of aging, APOE, and its expression increased significantly with age. In addition, this example also found a new aging marker, VTN, which showed strong correlation with age in both cross-sectional and longitudinal data Figure 1 B-C); and the validation results in JASHA dataset were also consistent (R=0.28, P=0.014) Figure 1 D).
[0087] According to the GEO database, the RNA of VTN is highly expressed specifically in the liver Figure 2 A). Further analysis by single-cell analysis found that VTN had the highest expression level in hepatocytes Figure 2 B). Further analysis of the GSE76427 dataset found that the expression of VTN in liver tissue decreased with age Figure 2 C). Combined with macrophenotype analysis, we found that the increase of VTN expression was closely related to the improvement of liver and kidney function, manifested as the increase of albumin (ALB) level, and the decrease of alanine aminotransferase (ALT) and creatinine (Crea) levels Figure 2 D).
[0088] The examination results of liver tissue of rats at different ages showed that the mRNA and protein expression levels of VTN gradually decreased from 12 months to 24 months Figure 3 A-B). In human liver tissue sections, the expression of VTN protein at 73 years old was significantly lower than that at 55 years old Figure 3 C). The above results showed that VTN not only can be used as a specific molecular biomarker of aging, but also can be a key target for delaying liver aging.
[0089] 2. Protective effect of VTN on mitochondria of hepatocytes and its role in delaying hepatocyte aging
[0090] By pathway enrichment analysis of 225 liver cancer adjacent transcriptome datasets, we found that the high expression of VTN was significantly enriched in metabolic pathways (such as glycolysis, gluconeogenesis and citric acid cycle pathways), on the contrary, the enrichment in inflammatory pathways was lowerFigure 4 A) Based on the high expression level of VTN in liver cells, we first selected the HepG2 cell line with high expression of VTN for subsequent mechanism study. VTN overexpression and knockdown models were constructed in HepG2 cells. The results showed that high concentration of BLM could induce programmed cell death, and VTN overexpression could significantly reduce BLM-induced programmed cell death, while VTN knockdown enhanced BLM-induced programmed cell death Figure 4 B) In addition, mitochondrial dysfunction is considered an important marker of aging and metabolic dysfunction. In subsequent experiments, we detected indicators related to mitochondrial function. The results showed that under BLM stimulation, VTN overexpression could restore the stability of JC-1 multimers and reduce ROS activity, while VTN knockdown led to more JC-1 multimers converting to JC-1 monomers, further increasing ROS activity Figure 4 C-D) ROS increase caused by oxidative stress is an important inducer of cell aging. Further analysis found that under BLM stimulation, the number of β-gal staining positive cells in the VTN knockdown cell line increased significantly Figure 4 E), the levels of aging markers P21 and P16 increased significantly Figure 4 G) Western blot analysis showed that under BLM stimulation, VTN knockdown led to a significant increase in the expression of damage-related indicators such as γH2A.X, BAX and C-CASP3 Figure 4 F).
[0091] To further clarify the role of VTN in liver cells, this embodiment constructed a VTN overexpression model in the L-O2 cell line, which has lower expression of VTN. The results showed that under BLM stimulation, overexpression of VTN in L-O2 cells significantly reduced the number of JC-1 monomers, indicating that the integrity of the mitochondrial membrane was restored Figure 5 A) After detecting ROS activity, it was found that VTN overexpression could reduce the increase in ROS activity induced by BLM Figure 5 B) and significantly reduced the number of BLM-induced β-gal staining positive cells Figure 5 C) In addition, VTN overexpression could reduce the expression of damage marker C-CASP3 and aging marker P16 induced by BLM Figure 5 D-E).
[0092] The above results show that VTN gene knockdown promotes liver cell aging, and increasing the expression of VTN may be an effective strategy to delay or reverse liver aging.
[0093] 3. Causal relationship analysis of VTN with aging phenotype and disease
[0094] To further validate the potential association between VTN and aging, this study used VTN genome-wide association study data from Iceland as the exposure variable, and four DNA methylation age acceleration indicators (indicators reflecting the degree of aging), cirrhosis (a common disease of liver aging), and a dataset of 2083 diseases from Finland as the outcome variable, performing a two-sample Mendelian randomization (MR) analysis. This method allows for the examination of the potential causal role of VTN protein in these diseases while excluding the influence of confounding factors. During the analysis, a significant negative causal association was found between VTN and two of the four DNA methylation age acceleration indicators (GrimAge acceleration and Hannum age acceleration) (P<0.05, beta<0). Furthermore, a significant negative causal association was also found between VTN and cirrhosis. Statistical results showed that the p-value for IVW was less than 0.05, and the odds ratio (OR = 0.93) indicated that decreased VTN levels may be closely related to the occurrence of cirrhosis. Figure 6 A). This result provides strong genetic evidence for VTN protein as a potential protective factor against cirrhosis, suggesting that VTN may participate in the development of cirrhosis by maintaining hepatocyte homeostasis or inhibiting excessive fibrosis. Two-sample Mendelian randomization analysis revealed a negative causal association between VTN and 101 of 2083 disease outcomes in Finland (P<0.05, beta<0), including common age-related diseases such as hypertension, nephrotic syndrome, and osteoporosis. Figure 6 B). The analysis in this embodiment supports the causal role of VTN in the aging phenotype and liver function, and provides a basis for its use as a potential biomarker for early warning of a range of age-related diseases.
[0095] The above description is merely a preferred embodiment of this application, but the scope of protection of this application is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in this application should be included within the scope of protection of this application.
Claims
1. Application of VTN protein in human biological samples as a molecular marker for the diagnosis or auxiliary diagnosis of aging or aging-related diseases.
2. The application according to claim 1, characterized in that, The age-related diseases mentioned refer to cardiovascular disease, Alzheimer's disease, osteoporosis, or cirrhosis.
3. The application according to claim 1, characterized in that, The expression level of VTN protein in human biological samples is negatively correlated with the degree of aging.
4. The application according to claim 3, characterized in that, Human biological samples include one or more of the following: plasma, serum, and liver tissue samples.
5. The application of substances used to detect VTN protein expression levels in the preparation of products with any of the following functions: a) Diagnostic or auxiliary diagnostic features of aging: b) Identify or assist in the identification of senescent cells; c) Screening or assisting in the screening of young cells; d) Assess or assist in assessing individual aging, organ / tissue aging, or cellular aging.
6. The application according to claim 5, characterized in that, The product includes a kit containing reagents for detecting the expression level of VTN protein in a sample.
7. Application of products that increase VTN protein content or activity in improving aging phenotypes.
8. The application according to claim 7, characterized in that, The product includes any one of the following: a) Nucleic acid molecules, kits, vectors, cells, or supplements used to increase VTN protein expression; b) Nucleic acid molecules, kits, vectors, cells, or supplements that interfere with VTN protein expression.
9. A reagent kit for diagnosing or assisting in the diagnosis of aging or aging-related diseases, characterized in that, The kit contains reagents for detecting VTN protein expression levels.