Regulator for improving bacterial wilt resistance of plants and application thereof

Abstract

The invention belongs to the technical field of plant disease control, and particularly relates to a regulator for improving bacterial wilt resistance of plants and application of the regulator. By comparing rhizosphere metabolites of a disease-resistant peanut variety and a susceptible peanut variety under the conditions of being infected by peanut bacterial wilt and not infected by peanut bacterial wilt respectively, 44 rhizosphere metabolites which are significantly differently enriched in rhizosphere of the disease-resistant peanut variety are identified. Wherein the four rhizosphere metabolism active substances including tetracycline, salicylic acid, betaine and estradiol and a compound regulator compounded by the four rhizosphere metabolism active substances have a remarkable bacteriostatic effect on ralstonia solanacearum causing bacterial wilt, and the disease resistance of plants to the bacterial wilt is improved. Meanwhile, the regulator is low in cost, good in effect and free of pollution, has extremely high popularization and application potential in the aspect of improving the disease resistance of crops, and has important significance on efficient prevention and treatment of plant soil-borne diseases, especially bacterial wilt.

Description

Technical Field

[0001] This invention belongs to the field of plant disease control technology, specifically relating to a regulator that improves the resistance of plants to bacterial wilt and its application. Background Technology

[0002] Peanuts (Arachis hypogaea L.) are an important economic and oilseed crop, a vital source of edible vegetable oil and protein, and play a crucial role in edible vegetable oil consumption and the snack food industry. However, peanuts are frequently susceptible to various plant diseases during cultivation. Among them, peanut bacterial wilt caused by Ralstonia solanacearum is one of the most damaging soil-borne bacterial diseases affecting peanut production. As one of the plant pathogens with the widest host range, Ralstonia solanacearum is listed among the top ten plant pathogens globally, capable of infecting more than 200 crops, including peanuts, tomatoes, potatoes, and tobacco. Ralstonia solanacearum primarily invades plants through the root system and colonizes the vascular bundles, hindering water and nutrient transport, ultimately causing plant wilting and death, leading to yield reductions of over 50% or even total crop failure. Currently, the main methods for controlling peanut soil-borne diseases include chemical control, agricultural control, and biological control. Because *Ralstonia solanacearum* hides deep in the soil when not infecting plants and penetrates the xylem when it does, traditional chemical agents are less effective at directly controlling *Ralstonia solanacearum*. Furthermore, traditional chemical agents have problems such as environmental residues, the development of drug resistance in pathogens, and severe damage to the soil microecological environment, thus limiting their application. While biological control is environmentally friendly, it is greatly affected by environmental factors and its effectiveness is unstable. Therefore, developing a novel formulation that can effectively control crop diseases, enhance crop immunity, and is environmentally friendly is of great significance.

[0003] Rhizosphere metabolites are the various organic metabolites continuously released into the rhizosphere soil by plant roots and their rhizosphere microorganisms during their interactions. These metabolites mainly include organic acids, sugars, amino acids, enzymes, hormones, and secondary metabolites. Rhizosphere metabolites act as a bridge in the interaction between plants, soil, and pathogenic microorganisms, and play an important role in the occurrence and mitigation of soil-borne diseases. For example, 2,6-diisopropylphenol and dibutyl phthalate in garlic rhizosphere metabolites exhibit significant antibacterial activity against tobacco root rot pathogens; octadecanoic acid in the rhizosphere metabolites of disease-resistant watermelon varieties can slow the growth and reproduction of soil-borne pathogens; and when maize is invaded by soil-borne pathogens, compounds induced by chlorogenic acid and jasmonic acid in its rhizosphere metabolites can enhance maize's disease resistance. Among common plant rhizosphere metabolites, salicylic acid, as a plant hormone, can induce systemic acquired resistance in plants when they are infected by pathogens; tetracycline is a broad-spectrum antibiotic with significant inhibitory effects on various bacteria, including Ralstonia solanacearum; estradiol, as a flavonoid metabolite derivative, can enhance plants' ability to scavenge reactive oxygen species, thereby improving their resistance to stress and diseases; betaine can enhance plants' basic defense responses and resistance to various diseases, including soil-borne diseases, by improving their physiological state. Simultaneously, rhizosphere metabolites can directly affect soil microbial community diversity and its ecological functions. The higher the diversity of rhizosphere soil microorganisms, the more difficult it is for pathogens to invade. Beneficial microorganisms in the rhizosphere soil can inhibit the occurrence of bacterial wilt through various mechanisms, including competing for nutrients, producing antimicrobial substances, and inducing plant resistance. For example, eggplants secrete myristic and palmitic acids through their roots, recruiting large numbers of antagonistic bacteria to Verticillium wilt, thus significantly reducing the incidence of Verticillium wilt. Similarly, corn roots can secrete benzoxazinone compounds to recruit beneficial bacteria such as *Pseudomonas putida*, effectively preventing soil-borne diseases. Disease-resistant varieties may also recruit beneficial microorganisms (such as nitrogen-fixing bacteria, actinomycetes, and Bacillus) by secreting specific metabolites (such as organic acids and antibiotics), thereby inhibiting pathogen growth and activating the host's immune response. Therefore, utilizing rhizosphere metabolites to recruit beneficial bacteria is a method to improve plant disease resistance. Thus, studying the rhizosphere microecological regulation mechanism of peanut resistance to bacterial wilt, especially the synergistic relationship between microbial community structure, key metabolites, and disease-resistant genes, holds promise for developing compound regulators to enhance peanut resistance to bacterial wilt, which is of great significance for the efficient control of peanut bacterial wilt. Summary of the Invention

[0004] To overcome the shortcomings of the prior art, this invention proposes a regulator that can improve the resistance of plants to bacterial wilt. The regulator is any one of tetracycline, salicylic acid, betaine and estradiol, or a compound regulator composed of the above four active substances. This type of regulator is suitable for controlling soil-borne diseases of crops such as peanuts, especially bacterial wilt (bacterial wilt), and is therefore a highly efficient and environmentally friendly biological control agent.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] The first aspect of the present invention provides a regulator for improving the resistance of plants to bacterial wilt, the regulator comprising at least one of betaine, estradiol, salicylic acid and tetracycline.

[0007] Preferably, the regulator is composed of betaine, estradiol, salicylic acid and tetracycline (named prebiotic BEST).

[0008] This invention identified 44 rhizosphere metabolites that were significantly enriched in the rhizosphere of resistant and susceptible peanut varieties under conditions of bacterial wilt infection and those not infected with peanut bacterial wilt, respectively. Based on this, four inexpensive and commonly available rhizosphere metabolites (including salicylic acid, betaine, tetracycline, and estradiol) were selected for plate inhibition experiments. The results showed that tetracycline, salicylic acid, betaine, and estradiol all significantly inhibited the growth of *Ralstonia solanacearum*, with inhibition rates of 23.5%, 74.5%, 82.6%, and 100%, respectively. To further improve the control effect against peanut bacterial wilt, the above four bioactive substances were compounded to form the prebiotic BEST. Plate inhibition experiments showed that this compound achieved a 100% inhibition efficiency against *Ralstonia solanacearum*. Experiments involving root application in hydroponics and foliar spraying in pots of peanuts showed that these four rhizosphere metabolically active substances (tetracycline, salicylic acid, betaine, and estradiol) and the prebiotic BEST, a compound of these active substances, could significantly reduce the incidence and disease index of susceptible peanut varieties infected with Ralstonia solanacearum. 16S rRNA sequencing of rhizosphere bacterial diversity indicated that application of the compound of these active substances (i.e., prebiotic BEST) significantly increased the microbial diversity of peanut roots in both Ralstonia solanacearum-inoculated and uninoculated plants, and significantly reduced the abundance of Ralstonia solanacearum and significantly increased the abundance of beneficial bacteria in the rhizosphere of inoculated peanuts. Gene expression analysis showed that application of prebiotic BEST significantly promoted the expression of genes related to systemic acquired resistance in peanut roots, indicating that the prebiotic BEST can enhance peanut resistance to Ralstonia solanacearum by inhibiting pathogens, recruiting beneficial bacteria, and activating the host immune response.

[0009] Preferably, the betaine is a natural extract with a purity ≥98%; the estradiol is β-estradiol with a purity ≥99%; the salicylic acid is a white crystalline powder with a purity ≥99%; and the tetracycline has a purity ≥95%.

[0010] Preferably, the effective concentration of betaine is not less than 10 mM, the effective concentration of estradiol is not less than 50 ng / mL, the effective concentration of salicylic acid is not less than 0.5 mM, and the effective concentration of tetracycline is not less than 15 μg / mL.

[0011] The second aspect of the present invention provides the application of the regulator described in the first aspect in improving the resistance of plants to bacterial wilt, wherein the plants include dicotyledonous plants or monocotyledonous plants.

[0012] Research has found that the regulators described in the first aspect can enhance peanut resistance to bacterial wilt by inhibiting pathogens, recruiting beneficial bacteria, and activating the host's immune response. This overcomes the shortcomings of traditional chemical agents in controlling bacterial wilt, such as poor efficacy, environmental residues, pathogen resistance, damage to soil microecology, and unstable effects.

[0013] Preferably, the plants include peanuts, soybeans, tomatoes, tobacco, cucumbers, potatoes, peppers, alfalfa, clover, and peas.

[0014] Preferably, the pathogen causing bacterial wilt is Ralstonia solanacearum (Solanaceae).

[0015] The third aspect of this invention provides a method for improving the resistance of plants to bacterial wilt, specifically including: mixing and soaking plant seeds with the regulator described in the first aspect before sowing; or applying the regulator described in the first aspect to the roots of the plant during the seedling stage; or applying the regulator described in the first aspect to the leaves of the plant at each growth stage.

[0016] Compared with the prior art, the beneficial effects of the present invention are:

[0017] This invention identified 44 rhizosphere metabolites that were significantly enriched in the rhizosphere of resistant and susceptible peanut varieties under conditions of bacterial wilt infection and those not infected with peanut bacterial wilt, respectively. Among them, tetracycline, salicylic acid, betaine, and estradiol, four rhizosphere metabolically active substances, significantly inhibited the growth of *Ralstonia solanacearum*. Furthermore, a compound preparation of these four bioactive substances (referred to as prebiotic BEST) significantly enhanced the inhibitory effect on *Ralstonia solanacearum*, achieving an inhibition efficiency of up to 100%. Moreover, these four rhizosphere metabolically active substances (tetracycline, salicylic acid, betaine, and estradiol) and the aforementioned prebiotic BEST all significantly reduced the incidence and disease index of susceptible peanut varieties infected with *Ralstonia solanacearum*. Furthermore, the application of the prebiotic BEST significantly increased the bacterial microbial diversity in peanut roots in both inoculated and uninoculated peanuts with Ralstonia solanacearum (RSS), and significantly reduced the abundance of RSS and increased the abundance of beneficial bacteria in the rhizosphere of inoculated peanuts. Moreover, the application of prebiotic BEST significantly promoted the expression of genes related to systemic acquired resistance in peanut roots, indicating that this compound agent can effectively control diseases, enhance crop immunity, and is environmentally friendly. It is of great significance for the efficient control of soil-borne plant diseases, especially bacterial wilt.

[0018] Specifically, the present invention has the following advantages:

[0019] (1) Through rhizosphere metabolomics analysis, core metabolite screening, plate antibacterial experiment, hydroponic root application and pot spraying experiment, rhizosphere bacterial diversity 16S rRNA sequencing and real-time fluorescence quantitative experiment, this invention found that four rhizosphere metabolic active substances (tetracycline, salicylic acid, betaine and estradiol) and their compound preparation BEST can significantly inhibit the growth of Ralstonia solanacearum and promote peanut resistance to Ralstonia solanacearum.

[0020] (2) These four rhizosphere metabolic active substances (tetracycline, salicylic acid, betaine and estradiol) and their compound preparation BEST are low in cost, effective and pollution-free, and have great potential for promotion and application in improving crop disease resistance.

[0021] (3) The active substance compound agent BEST provided by the present invention can enhance the resistance of peanuts to bacterial wilt by inhibiting pathogens, recruiting beneficial bacteria and activating the host immune response. It overcomes the shortcomings of traditional chemical agents in controlling bacterial wilt, such as poor effect, environmental residue, pathogen resistance, damage to soil microecology and unstable effect.

[0022] (4) The compound prebiotic BEST provided by the present invention can directly inhibit the growth and reproduction of Ralstonia solanacearum, and can be used to prevent and control Ralstonia solanacearum in crops such as peanuts, soybeans, tomatoes, tobacco, cucumbers, potatoes, peppers, alfalfa, clover, and peas. Attached Figure Description

[0023] Figure 1 Analysis of rhizosphere soil metabolites in peanut varieties infected and uninfected with Ralstonia solanacearum;

[0024] Figure 2 Plate antibacterial experiment of BEST prebiotic compound, a rhizosphere metabolic active substance and its compound preparation.

[0025] Figure 3 Experiments on root application and pot spraying of peanut hydroponically grown plants to detect rhizosphere metabolic active substances;

[0026] Figure 4 Statistics on the disease index of peanut hydroponic root application and pot spraying for rhizosphere metabolic active substances;

[0027] Figure 5 Experiments on root application and pot spraying of peanut hydroponically grown prebiotics (Best);

[0028] Figure 6 The effects of prebiotic BEST on rhizosphere bacterial diversity and expression of disease resistance-related genes in peanuts infected with Ralstonia solanacearum. Detailed Implementation

[0029] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0030] Unless otherwise specified, all instruments and reagents used in the following examples are conventional equipment in the field, and all reagents are commercially available analytical grade products. Unless otherwise specified, all detection methods used are standard methods in the field. Primer synthesis and sequencing were performed by Sangon Biotech (Shanghai) Co., Ltd. (hereinafter referred to as "Sangon").

[0031] This invention identified 44 rhizosphere metabolites that were significantly enriched in the rhizosphere of resistant and susceptible peanut varieties under conditions of bacterial wilt infection and those not infected with bacterial wilt, respectively. Among them, four rhizosphere metabolically active substances—15 μg / mL tetracycline, 0.5 mM salicylic acid, 10 mM betaine, and 50 ng / mL estradiol—significantly inhibited the growth of Ralstonia solanacearum. When these four bioactive substances were combined to form the compound preparation "Prebiotic BEST," the inhibition efficiency against Ralstonia solanacearum reached 100%. These four rhizosphere metabolically active substances (i.e., 15 μg / mL tetracycline, 0.5 mM salicylic acid, 10 mM betaine, and 50 ng / mL estradiol) and the aforementioned prebiotic BEST significantly reduced the incidence and disease index of susceptible peanut varieties infected with Ralstonia solanacearum. Analysis of rhizosphere bacterial diversity using 16S rRNA sequencing showed that application of the prebiotic BEST significantly enhanced the bacterial microbial diversity of peanut roots in both inoculated and uninoculated plants with Ralstonia solanacearum (RSS). Simultaneously, in the RSS-inoculated peanut rhizosphere, the abundance of RSS significantly decreased, while the abundance of beneficial bacteria significantly increased. Gene expression analysis indicated that application of the prebiotic BEST significantly promoted the expression of genes related to systemic acquired resistance in peanut roots. Therefore, this compound formulation effectively controls Ralstonia solanacearum, enhances crop immunity, and is environmentally friendly, making it significant for the efficient control of soil-borne plant diseases, especially Ralstonia solanacearum.

[0032] To fully and clearly present the technical solution and significant advantages of the present invention, the present invention will be described in detail below with reference to specific embodiments.

[0033] Example 1: Analysis of rhizosphere metabolites of peanuts infected with Ralstonia solanacearum

[0034] (1) Peanut rhizosphere soil collection

[0035] Seeds of the highly resistant bacterial wilt peanut variety “NDH108” and the highly susceptible variety “NDH107”, both bred by the peanut breeding team of the College of Agriculture of Henan Agricultural University, were planted in the bacterial wilt nursery of Xinyang Academy of Agricultural Sciences in Henan Province and the Maozhuang Experimental Base of Henan Agricultural University (Zhengzhou), respectively.

[0036] During the peanut flowering period, the rhizosphere soil of peanut plants H107 (XYH107) and H108 (XYH108) in Xinyang area and H107 (ZZH107) and H108 (ZZH108) in Zhengzhou area was collected using the shaking method. Figure 1 A). Specifically, after removing surface litter, fine roots were dug up along the root system, and the soil adhering to the surface of the plant roots was shaken off. The remaining soil adhering to the root surface was then washed off with deionized water, and the rhizosphere soil eluent was used for subsequent metabolomics analysis.

[0037] (2) Metabolomics analysis of rhizosphere soil of resistant and susceptible peanut varieties

[0038] Take 100 μL of rhizosphere soil eluent sample, place it in a centrifuge tube, and add 400 μL of 80% methanol aqueous solution; vortex and incubate on ice for 5 min, then centrifuge at 15000 rpm and 4℃ for 20 min; then take a certain amount of supernatant, dilute it with mass spectrometry grade water to a methanol content of 53%; centrifuge at 15000 rpm and 4℃ for 20 min, collect the supernatant, and use it for metabolomics analysis by liquid chromatography-mass spectrometry (LC-MS).

[0039] The detected metabolites are compared with public databases to identify them; the structure of the metabolites is further verified by combining secondary mass spectrometry data and retention time information; differential metabolites are screened by multivariate statistical methods (such as principal component analysis and partial least squares); differential metabolites are mapped to metabolic pathways, and the pathways with significant enrichment are analyzed to reveal the biological functions of the metabolites.

[0040] The results showed that differential metabolites under Ralstonia solanacearum infection were mainly enriched in the following pathways: alanine, aspartic acid, and glutamic acid metabolism; glycine, serine, and threonine metabolism; valine, leucine, and isoleucine degradation; primary bile acid biosynthesis; neomycin, kanamycin, and gentamicin biosynthesis; and phenylalanine metabolism. Specifically, tetracycline was identified as a differential metabolite in the primary bile acid biosynthesis pathway; betaine was identified in the glycine, serine, and threonine pathway; and salicylic acid was identified in the phenylalanine metabolism pathway. Meanwhile, under Ralstonia solanacearum infection, metabolites with significant fold differences and highest enrichment in XYH108 include hepatobiliary acid, nitrophenol, tetracycline, arachidonic acid, betaine, salicylic acid, cytisine, arginine, and coniferin. Figure 1 B).

[0041] Example 2: In vitro antibacterial and disease-resistant effects of active metabolites

[0042] (1) In vitro antibacterial experiment of active metabolites

[0043] Four inexpensive and commonly used active substances (including salicylic acid, betaine, tetracycline, and β-estradiol) were selected from highly enriched metabolites for in vitro antibacterial experiments. The specific operation was as follows: The Ralstonia solanacearum isolated and preserved in our laboratory (the specific isolation method is referred to in the reference "Dai Xiaoqiu et al., 2022. Isolation and genetic diversity identification of peanut bacterial wilt pathogen in Guangdong Province, Journal of Zhongkai University of Agriculture and Engineering, 2022, 35(03): 26-33.") was streaked onto triphenyltetrazole chloride (TTC) agar medium (containing 10.0 g / L peptone, 1 g / L casein hydrate, 5.0 g / L D-glucose and 15.0 g / L agar). Then, a single colony was picked with a sterile toothpick and inoculated into TTC liquid medium and placed in a shaker at 28℃ and 200 rpm / min for 2 days. The resuspended bacteria were then adjusted to OD using a Nanodrop 2000c spectrophotometer. 600 Up to about 0.5, its concentration is about 10. 8 CFU / mL.

[0044] OD 600 Ralstonia solanacearum bacterial suspension with a pH of 0.5 was diluted 10-fold and 100-fold, respectively, and spread onto TTC solid medium. Four susceptibility test strips (5 mm in diameter) soaked in active substances were then placed 2 cm above, below, to the left, and to the right of the center. These strips contained 10 mM betaine, 50 ng / mL estradiol, 0.5 mM salicylic acid, and 15 μg / mL tetracycline, respectively. The medium was then incubated overnight at 28°C in the dark. Of the test reagents used, 99.5% salicylic acid was purchased from Sinopharm Chemical Reagent Co., Ltd., and 98% betaine, 98% tetracycline, and 98% estradiol were all purchased from Beijing Solarbio Science & Technology Co., Ltd. (all reagents were prepared into aqueous solutions according to specific concentrations and used immediately). ddH2O was used as a negative control, and 50 ng / mL kanamycin as a positive control.

[0045] The results showed that the drug susceptibility test strips containing salicylic acid, estradiol, betaine, and tetracycline did not change color, and the Ralstonia solanacearum colonies around the test strips were significantly reduced, indicating that 10 mM betaine, 50 ng / mL estradiol, 0.5 mM salicylic acid, and 15 μg / mL tetracycline all had certain antibacterial effects against Ralstonia solanacearum. Figure 2 A).

[0046] To enhance the antibacterial effect, the four active substances (salicylic acid, estradiol, betaine, and tetracycline) were mixed in equal volumes at appropriate concentrations to prepare a compound preparation. Antimicrobial susceptibility test strips soaked in the compound preparation, along with negative and positive controls, were placed on TTC solid culture medium coated with Ralstonia solanacearum and incubated overnight in a 28°C incubator in the dark. The results showed that this compound preparation had a better inhibitory effect on the growth of Ralstonia solanacearum. Figure 2 A). The compound of these four active substances, which has a better antibacterial effect, is named BEST.

[0047] To more accurately quantify the antibacterial effects of these active substances and BEST, their antibacterial rates were statistically analyzed. The specific procedures were as follows: 10 mM betaine, 50 ng / mL estradiol, 0.5 mM salicylic acid, and 15 μg / mL tetracycline, along with the prebiotic BEST, ddH2O negative control, and kanamycin positive control, were added to TTC solid culture medium. 600 After serially diluting the Ralstonia solanacearum bacterial suspension with a value of 0.5 by 10 times and 100 times, 50 μL of each suspension was spread onto TTC solid medium and incubated overnight in a constant temperature incubator at 28°C in the dark. The inhibition rate was then calculated.

[0048] Inhibition rate (%) = (Negative control colony count - Active substance or BEST treatment colony count) / Negative control colony count ◇ 100%.

[0049] The results showed that 15 μg / mL tetracycline and BEST completely inhibited the growth of Ralstonia solanacearum, while 10 mM betaine, 50 ng / mL estradiol and 0.5 mM salicylic acid had certain antibacterial effects. Figure 2 B). Specifically, the antibacterial rates of betaine (10 mM), estradiol (50 ng / mL), salicylic acid (0.5 mM), tetracycline (15 μg / mL), and prebiotic BEST were 21.71%, 72.97%, 86.90%, 100.00%, and 100.00%, respectively. Figure 2 C). The above results indicate that certain concentrations of betaine, estradiol, salicylic acid, and tetracycline can significantly inhibit the growth of Ralstonia solanacearum, and the compound preparation BEST has a better inhibitory effect on the growth of Ralstonia solanacearum.

[0050] (2) Experiments on the promotion of disease resistance by active metabolites

[0051] Seeds of the peanut variety “NDH107”, which is highly susceptible to bacterial wilt, were placed in a petri dish containing sterile water and left to germinate overnight at room temperature in the dark.

[0052] Germinated peanut seeds were transplanted into 10×10×10cm plastic pots, with 4 seedlings per pot, and placed in a suitable greenhouse for cultivation. The growing medium for peanut seedlings was vermiculite and Danish Pinscher nutrient substrate (volume ratio 2:1). The greenhouse was maintained with 16 hours of light at 28℃ and 8 hours of darkness at 26℃. When the peanut roots reached about 5cm in length, the seedlings were removed, rinsed with tap water, and transplanted into culture boxes containing Hogrange's solution (purchased from Shanghai Yuanye Biotechnology Co., Ltd.) to conduct a hydroponic root application experiment.

[0053] Meanwhile, the germinated peanut seeds were transplanted into 10×10×10cm plastic pots, with 4 seedlings planted in each pot, and then placed in a suitable greenhouse for cultivation. In the greenhouse, the peanut seedlings were grown in conventional soil as the growing substrate, and a potted foliar spraying experiment was carried out under these conditions; at the same time, the greenhouse needed to maintain an environmental condition of 16 hours of light (temperature 28℃) and 8 hours of darkness (temperature 26℃).

[0054] First, OD 600 The Ralstonia solanacearum inoculum solution with a concentration of 0.5 was diluted 10 times, and then the root injury method was used (refer to Zhao K, Ren R, Ma X, et al. Genome-wide investigation of defensin genes in peanut (Arachis hypogaea L.) revealals AhDef2.2 conferring resistance to bacterial wilt. The Crop Journal, 2022, 10(3):809-819.). The diluted inoculum solution was inoculated onto hydroponic peanut seedlings and potted peanut seedlings at the three-leaf stage to complete the Ralstonia solanacearum inoculation treatment of peanut seedlings. After the peanuts grew 3 true leaves, the root tip of the main root was cut off; then a concentration of 10% was selected. 8 Peanuts were inoculated with a CFU / mL Ralstonia solanacearum inoculum solution using the osmosis method. After inoculation, the peanuts were placed in a light incubator at 28℃, 60% humidity, and a light cycle of 16 hours light / 8 hours darkness.

[0055] While inoculating peanut seedlings with Ralstonia solanacearum, root application and foliar spraying experiments were conducted. In the root application experiment, 15 μg / mL tetracycline, 0.5 mM salicylic acid, 10 mM betaine, and 50 ng / mL estradiol were added sequentially to Hogrange's solution (purchased from Shanghai Yuanye Biotechnology Co., Ltd.) used to cultivate hydroponically grown peanut seedlings. In the foliar spraying experiment, potted peanut seedlings were sprayed with the same concentrations of the four reagents. Each treatment in both experiments had three biological replicates, with a blank control consisting of an equal volume of ddH2O added to the Ralstonia solanacearum inoculum solution.

[0056] Fourteen days after inoculation with Ralstonia solanacearum, the incidence of peanut bacterial wilt was investigated and statistically analyzed in each treatment group. The disease severity was assessed according to the following criteria: Grade 0 (immune, no wilting symptoms); Grade 1 (resistant, no wilting or only a few leaves showing wilting); Grade 2 (moderately resistant, less than half of the branches wilting); Grade 3 (moderately susceptible, more than half of the branches and leaves wilting); Grade 4 (susceptible, the entire plant wilting or the entire plant dying). The disease index was then calculated using the following formula:

[0057] Disease index = (0◇Number of grade 0 plants + 1◇Number of grade 1 diseased plants + 2◇Number of grade 2 diseased plants + 3◇Number of grade 3 diseased plants + 4◇Number of grade 4 diseased plants) / (4◇Total number of plants).

[0058] The results showed that, without inoculation with Ralstonia solanacearum, foliar and root application of 10 mM betaine, 50 ng / mL estradiol, 0.5 mM salicylic acid, and 15 μg / mL tetracycline did not significantly affect the growth of peanut plants; however, with inoculation with Ralstonia solanacearum, foliar and root application of 10 mM betaine, 50 ng / mL estradiol, 0.5 mM salicylic acid, and 15 μg / mL tetracycline all reduced the incidence of bacterial wilt in peanuts. Figure 3 ).

[0059] When inoculated with Ralstonia solanacearum alone, the disease incidence indices in hydroponic and pot experiments were 0.95 and 0.91, respectively. Figure 4 Under the inoculation of Ralstonia solanacearum, the incidence rates of disease after root application of 10 mM betaine in hydroponics and foliar spraying in potted plants were 0.80 and 0.75, respectively; after root application of 50 ng / mL estradiol in hydroponics and foliar spraying in potted plants, the incidence rates were 0.72 and 0.48, respectively; after root application of 0.5 mM salicylic acid in hydroponics and foliar spraying in potted plants, the incidence rates were 0.37 and 0.43, respectively; and after root application of 15 μg / mL tetracycline in hydroponics and foliar spraying in potted plants, the incidence rates were 0.30 and 0.34, respectively. Figure 4 The above results indicate that foliar and root application of 10 mM betaine, 50 ng / mL estradiol, 0.5 mM salicylic acid, and 15 μg / mL tetracycline can significantly improve peanut resistance to bacterial wilt.

[0060] Simultaneously, following the experimental methods described above, root application and foliar spraying experiments of prebiotic BEST were conducted while inoculating peanut seedlings with Ralstonia solanacearum. In the root application experiment, prebiotic BEST was added to Hoagland's solution used to cultivate hydroponically grown peanut seedlings. In the foliar spraying experiment, prebiotic BEST was sprayed onto potted peanut seedlings already inoculated with Ralstonia solanacearum. Each treatment in both experiments had three biological replicates, with a blank control consisting of an equal volume of ddH2O added to the Ralstonia solanacearum inoculum solution. Fourteen days after inoculation with Ralstonia solanacearum, the incidence of peanut bacterial wilt in each treatment group was investigated and statistically analyzed.

[0061] The results showed that, without inoculation with Ralstonia solanacearum, neither spraying nor root application of prebiotic BEST had a significant impact on the growth of peanut plants; however, with inoculation with Ralstonia solanacearum, both spraying and root application of prebiotic BEST reduced the incidence of bacterial wilt in peanuts. Figure 5 A). Under single inoculation with *Ralstonia solanacearum*, the disease incidence rates in hydroponics and pot experiments were 0.91 and 0.88, respectively; under *Ralstonia solanacearum* inoculation, the disease incidence rates after root application in hydroponics and foliar spraying of prebiotic BEST in potted plants were 0.05 and 0.08, respectively. Figure 5 B).

[0062] In addition, quantitative analysis was conducted on the Ralstonia solanacearum that invaded peanut roots after root application in hydroponics and foliar spraying of prebiotic BEST in potted plants under Ralstonia solanacearum inoculation.

[0063] The specific procedures are as follows: 14 days after inoculation with Ralstonia solanacearum, peanut root hair tissues of the same location and quality were collected and placed in 2.0 mL centrifuge tubes. 1.0 mL of ddH2O was added, and the tissues were thoroughly ground with a small plastic grinder. After standing at room temperature for 5 minutes, 100 μL of the supernatant from each treatment group was taken and serially diluted 10-fold and 100-fold, respectively. The diluted solutions were then spread on TTC solid medium and incubated overnight in a 28°C incubator in the dark. Three biological replicates were set up for each treatment.

[0064] Based on the number of Ralstonia solanacearum colonies on TTC solid medium, a relative quantitative analysis of Ralstonia solanacearum in peanut roots was performed. The results showed that applying the prebiotic BEST to the roots of hydroponically grown plants and foliar spraying to potted plants significantly reduced the number of Ralstonia solanacearum in peanut roots. Figure 5 C). The above results indicate that both foliar spraying and root application of the prebiotic BEST can significantly improve peanut resistance to bacterial wilt.

[0065] Example 3: Mechanism study of prebiotic BEST in promoting peanut resistance to bacterial wilt

[0066] (1) Analysis of rhizosphere microbial diversity in peanuts under Ralstonia solanacearum infection

[0067] The diversity of rhizosphere bacteria in peanuts after foliar spraying with BEST was analyzed using 16S rRNA sequencing technology for bacterial diversity.

[0068] Referring to the method in Part (1) of Example 1, 14 days after inoculation with Ralstonia solanacearum, peanut rhizosphere soil was collected from four groups of treatments: untreated control, sprayed with prebiotic BEST, Ralstonia solanacearum inoculation, and Ralstonia solanacearum inoculation followed by spraying with prebiotic BEST.

[0069] Genomic DNA was extracted from peanut rhizosphere microorganisms using the Omega Bio-Tek DNA Extraction Kit (R6731-00). After extraction, the concentration and quality of the DNA were assessed, and the DNA concentration was further determined by agarose gel electrophoresis: the electrophoresis conditions were 1% agarose gel, 1×TAE buffer, and 100V for 20 min; the electrophoresis sample was prepared by mixing 1 μL of loading buffer, 1 μL of DNA, and 4 μL of sterile water.

[0070] Using extracted peanut rhizosphere microbial genomic DNA as a template and universal 16S rRNA primers as a template, PCR amplification was performed. The universal 16S rRNA primer sequences were: 27-F: AGAGTTTGATCCTGGCTCAG; 1492-R: TACGGTTACCTTGTTACGACTT. The PCR reaction system consisted of: 4 μL of 5×Fast Pfu Buffer, 2 μL of 2.5 mM dNTPs, 0.8 μL of Forward Primer (5 μM), 0.8 μL of Reverse Primer (5 μM), 0.4 μL of FastPfu Polymerase, 10 ng of Template DNA, and ddH2O to a final volume of 20 μL. The PCR amplification program was: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 45 s, 30 cycles; and 72℃ extension for 10 min. All samples were processed under the above conditions, with three replicates per sample. PCR products from the same sample were mixed and detected by 2% agarose gel electrophoresis; then, the DNA was recovered by gel excision using the AXYGEN AxyPrep DNA Gel Recovery Kit, eluted with Tris-HCl, and verified by 2% agarose gel electrophoresis. High-throughput sequencing of the recovered products was performed using an Illumina PE250 system, and the raw sequencing data were uploaded to the NCBI database for comparison and plotted online using the Lingen Bio Cloud Platform.

[0071] The results showed that applying the above-mentioned active ingredient compound (i.e., prebiotic BEST) significantly improved the bacterial microbial diversity of peanut roots inoculated with and uninoculated with Ralstonia solanacearum. Figure 6 A). Applying the prebiotic BEST significantly reduced the abundance of Ralstonia solanacearum in the rhizosphere of peanuts inoculated with Ralstonia solanacearum. Figure 6B). Applying the prebiotic BEST significantly increased the abundance of beneficial bacteria in the rhizosphere of peanuts inoculated with Ralstonia solanacearum. These beneficial bacteria included Pseudomonas aeruginosa, Lactobacillus johnsonii, Hydrogenophaga sp011388215, Chryseobacterium sp., and Azospirillum thermophilum, among others. Figure 6 C).

[0072] (2) Expression analysis of peanut disease resistance marker genes under Ralstonia solanacearum infection

[0073] The expression of peanut disease resistance marker genes after foliar spraying with BEST was analyzed using real-time fluorescence PCR under the condition of inoculation with Ralstonia solanacearum.

[0074] Fourteen days after inoculation with Ralstonia solanacearum, peanut root tissues were collected from four treatment groups: untreated control, prebiotic BEST sprayed, Ralstonia solanacearum inoculation, and Ralstonia solanacearum inoculation followed by prebiotic BEST spraying. Each sample was collected independently at 0.5g, with three biological replicates. Total RNA was extracted using a plant total RNA extraction kit (DP441), and the concentration and integrity of RNA were further analyzed using an Agilent 2100 bioanalyzer. Subsequently, RNA reverse transcription and cDNA first-strand synthesis were performed according to the instructions of the Prime Script RT kit (Beijing Baori Biotechnology Co., Ltd., RR037A) and the gDNA Eraser kit (Beijing Baori Biotechnology Co., Ltd., RR092A).

[0075] Based on the reference genome information of cultivated peanut (Arachis hypogaea cv. Tifrunner, https: / / peanutbase.org / ), the full-length nucleotide coding sequences of peanut disease resistance-related genes Ah17g014300 (NPR1), Ah10g050800 (PR1), Ah11g430600 (PR10), Ah11g187000 (STK), Ah19g396600 (GST), and STRG.1004 (TGA) were extracted. Gene-specific primers were then designed using Primer-BLAST online software, with AhActin7 (XM_025826875) as an internal reference gene. Only primers amplifying a single product of approximately 150-250 bp were selected for quantitative real-time expression analysis (Table 1).

[0076] Table 1 Gene-specific primer sequences used for quantitative real-time expression analysis

[0077]

[0078]

[0079] The quantitative PCR reaction system consisted of 1.0 μL first-strand cDNA (10-fold dilution), 1.0 μL forward and reverse primers (10.0 μM), 10.0 μL Takara 2×SYBR Green I Master Mix, and 7.0 μL ddH2O, with a final reaction volume of 20 μL. All reactions were performed in 96-well plates using a Bio-Rad CFX-96 real-time PCR system, with three replicates per reaction. The polymerase chain reaction (PCR) amplification conditions included: an initial denaturation step at 95°C for 3 minutes, followed by 40 cycles, each consisting of denaturation at 95°C for 10 seconds, annealing at 54°C for 30 seconds, and extension at 65°C for 5 seconds. Finally, a final extension step was performed at 68°C for 5 minutes. The results were then compared with the quantitative method (2...). -ΔΔCT Assess the expression level of the target gene.

[0080] The results showed that application of prebiotic BEST significantly induced the upregulation of Ah17g014300, Ah10g050800, Ah11g430600, Ah11g187000, Ah19g396600, and STRG.1004 genes. Application of prebiotic BEST under Ralstonia solanacearum infection significantly induced the expression of Ah17g014300, Ah10g050800, Ah11g187000, Ah19g396600, and STRG.1004 genes. Figure 6 D). The above results indicate that the application of prebiotic BEST can significantly promote the expression of genes related to acquired resistance in peanut roots.

[0081] In summary, the active ingredient compound prebiotic BEST can enhance peanut resistance to bacterial wilt by inhibiting pathogens, recruiting beneficial bacteria, and activating the host's immune response.

[0082] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.

Claims

1. A regulator to enhance plant resistance to bacterial wilt, characterized in that, The regulator includes at least one of betaine, estradiol, salicylic acid, and tetracycline.

2. The regulator for improving plant resistance to bacterial wilt according to claim 1, characterized in that, The regulator is composed of betaine, estradiol, salicylic acid and tetracycline.

3. A plant growth regulator for improving resistance to bacterial wilt according to claim 1 or 2, characterized in that, The betaine is a natural extract with a purity ≥98%; the estradiol is β-estradiol with a purity ≥99%; the salicylic acid is a white crystalline powder with a purity ≥99%; and the tetracycline has a purity ≥95%.

4. A plant growth regulator for improving resistance to bacterial wilt according to claim 1 or 2, characterized in that, The effective concentrations of betaine, estradiol, salicylic acid, and tetracycline are not less than 10 mM, 50 ng / mL, 0.5 mM, and 15 μg / mL, respectively.

5. The application of the regulator according to any one of claims 1-4 in improving plant resistance to bacterial wilt, characterized in that, The plants include dicotyledonous plants or monocotyledonous plants.

6. The application according to claim 5, characterized in that, The plants mentioned include peanuts, soybeans, tomatoes, tobacco, cucumbers, potatoes, peppers, alfalfa, clover, and peas.

7. The application according to claim 5, characterized in that, The pathogen causing bacterial wilt is Ralstonia solanacearum, a member of the Solanaceae family.

8. A method for improving the resistance of plants to bacterial wilt, characterized in that, Before sowing, the plant seeds are treated and soaked with the regulator described in any one of claims 1-4; or the plant seedlings are irrigated with the regulator described in any one of claims 1-4 during the seedling stage; or the plant seedlings are foliar sprayed with the regulator described in any one of claims 1-4 at each growth stage.

Images