SgRNA of targeted chestnut plant PDS gene, gene editing vector, gene editing system and application of sgRNA

Abstract

The invention discloses sgRNA of a targeted chestnut plant PDS gene, a gene editing vector, a gene editing system and application of the sgRNA, and relates to the technical field of gene engineering. The sgRNA targeting the PDS gene of the chestnut plant, provided by the invention, can be used for carrying out site-specific knockout on a coding gene of an endogenous gene PDS of the chestnut plant, and finally, a gene edited chestnut plant with stable genetic transformation can be obtained through screening. The constructed gene editing vector and system have extremely high gene editing efficiency. After plant cells are further transformed by the gene editing vector, a transgenic plant with a high positive rate is obtained through screening, and the seedling rate of gene editing is high. Therefore, the invention provides a new gene editing system for shortening the breeding cycle of the chestnut plant and realizing the knockout or editing of the PDS gene, and also provides a good gene editing system for researching other genes in the chestnut plant.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more specifically, to an sgRNA targeting the PDS gene of chestnut plants, a gene editing vector, a gene editing system, and its applications. Background Technology

[0002] China is home to plants of the genus *Castanopsis* ( Castanea It is one of the diversity centers and origins of chestnuts, and is home to chestnuts ( Castanea mollissima , chestnut ( Castanea seguinii ), chestnut ( Castanea henryi The three native species and cultivated species of Japanese chestnut ( Castanea crenata Chestnut, as a core economic species, is defined as a strategic "woody food" due to its high starch content (51%-62%) and complex nutrients. Japanese chestnut, widely cultivated on the Liaodong Peninsula, is characterized by its large fruit, high yield, and high amylose content, making it an important processing variety. *Castanopsis fargesii* and *Castanopsis chinensis*, endemic to China, respectively provide drought-resistant rootstock resources and high-density timber (air-dry density 0.68 g / cm³). 3 Its wild populations constitute the core reserves of the National Germplasm Bank (accounting for 72% of global resources). To improve the species characteristics and enrich the diversity of the *Castanopsis* genus in China, germplasm improvement through genetic engineering is an effective approach. Agrobacterium-mediated genetic transformation is becoming the most widely used plant genetic transformation method due to its advantages such as genetic stability, simple operation, low cost, and mature methodology.

[0003] In the research of gene transformation in *Castanopsis* species in China, although a stable genetic transformation system for chestnut has been successfully constructed using RNAi interference technology and by infecting embryogenic callus with *Agrobacterium* GV3010, gene editing technology is currently lacking in this research. Gene editing technology based on the CRISPR / Cas9 system is highly attractive due to its high efficiency, flexibility, and non-transgenic characteristics. CRISPR / Cas9 uses sgRNA-guided Cas9 nucleases to specifically cut target gene sequences (generating DSBs) and utilizes the cell's own HR or NHEJ repair mechanisms to achieve precise insertion or deletion of specific genes. This technology has significant advantages such as high precision, excellent efficiency, low cost, and ease of operation, and has been widely used in various crops such as rice, corn, wheat, cotton, and soybeans, significantly shortening the plant breeding cycle.

[0004] In view of this, the present invention is proposed. Summary of the Invention

[0005] The purpose of this invention is to provide an sgRNA targeting the PDS gene of chestnut plants, a gene editing vector, a gene editing system, and its application to solve the above-mentioned technical problems.

[0006] The present application is implemented as follows: In a first aspect, the present application provides a guide sequence targeting PDS gene of Castanea, which has a sequence as shown in SEQ ID NO: 9 and / or SEQ ID NO: 10 or a complementary sequence thereof.

[0007] In a second aspect, the present application provides a guide RNA targeting PDS gene of Castanea, which comprises the guide sequence described above and a scaffold sequence operably linked to the guide sequence.

[0008] In a third aspect, the present application provides a Castanea CRISPR / Cas9 gene editing vector, which comprises a coding sequence of the guide RNA targeting PDS gene of Castanea described above.

[0009] In a fourth aspect, the present application provides a recombinant cell, which is a non-plant cell, comprising the Castanea CRISPR / Cas9 gene editing vector described above.

[0010] In a fifth aspect, the present application provides use of the Castanea CRISPR / Cas9 gene editing vector or the recombinant cell described above in cultivating a gene-edited Castanea plant.

[0011] In a sixth aspect, the present application provides a construction method of a Castanea CRISPR / Cas9 gene editing system, which comprises transferring the Castanea CRISPR / Cas9 gene editing vector described above or the recombinant cell described above into a Castanea plant; and the method for transferring the Castanea plant is selected from Agrobacterium transformation or gene gun method.

[0012] The present application has the following beneficial effects: The application provides a Castanea CRISPR / Cas9 gene editing system, which can perform site-directed knockout on the coding gene of endogenous phytoene dehydrogenase (PDS) of Castanea, and finally can screen a stably genetically transformed gene editing Castanea plant. The PDS gene of Chinese Castanea is highly conserved, and after screening and design, the inventors find that the guide sequence for targeting the PDS gene of Castanea shown in SEQ ID NO: 9 and / or SEQ ID NO: 10 has a high GC content, and after connecting the target to the CRISPR / Cas9 gene editing vector, the gene editing efficiency is extremely high. After further transforming the gene editing vector into plant cells, a transgenic plant with a high positive rate is screened, and the gene editing seedling rate is high. Therefore, the application provides a new gene editing system for shortening the breeding cycle of Castanea, realizing the knockout or editing of the PDS gene, and also provides a good gene editing system for the research of other genes in Castanea, which is beneficial to obtaining a stably genetically transformed gene editing plant. BRIEF DESCRIPTION OF DRAWINGS

[0013] In order to more clearly illustrate the technical solutions of the embodiments of the application, the drawings needed in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the application, and therefore should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can also be obtained without creative labor on the basis of these drawings.

[0014] Figure 1 pCBC-DU1U2 vector modification schematic diagram (left figure is an expression cassette schematic diagram, and right figure is a vector diagram of an intermediate vector); Figure 2 pHSE401 vector modification schematic diagram (left figure is an expression cassette schematic diagram, and right figure is a vector diagram of an intermediate vector); Figure 3 Wild type plant and PDS gene edited albino plant callus development diagram (left) and embryo cotyledon development diagram (right); Figure 4 PDS gene target point editing detection (01 and 02 respectively refer to two events). DETAILED DESCRIPTION

[0015] Reference will now be made in detail to embodiments of the application, one or more examples of which are described hereinbelow. Each example is provided as an explanation and not a limitation of the application. Indeed, it will be apparent to one of ordinary skill in the art that numerous modifications and variations of the present application are possible in light of the above teachings. For example, features described or illustrated as part of one embodiment can be used with another embodiment to yield still a further embodiment.

[0016] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the preparations or units described herein, some methods and materials are now described. Unless otherwise stated, the techniques employed or contemplated herein are standard methods. The materials, methods, and examples are illustrative only and not limiting.

[0017] As used herein, the term "guide RNA (gRNA)" refers to the combination of a CRISPR RNA (crRNA) and a tracrRNA (trRNA). "Guide RNA" can be used interchangeably with "guide." The crRNA and trRNA can be associated as a single RNA molecule (single guide RNA, sgRNA) or in two separate RNA molecules (double guide RNA, dgRNA). "Guide RNA" or "gRNA" can refer to each type, i.e., sgRNA or dgRNA; "sgRNA" of the present application can also be referred to simply as "gRNA." The trRNA can be a naturally occurring sequence, or the trRNA sequence can have modifications or variations compared to the naturally occurring sequence.

[0018] As used herein, "guide sequence" refers to a sequence within a guide RNA that is complementary to a target sequence and serves to guide the guide RNA to the target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA binding agent. "Guide sequence" can also be referred to as "guide region," "targeting sequence," "spacer sequence," or "protospacer sequence."

[0019] As used herein, "scaffold" refers to a nucleic acid sequence in a sgRNA other than a guide sequence.

[0020] It should be understood that a guide RNA, guide sequence, scaffold sequence can be a RNA sequence, or a DNA sequence or DNA region corresponding to a RNA sequence.

[0021] In a first aspect, the present application provides a guide sequence targeting PDS gene of Castanea, which has a sequence as shown in SEQ ID NO: 9 and / or SEQ ID NO: 10, or a complementary sequence thereof.

[0022] SEQ ID NO: 9: UGGCAUACAGAGUCUCUCUG; SEQ ID NO: 10: UGAUCCGUGGAAAUUUCAUC.

[0023] SEQ ID NO: 9 and SEQ ID NO: 10 are respectively directed to different target sites of PDS gene, and simultaneous insertion of the two guide sequences on a gene editing vector helps to improve the gene editing efficiency. SEQ ID NO: 9 and SEQ ID NO: 10 have a GC content of 50%, which helps to enhance the stability of the guide sequence and resist nuclease degradation, thereby improving the editing efficiency and enhancing the specificity and reducing off-target effects.

[0024] Through screening, the inventors found that the above-mentioned guide sequence can accurately and efficiently target PDS gene of Castanea.

[0025] In a second aspect, the present application provides a guide RNA targeting PDS gene of Castanea, which comprises the above-mentioned guide sequence and a scaffold sequence operably linked to the guide sequence.

[0026] In a preferred embodiment of the present application, the scaffold sequence is as shown in SEQ ID NO: 11, and the 3' end of the sequence as shown in SEQ ID NO: 9 and SEQ ID NO: 10 is respectively connected with a scaffold sequence.

[0027] In a third aspect, the present application provides a Castanea CRISPR / Cas9 gene editing vector, which comprises a coding sequence of the above-mentioned guide RNA targeting PDS gene of Castanea.

[0028] In a preferred embodiment of the present application, the Castanea CRISPR / Cas9 gene editing vector further comprises a promoter coding sequence, a Cas9 protein coding sequence and a terminator coding sequence.

[0029] In some embodiments, the Cas nuclease is not limited to Cas9 protein.

[0030] In some embodiments, the Cas nuclease is from type II CRISPR / Cas system. In some embodiments, the Cas nuclease is fused with an exonuclease. In some embodiments, the Cas nuclease is Cas9, Cpfl, C2cl, C2c2 and C2c3 or a modified protein thereof.

[0031] In a preferred embodiment of the application, the promoters are selected from the first U6 promoter and the second U6 promoter of Castanea mollicula, the first U6 promoter and the second U6 promoter of Castanea seguinii, the first U6 promoter and the second U6 promoter of Castanea henryi or the first U6 promoter and the second U6 promoter of Castanea crenata, the nucleotide sequences of the first U6 promoter and the second U6 promoter of Castanea mollicula are shown in SEQ ID NO: 12 and SEQ ID NO: 13, respectively, the nucleotide sequences of the first U6 promoter and the second U6 promoter of Castanea seguinii are shown in SEQ ID NO: 16-17, respectively, the nucleotide sequences of the first U6 promoter and the second U6 promoter of Castanea henryi are shown in SEQ ID NO: 18-19, respectively, and the nucleotide sequences of the first U6 promoter and the second U6 promoter of Castanea crenata are shown in SEQ ID NO: 20-21, respectively.

[0032] The inventors have found that the first U6 promoter (U6-p) and the second U6 promoter (U6-t) are truncated according to the sequences shown in SEQ ID NO: 12 and SEQ ID NO: 13, which greatly improves the transcriptional activity of the terminator.

[0033] The first U6 promoter (U6-p) and the second U6 promoter (U6-t) are both derived from the wild-type promoter of Castanea mollicula.

[0034] In a preferred embodiment of the application, the terminator is selected from the Nos terminator (simple terminator).

[0035] In a preferred embodiment of the application, the Castanea CRISPR / Cas9 gene editing vector comprises, in the 5' to 3' direction, a first U6 promoter, a coding sequence of a guide RNA targeting the PDS gene of the Castanea plant shown in SEQ ID NO: 9, a coding sequence of a scaffold sequence, a second U6 promoter, a first U6 promoter, a coding sequence of a guide RNA targeting the PDS gene of the Castanea plant shown in SEQ ID NO: 10, a coding sequence of a scaffold sequence, and a second U6 promoter.

[0036] In an embodiment, the above-mentioned Castanea CRISPR / Cas9 gene editing vector further comprises a selection marker gene and a reporter gene.

[0037] The term "selection marker" refers to a gene that will aid in the selection of cells that are actively expressing the nucleic acid sequence. Examples of suitable selection markers include enzymes that encode resistance to antibiotics (i.e., antibiotic resistance genes), such as kanamycin, neomycin, puromycin, hygromycin, blasticidin, bleomycin, glyphosate resistance genes, glufosinate resistance genes, and the like.

[0038] One example of a reporter gene is a fluorescent protein, such as green fluorescent protein (GFP), red fluorescent protein (RFP), or blue fluorescent protein (BFP), YFP, EGFP, and the like.

[0039] In a fourth aspect, the present application provides a recombinant cell, which is a non-plant cell, comprising the above-mentioned Castanea CRISPR / Cas9 gene editing vector.

[0040] The recombinant cell is, for example, selected from a recombinant Agrobacterium, a recombinant bacterium (such as Escherichia coli), and the like.

[0041] In a fifth aspect, the present application provides use of the above-mentioned Castanea CRISPR / Cas9 gene editing vector or the above-mentioned recombinant cell in cultivating a gene-edited Castanea plant. The above-mentioned Castanea CRISPR / Cas9 gene editing vector or the above-mentioned recombinant cell is introduced into a Castanea plant cell by a transgenic method, and a gene-edited Castanea plant can be obtained.

[0042] In one embodiment, the callus of Castanea mollissima, Castanea henryi, Castanea seguinii, and Castanea crenata is infected by an Agrobacterium transformation method, respectively. After screening by antibiotics and fluorescent markers, the transgenic callus is subcultured on an embryo initiation, embryo development, and embryo germination medium, and finally, a completely albino plant of a PDS gene-edited Castanea plant can be obtained.

[0043] In a sixth aspect, the present application provides a method for constructing a Castanea CRISPR / Cas9 gene editing system, which comprises introducing the above-mentioned Castanea CRISPR / Cas9 gene editing vector or the above-mentioned recombinant cell into a Castanea plant. The method for introducing the Castanea plant is selected from an Agrobacterium transformation method or a gene gun method, but is not limited thereto.

[0044] In order to make the objectives, technical solutions, and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be described clearly and completely below. If specific conditions are not indicated in the embodiments, conventional conditions or conditions recommended by manufacturers are used. If the used reagents or instruments are not indicated by manufacturers, they are all conventional products that can be purchased on the market.

[0045] The features and performances of the present application are further described in detail below in combination with embodiments.

[0046] Embodiment 1 In this embodiment, a PDS gene editing vector is constructed.

[0047] Vector modification and vector construction The gene editing skeleton in the embodiment adopts pHSE401-2gR donated by the research group of Professor Chen Qijun of China Agricultural University. The Arabidopsis U6 promoter sequence is used for BLAST in the genomes of C. cathy, C. concolor, C. mandshurica and C. ciliata, respectively, to obtain CmU6 , CheU6 , CsU6 and CcU6 ( Figure 1 ), and check whether the promoter sequence has the necessary elements: UAUA-like Box and USE (upsUream sequence element). The DNA of C. cathy, C. concolor, C. mandshurica and C. ciliata is used as a template to obtain CmU6 , CheU6 , CsU6 and CcU6 sequences by using high-fidelity enzyme cloning. Then CmU6 , CheU6 , CsU6 and CcU6 sequences are respectively connected to the pCBC-DT1T2 intermediate vector, which is also donated by the research group of Professor Chen Qijun of China Agricultural University.

[0048] Among them, the nucleotide sequences of the first U6 promoter ( CsU6 -p) and the second U6 promoter ( CsU6 -t) of C. mandshurica are shown in SEQ ID NO: 12 and SEQ ID NO: 13, respectively.

[0049] In order to screen the optimal PDS gene editing target, PDS targets 1-8 are designed in the embodiment, and the target sequences are shown in SEQ ID NO: 1-8 in Table 1.

[0050] Table 1: PDS gene target

[0051] Each PDS gene target is connected to the sgRNA expression cassette by PCR amplification reaction, and the sgRNA expression cassette includes a scaffold sequence, and the coding sequence is shown in SEQ ID NO: 14: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC, and the RNA sequence is shown in SEQ ID NO: 11: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC; The DNA sequence of the sgRNA expression cassette is shown below as SEQ ID NO: 15: ATATATGGTCTCGATTGGATGGAGACTGGTATGAGACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGTTCTCTCTTTTTTCAAAATTCATCATACAAGGTAATAGTCCAATCTGGGGTGTGTGTTTAAACTTTAAAAGACAAATTTGCATGCAGTCTTTTGAGGTTTTTTTTTCCTATTTGTTTGTTTAAAGAAAGGTTTCGGGTTGGGTATGTGACCGAATGCAATTCTTGCAAAGCTGCCGGATATTTTACGTTTTAATTTCATATATTTGGTTCTTGAGCCTGGCATAGTTAGCATGAACAAAGGTAGTAAATTGTATTTAAATTCGAGGTTTTTTATATTGAATATATTACATATATGTCATGCATCTATTATACTTCTAAAGTTACTCATCTGTTATTTTTCTTTTACTCTATTTTACAGAGATGATATTATATATTATTTTTATTTTTTTTGGTATTGAATTGAAAAAAGAAATCATATGTTTCATTATTAAACAAAAAATAAATAAGAAATTGTGTTTGATAACTTCGTCTCCAAAGAAGGCCCACAAGGATGAGAAGGTGGATGAGTAAGTTTGGGCCTGGGCATAGCACCTGTTTCAACTTTGTGCGCGCGTCCCACATCGCAAAGAAACAGTAAGATGAAAGCATTTATATAAAAACACGCAGCTAGTAACAATTGTGGCATACAGAGTCTCTCTGGTTTAGAGACCAATAAT.

[0052] The above sgRNA expression cassettes were respectively ligated to the pCBC-DT1T2 intermediate vector (refer to Figure 1 . The vector map of the intermediate vector is shown in Figure 1 .

[0053] Next, based on the enzyme cutting site BsaI, the double target and sgRNA expression cassette are connected to the final vector pHSE401-2gR (containing the glyphosate-resistant gene, EGFP gene) by "cutting and connecting", and the pHSE401-2gR-PDS gene editing vector is successfully constructed. Figure 2 The left graph in FIG. 1 is a position map of each element on the pHSE401-2gR-PDS gene editing vector. Figure 2 The right graph in FIG. 1 is a schematic diagram of the pHSE401-2gR-PDS gene editing vector containing the sgRNA expression cassette. CsU6 The SmR sequence in FIG. 1 is the sequence on the original vector pHSE401-2gR, and the expression cassette in the left graph of FIG. 1 is replaced by enzyme cutting and connection, thereby constructing the final vector pHSE401-2gR. Figure 2 The SmR sequence in FIG. 1 is the sequence on the original vector pHSE401-2gR, and the expression cassette in the left graph of FIG. 1 is replaced by enzyme cutting and connection, thereby constructing the final vector pHSE401-2gR. Figure 2 The SmR sequence in FIG. 1 is the sequence on the original vector pHSE401-2gR, and the expression cassette in the left graph of FIG. 1 is replaced by enzyme cutting and connection, thereby constructing the final vector pHSE401-2gR.

[0054] The gene editing efficiency of each pHSE401-2gR-PDS gene editing vector constructed is detected, and the detection method is as follows: The target points of the target gene PDS are screened by using the website http: / / crispr.tefor.net / crispor.py. The website http: / / www.rgenome.net / cas-offinder / is logged in to further evaluate the targeting efficiency and off-target situation, and high-score target points are screened. At the same time, the gene editing vectors of PDS target points 1-8 are constructed, and are transiently transformed into callus. The positive callus is obtained by fluorescence tag EGFP and hygromycin antibiotic screening, and the gene editing targeting efficiency is detected. The highest comprehensive score and the highest gene editing targeting efficiency PDS gene target point are selected from the target point 1 and the target point 2, the target point 1 is GATGGAGACTGGTATGAGAC, and the target point 2 is TGATCCGTGGAAATTTCATC. Therefore, the guide sequence of the target point 1 and the guide sequence of the target point 2 are selected to construct the gene editing vector (Table 2).

[0055]

[0056] Example 2 Carya plant somatic embryo genetic transformation method and transgenic cotyledon embryo acquisition: (1) The pHSE401-2gR-PDS gene editing vector containing the Carya cathayensis CsU6 Promoter constructed in the example is transformed into Agrobacterium GV3101, and first bacterial liquid preparation is carried out. The colony is placed in 500ul liquid LB medium, and the concentration of glyphosate is 50mg / L. In a sterilized 1.5ml centrifuge tube, the bacterial liquid is cultured on a shaker at 220r / min for 12h. The bacterial liquid is detected by colony PCR to test the positive bacterial liquid.

[0057] (2) Second bacteria liquid preparation: the first positive bacteria liquid was placed in 5 ml of liquid LB medium, in a sterilized 50 ml centrifuge tube, and cultured on a shaker at 220 r / min for 12 h. Positive colonies were tested by colony PCR.

[0058] (3) Third bacteria liquid preparation: 200 ul of the positive second bacteria liquid was taken and cultured in a 100 ml capacity bottle on a shaker at 220 r / min for 12 h until the OD value of the bacteria liquid was 0.8-1.2.

[0059] (4) The third bacteria liquid was centrifuged at 5000 r / min for 15 min, and the bacteria were collected and suspended in an induction medium. The volume ratio of the third bacteria liquid to the induction medium was 1:1. The two were dark cultured on a shaker at 75 r / min for 3-5 h, and then the infection liquid and the chestnut somatic cell embryos were soaked for 50-60 min. The infection liquid was dried with filter paper, and then the infected somatic cell embryos were dark cultured in an embryo growth medium at 25°C for 2 d. Then they were transferred to an Agrobacterium inhibition medium and cultured for 14 d. After the culture was completed, they were transferred to a resistance screening medium and grown. Calli were selected by a body fluorescence microscope, and calli with EGFP fluorescence expression were selected and continuously cultured in an embryo development medium and an embryo germination medium until seedlings were obtained. The components and concentrations of the above culture media are as follows: LB medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride (NaCl) 10 g / L, WPM 2.3 g / L, pH 7.3.

[0060] Induction medium: MES buffer 9.75 g / L, sucrose 10 g / L, pH 5.5, acetosyringone 80 mM.

[0061] Embryo growth medium: woody plant basic salt medium 2.3 g / L, vitamin 100 mg / L, hydrolyzed casein 1 g / L, 2,4-D 0.2 mg / L, 6-BA 0.2 mg / L, sucrose 30 g / L, agar 3 g / L, pH 5.5.

[0062] Agrobacterium inhibition medium: woody plant basic salt medium 2.3 g / L, vitamin 100 mg / L, hydrolyzed casein 1.0 g / L, 2,4-D 0.2 mg / L, 6-BA 0.2 mg / L, sucrose 30 g / L, agar 3 g / L, pH 5.5, rifampicin 50 mg / L, and temidin 50 mg / L.

[0063] Resistance screening medium: Woody plant basal salt medium 2.3 g / L, vitamin 100 mg / L, hydrolyzed casein 1.0 g / L, 2,4-D 0.2 mg / L, 6-BA 0.2 mg / L, sucrose 30 g / L, agar 3 g / L; pH 5.5, rifampicin 50 mg / L, temik 50 mg / L, glyphosate 500 mg / L.

[0064] Embryo development medium: Woody plant basal salt medium 2.3 g / L, vitamin 100 mg / L, L-Glutamine 0.5 g / L, sucrose 30 g / L, hydrolyzed casein 1.0 g / L, agar 3 g / L, pH 5.5±0.05.

[0065] Embryo germination medium: Woody plant basal salt medium 2.3 g / L, vitamin 100 mg / L, MES 0.5 g / L, sucrose 30 g / L, PVP-40 0.5 g / L, 6-BA 0.2 mg / L, NAA 0.2 mg / L, agar 3 g / L, pH 5.5±0.05.

[0066] (5) According to step (4), stable glyphosate-resistant and EGFP-labeled chestnut oak callus was obtained through subculture screening. Under dark field of a body fluorescence microscope, wild-type chestnut oak callus showed no fluorescence, and transgenic chestnut oak callus showed green fluorescence (left image in FIG. 1). Figure 3

[0067] The stable transgenic callus was further subjected to plant cell tissue culture, and was placed in an embryo growth medium and shaken at 80-100 r / min for 7 days to screen for 20-40 mesh upper spherical embryos. The spherical embryos obtained in the previous step were placed in an embryo development medium and shaken at 80-100 r / min for 7 days to screen for 20-40 mesh heart-shaped embryos. The heart-shaped embryos obtained in the previous step were placed in an embryo development liquid medium and shaken at 80-100 r / min for 7 days to screen for 20-40 mesh torpedo-shaped embryos. The torpedo-shaped embryos obtained in the previous step were placed in a liquid embryo development medium and shaken at 80-100 r / min for 7 days to screen for 20-40 mesh cotyledon embryos, which were further cultured on a solid embryo development medium. In order to better observe the growth state of the transgenic cotyledon embryos, a body fluorescence microscope was used to observe wild-type cotyledon embryos and transgenic cotyledon embryos (right image in FIG. 1). It was found through observation that under dark field, the wild-type cotyledon embryos showed no fluorescence, while the transgenic cotyledon embryos showed very obvious green fluorescence. Figure 3

[0068] ​​As shown in Table 3, a total of 61 cotyledon embryos were obtained, and the positive cotyledon embryos were observed by the EGFP carried by the vector, of which 41 were positive, with a positive rate of 67.2%, and 5 albino seedlings were obtained by culturing the cotyledon embryos, with a gene editing seedling rate of 12.1%. The sequence near the PDS gene target site of the albino seedlings was cloned, gel recovered and purified, and sent to the company for sequencing, and the gene editing efficiency was 100%. The editing efficiency and mutation type of the albino seedlings were analyzed, and the sequencing results showed that two editing events were generated, both of which were multi-base deletions. One editing event (01) had a probability of 73.3% and was a deletion of the target position base UCUC, and the other editing event (02) had a probability of 26.7% and was a deletion of the target position base UC. Figure 4

[0069] Table 3: Statistics of cotyledon embryo positive rate and albino seedling editing effect of Castanopsis fargesii CRISPR / Cas9 gene editing

[0070] Comparative Example 1 Compared with Example 1, the only difference is that the sequence before optimization of CsU6-p and CsU6-t is used as the promoter sequence, and the other steps are the same as those in Example 1.

[0071] A large number of studies have shown that there may be some inhibitory factors that inhibit the transcriptional activity of the promoter at the 5' end of the U6 promoter. In order to clone the AtU6-p promoter of Arabidopsis thaliana as a control, the candidate U6 promoters were truncated at the 5' end and named CseU6-p and CseU6-t. They were connected to the GUS243 vector, and the CseU6-p::GUS, CseU6-t::GUS and CseU6::GUS vectors were introduced into Castanopsis fargesii callus using the Agrobacterium-mediated genetic transformation system. CseU6-p, CseU6-t and CseU6 correspond to promoters CseU6-1, CseU6-2 and CseU6, respectively. The transcriptional activities of promoters CseU6-1, CseU6-2 and CseU6 were compared, and the GUS enzyme activity of the callus was determined. According to the staining and enzyme activity determination results, the promoter with higher transcriptional activity in the callus of Castanopsis fargesii was screened. The results showed that in the callus of Castanopsis fargesii, the transcriptional activity of CseU6-p was 2.85 U / L, the transcriptional activity of CseU6-t was 2.73 U / L, and the transcriptional activity of CseU6 was 1.86 U / L. Therefore, CseU6-p and CseU6-t truncated at the 5' end have better transcriptional activity.

[0072] ​The above merely provides the preferred embodiments of the present application, and is not used to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the principles and technical scope of the present application shall fall into the scope of the present application.

Claims

1. A guide sequence targeting PDS gene of Castanea genus plant, characterized in that, has a sequence as set forth in SEQ ID NO: 9 and / or SEQ ID NO: 10, or a complement thereof.

2. A guide RNA targeting a PDS gene of a Castanea plant, characterized in that, The guide RNA comprises the guide sequence of claim 1 and a scaffold sequence operably linked to the guide sequence.

3. The guide RNA targeting PDS gene of genus Castanea plant according to claim 2, characterized in that, The scaffold sequence is as set forth in SEQ ID NO: 11, and one scaffold sequence is linked to the 3' end of each of the sequences as set forth in SEQ ID NO: 9 and SEQ ID NO:

10.

4. A Castanea CRISPR / Cas9 gene editing vector, characterized in that, The guide RNA comprises the guide sequence of claim 1 and a scaffold sequence operably linked to the guide sequence. The coding sequence of the guide RNA targeting the PDS gene of a Castanea plant of any one of claims 2-3.

5. The Castanea genus plant CRISPR / Cas9 gene editing vector of claim 4, characterized in that, The Castanea plant CRISPR / Cas9 gene editing vector further comprises a promoter coding sequence, a Cas9 protein coding sequence, and a terminator coding sequence.

6. The Castanea CRISPR / Cas9 gene editing vector of claim 5, wherein, The promoter is selected from the group consisting of a first U6 promoter and a second U6 promoter of Castanea mollissima, a first U6 promoter and a second U6 promoter of Castanea mollissima, a first U6 promoter and a second U6 promoter of Castanea henryi, or a first U6 promoter and a second U6 promoter of Castanea crenata, the nucleotide sequences of the first U6 promoter and the second U6 promoter of Castanea mollissima are as set forth in SEQ ID NO: 12 and SEQ ID NO: 13, respectively, the nucleotide sequences of the first U6 promoter and the second U6 promoter of Castanea mollissima are as set forth in SEQ ID NO: 16-17, respectively, the nucleotide sequences of the first U6 promoter and the second U6 promoter of Castanea henryi are as set forth in SEQ ID NO: 18-19, respectively, and the nucleotide sequences of the first U6 promoter and the second U6 promoter of Castanea crenata are as set forth in SEQ ID NO: 20-21, respectively.

7. The Castanea genus plant CRISPR / Cas9 gene editing vector of claim 6, characterized in that, In the 5' to 3' direction, the Castanea plant CRISPR / Cas9 gene editing vector comprises, in order, the first U6 promoter, the coding sequence of the guide RNA targeting the PDS gene of a Castanea plant as set forth in SEQ ID NO: 9, the coding sequence of the scaffold sequence, the second U6 promoter, the first U6 promoter, the coding sequence of the guide RNA targeting the PDS gene of a Castanea plant as set forth in SEQ ID NO: 10, the coding sequence of the scaffold sequence, and the second U6 promoter.

8. A recombinant cell, characterized in that, The recombinant cell is a non-plant cell comprising the Castanea plant CRISPR / Cas9 gene editing vector of any one of claims 4-7.

9. Use of the Castanea plant CRISPR / Cas9 gene editing vector of any one of claims 4-7 or the recombinant cell of claim 8 in breeding a gene-edited Castanea plant. 10.A method for constructing a CRISPR / Cas9 gene editing system of Castanea, characterized in that, The Castanea plant CRISPR / Cas9 gene editing vector of any one of claims 4-7 or the recombinant cell of claim 8 is introduced into a Castanea plant, and the method of introducing the Castanea plant is selected from the group consisting of Agrobacterium transformation and biolistic transformation.

Images