Application of fucoidin degradation product Fuc-S in pharmaceutical composition for preventing, relieving or treating type 2 diabetes mellitus and liver injury

Abstract

The invention discloses application of a fucoidin degradation product Fuc-S in a pharmaceutical composition for preventing, relieving or treating type 2 diabetes mellitus and liver injury, and relates to the technical field of biological medicines. The invention provides a new effect of fucoidin Fuc-S in treating diabetic liver injury, and particularly, the fucoidin Fuc-S can significantly improve blood glucose control (reducing fasting blood glucose and enhancing sugar tolerance) and blood lipid spectrum (reducing TG, TC and LDL-C and increasing HDL-C) of diabetic mice, alleviate liver fatty degeneration and reduce serum ALT / AST level, and shows a significant liver protection effect. Furthermore, the Fuc-S can be used for remodeling the intestinal flora structure through specific enrichment of beneficial bacteria such as Bacteroides acdifaciens and the like, so that the generation of short-chain fatty acid (SCFAs) with a liver protection effect is promoted. The flora and metabolic change jointly improve the oxidative stress state of the liver, inhibit pro-inflammatory response and reduce lipid accumulation. The invention provides a novel nutrition intervention strategy for prevention and treatment of T2DM and liver complications thereof.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological medicine, and particularly relates to application of fucoidan degradation product Fuc-S in preparation of a medicine composition for preventing / treating diabetes and liver injury. BACKGROUND

[0002] Type 2 diabetes mellitus (T2DM) has become a major global public health challenge, and its prevalence is showing a sharp upward trend. Existing researches have confirmed that liver injury is an important secondary complication of T2DM. Epidemiological data shows that 50-70% of T2DM patients will be complicated with non-alcoholic fatty liver disease (NAFLD), of which 10-30% will progress to non-alcoholic steatohepatitis (NASH), significantly increasing the risk of liver fibrosis, cirrhosis and hepatocellular carcinoma. Current clinical commonly used hypoglycemic drugs such as insulin secretagogue and SGLT-2 inhibitor can effectively control blood glucose, but have side effects such as hypoglycemia, gastrointestinal adverse reactions and urinary tract infections, and have limited protective effect on liver. Based on these limitations, nutritional intervention strategies, especially dietary fiber supplementation, are attracting attention due to their good safety and multi-target action mechanism. Studies have shown that dietary fiber can play a beneficial role through various pathways such as regulating the "gut microbiota-liver" axis, improving insulin sensitivity and reducing oxidative stress, providing a new idea for the prevention and treatment of T2DM.

[0003] Fucoidan is a sulfated fucose-rich polysaccharide mainly derived from edible brown algae (Ascophyllum nodosum), and its biological activity is closely related to its unique structural characteristics (including sulfation pattern, glycosidic bond type and molecular weight distribution, etc.). Recent studies have found that the backbone structure of this polysaccharide is mainly of two types, A and B, i.e. L-fucopyranose is connected alternately by α-(1→4) and α-(1→3) glycosidic bonds (A) or L-fucopyranose is connected by α-(1→3) glycosidic bonds (B). This polysaccharide has a wide range of biological activities: in metabolic regulation, it can enhance the insulin sensitivity of muscle tissue through the AMPK pathway, showing significant anti-diabetic properties; in anti-inflammatory effects, it can exert effects through inhibition of the NF-κB signaling pathway; in anti-tumor effects, it can play a role by remodeling the tumor microenvironment. In addition, studies have also confirmed its functions of inhibiting VEGF-mediated angiogenesis and bidirectional immune regulation. These findings indicate that fucoidan has important translational application value in metabolic diseases, inflammation, tumor and immune regulation, etc.

[0004] By means of ultrasonic-assisted degradation technology, the inventors isolated a low-molecular-weight fucoidan component (Fuc-S) from Fucus vesiculosus, and systematically characterized its structure by means of high-performance gel permeation chromatography (HPGPC), Fourier transform infrared spectroscopy (FT-IR) and nuclear magnetic resonance (NMR) technology, and found that the skeleton structure of Fuc-S is quite different from the skeleton structures of A and B, and the biological activity of Fuc-S has not been reported in the prior art. SUMMARY

[0005] The technical problem to be solved by the present application is to provide an application of a fucoidan degradation product Fuc-S in a pharmaceutical composition for preventing, alleviating or treating type 2 diabetes and liver damage.

[0006] In order to solve the above problems, the present application proposes the following technical solutions:

[0007] The present application provides an application of a fucoidan degradation product Fuc-S in a pharmaceutical composition for preventing, alleviating or treating type 2 diabetes.

[0008] On the other hand, the present application provides an application of a fucoidan degradation product Fuc-S in a pharmaceutical composition for preventing, alleviating or treating liver damage.

[0009] Further, the liver damage is one or more selected from the group consisting of fatty liver, hepatitis, liver fibrosis and liver cirrhosis.

[0010] Further, the fatty liver is non-alcoholic fatty liver.

[0011] Further, the non-alcoholic fatty liver is diabetic non-alcoholic fatty liver.

[0012] Further, the pharmaceutical composition has one or more of the following (1) to (4) characteristics:

[0013] (1) the serum ALT and / or AST concentration is reduced,

[0014] (2) the concentration of short-chain fatty acids SCFAs is increased,

[0015] (3) the abundance of intestinal Bacteroides acidifaciens flora is increased,

[0016] (4) the concentration of inflammatory factors IL-6 and / or TNF-alpha is reduced.

[0017] Further, the short-chain fatty acids SCFAs include at least one of acetic acid, propionic acid and butyric acid.

[0018] In another aspect, the present application provides a food composition for preventing, alleviating or treating type 2 diabetes, which comprises fucoidan degradation product Fuc-S as an active ingredient.

[0019] In another aspect, the present application provides a food composition for preventing, alleviating or treating liver injury, which comprises fucoidan degradation product Fuc-S as an active ingredient.

[0020] It is understood that the above pharmaceutical composition can further comprise a pharmaceutically acceptable carrier or adjuvant, such as a humectant, a binder, a lubricant, a coating agent, etc.

[0021] The above food composition can further comprise a food-acceptable carrier or adjuvant, such as a humectant, a binder, a lubricant, a coating agent, etc.

[0022] It is noted that the fucoidan degradation product Fuc-S of the present application is a sulfated fucose-rich polysaccharide with a backbone of →3)-α-L-Fucp-(1→, →4)-α-L-Fucp-(1→ and →3,4)-α-D-Glcp-(1→, which can be extracted and prepared into a pure product by using conventional separation and purification techniques or methods reported in the literature, or can be prepared by using a chemical synthesis method, and can also be directly purchased.

[0023] The present application provides a new effect of fucoidan Fuc-S in treating liver injury in diabetes, specifically, fucoidan Fuc-S can significantly improve the blood glucose control (lower fasting blood glucose, enhance glucose tolerance) and blood lipid profile (lower TG, TC, LDL-C, and increase HDL-C) of diabetic mice, while reducing liver steatosis and lowering serum ALT / AST levels, showing a significant liver protection effect. Further, Fuc-S can regulate intestinal flora (enriching Bacteroides acidifaciens) and increase the production of short-chain fatty acids (SCFAs, including acetic acid, propionic acid and butyric acid), thereby reducing liver oxidative stress (restoring SOD / CAT / GSH-Px activity, reducing MDA) and inflammatory response (reducing IL-6 / TNF-α). Fuc-S can specifically enrich beneficial bacteria such as Bacteroides acidifaciens to reshape the intestinal flora structure and promote the production of short-chain fatty acids (SCFAs) with liver protection effect. These changes in flora and metabolism together improve the oxidative stress state of the liver, inhibit pro-inflammatory response, and reduce lipid accumulation.

[0024] Compared with the prior art, the present application can achieve the following technical effects:

[0025] (5) The application provides a new use of fucoidan degradation product Fuc-S in the preparation of a pharmaceutical composition for preventing, alleviating or treating type 2 diabetes and liver injury. Fuc-S can significantly improve blood glucose homeostasis (reduce fasting blood glucose, enhance glucose tolerance) and blood lipid profile (reduce serum TG, TC and LDL-C, and increase HDL-C); reduce liver steatosis, reduce serum ALT / AST levels, restore liver antioxidant enzyme activity (SOD / CAT / GSH-Px), and has a significant protective effect on the liver; Fuc-S can specifically enrich short-chain fatty acid-producing bacterial groups (such as Bacteroides acidifaciens) and increase the concentration of cecal SCFAs (acetic acid / propionic acid / butyric acid); Fuc-S can inhibit the release of liver inflammatory factors (reduce IL-6 / TNF-alpha) and reduce oxidative damage (reduce MDA); by repairing intestinal barrier integrity, regulating bile acid metabolism and SCFAs-GPCR pathway, and blocking LPS translocation-mediated liver injury.

[0026] In summary, the application provides a new nutritional intervention strategy for the prevention and treatment of T2DM and its liver complications. BRIEF DESCRIPTION OF DRAWINGS

[0027] In order to more clearly illustrate the technical solutions of the embodiments of the application, the drawings needed in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are some embodiments of the application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0028] Figure 1 The chemical structural formula of fucoidan Fuc-S.

[0029] Figure 2 The results of Fuc-S improving the metabolic parameters of STZ / HFD-induced diabetic mice. In the figure, (A) is the change of body weight of mice at the starting point (0 weeks) and the endpoint (5 weeks); (B) is the change of food intake of mice; (C) is the fasting blood glucose level; (E) is the oral glucose tolerance test (OGTT) result; (F) is the area under the blood glucose curve (AUC). The T2DM model is established by 4 weeks of high-fat diet combined with STZ intraperitoneal injection (25 mg / kg / day, continuously for 3 days). Diabetic mice with fasting blood glucose ≥11 mmol / L (for 7 days) are treated with Fuc-S or metformin for 5 weeks. The metabolic parameters are monitored every week (n=8, mean ± standard error). #p<0.05, ####p<0.001 vs normal group; p<0.05, **p<0.001, ****p<0.0001 vs model group. Grouping: Con (normal control), Mod (model), Met (metformin), P-H / L (high / low dose of Fuc-S).

[0030] Figure 3 Results of Fuc-S improving dyslipidemia in diabetic mice. In the figure, (A) is the result of triglyceride (TG); (B) is the result of total cholesterol (TC); (C) is the result of high-density lipoprotein (HDL); (D) is the result of low-density lipoprotein (LDL). After the establishment of the T2DM model (4 weeks of HFD+STZ [25 mg / kg, continuously for 3 days]), mice with fasting blood glucose ≥11 mmol / L (for 7 days) were treated with Fuc-S or metformin for 5 weeks. The serum lipids were detected using a commercial kit (n=8, mean ± standard error). ##p<0.01, ####p<0.001 vs normal group; *p<0.05, **p<0.01, ***p<0.001 vs model group.

[0031] Figure 4 Results of Fuc-S reducing diabetic-related liver damage. In the figure, (A) is a representative picture of H&E staining of liver tissue (scale bar 100 μm); (B) is the liver-body ratio; (C) is the serum AST and ALT levels. The model was established and treated as before. Liver and serum analysis (n=8, mean ± standard error). ##p<0.01, ####p<0.001 vs normal group; *p<0.05, **p<0.01, ***p<0.001 vs model group.

[0032] Figure 5 Results of Fuc-S improving liver antioxidant capacity and reducing inflammation. In the figure, (A) is the SOD level; (B) is the GSH-Px level; (C) is the CAT activity; (D) is the MDA content; (E) and (F) are the IL-6 and TNF-α levels, respectively. The model was established and treated as before. Liver tissue analysis after treatment (n=8, mean ± standard error). ####p<0.001 vs normal group; *p<0.05, **p<0.01, ***p<0.001 vs model group.

[0033] Figure 6 Effects of Fuc-S on the intestinal microbial community of diabetic mice; in the figure, (A, B) are the Chao index and Shannon index reflecting the microbial community, respectively; (C) is the microbial community structure of different treatment groups; (D) is the relative abundance of each bacterial family in different treatment groups; (E) is the relative abundance of each bacterial genus in different treatment groups; (F) is the relative abundance of specific bacteria (Ruminococcus_gnavus, Bacteroides_acidifaciens, and others) in different treatment groups; *p<0.05, **p<0.01 vs model group. Grouping: Con (normal control), Mod (model), Met (metformin), P-H (Fuc-S high dose).

[0034] Figure 7 Results of the effect of Fuc-S on SCFAs (acetic acid, propionic acid and butyric acid / isobutyric acid). Group: Con (normal control), Mod (model), Met (metformin), P-H (Fuc-S high dose). #p<0.05, ##p<0.01 vs normal group; *p<0.05 vs model group.

[0035] Figure 8 Results of the effect of Fuc-S on intestinal tissue morphology, serum indicators and tight junction protein expression. In the figure, (A) from left to right are the intestinal tissue morphology microscope images of Con (normal group), Mod (model group) and P-H (Fuc-S high dose); (B) is the content of FD4 in serum; (C) from left to right are the expression levels of ZO-1, Occludin and Claudin-2 mRNA in different groups; (D) is the expression level of Occludin protein, GAPDH as internal reference. #p<0.05, ##p<0.01, ###p<0.005 vs normal group; *p<0.05 vs model group. DETAILED DESCRIPTION

[0036] The technical solutions in the embodiments will be described clearly and completely below with reference to the drawings in the embodiments of the present application. Obviously, the embodiments described below are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0037] It should be understood that, when used in the specification and the appended claims, the terms "comprise" and "include" indicate the presence of described features, integers, steps, operations, elements, and / or components, but do not exclude one or more other features, integers, steps, operations, elements, components, and / or groups thereof.

[0038] It should also be understood that the terms used in the specification of the embodiments of the present application are only for the purpose of describing specific embodiments and are not intended to limit the embodiments of the present application. As used in the specification of the embodiments of the present application and the appended claims, unless otherwise clearly indicated by the context, the singular forms "a", "an" and "the" are intended to include the plural forms.

[0039] The following are the experimental materials and sources involved in the embodiments of the present application:

[0040] Fucoidan from Fucus vesiculosus was purchased from Yixin Biotech Co., Ltd. (Shanghai, China). Streptozotocin (STZ), metformin (Met), hematoxylin and eosin were purchased from Sigma-Aldrich (Missouri, USA). High-fat diet (HFD, #12492) was provided by Research Diets (Pennsylvania, USA). Superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GSH-Px), malondialdehyde (MDA), aspartate aminotransferase (AST), alanine aminotransferase (ALT), triglyceride (TG), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) ELISA detection kits were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) ELISA kits were purchased from Shanghai Jianglai Biotech Co., Ltd. Short-chain fatty acid standards (acetic acid, propionic acid, isobutyric acid, and butyric acid) were purchased from Aladdin (Shanghai, China), and 2-ethylbutyric acid was purchased from Merck (Germany). The QIAquick Gel Extraction Kit was purchased from QIAGEN (Germany), and the DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0041] Example 1 Preparation and characterization of Fuc-S

[0042] In this example, Fuc-S was extracted from commercially available Fucus vesiculosus by ultrasonic degradation according to the method reported in the literature, such as Xiao et al. in Marine Drugs (DOI: 10.3390 / md21010016). The structural formula of Fuc-S is shown in Figure 1 , and its molecular backbone is →3)-α-L-Fucp-(1→, →4)-α-L-Fucp-(1→ and →3,4)-α-D-Glcp-(1→. The molecular weight of Fuc-S was determined to be 156 kDa by high-performance size exclusion chromatography-multiple-angle laser light scattering (HPSEC-MALLS) technology. Monosaccharide composition analysis showed that Fuc-S was composed of glucose, galactose, xylose, rhamnose, mannose, galacturonic acid, and glucuronic acid, with a molar ratio of 0.49:0.28:0.12:0.01:0.02:0.04:0.01:0.02.

[0043] Example 2 Animal experiments with Fuc-S prepared in Example 1

[0044] Construction of experimental model: The experimental protocol of this invention was approved by the Experimental Animal Ethics Committee of Peking University / Hong Kong University of Science and Technology Medical Center in Shenzhen (approval number: 2021-791). Male C57BL / 6J mice (21±1 g) at 6-7 weeks of age were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (license number: SCXK Jing 2021-0006). After 1 week of adaptive feeding, 8 mice were randomly selected as the normal control group (Con), and the remaining mice were fed a high-fat diet for 4 weeks and then intraperitoneally injected with STZ (25 mg / kg) for 3 consecutive days to establish a T2DM model. A fasting blood glucose level ≥ 11.1 mmol / L was used as the standard for successful modeling. Thirty-two diabetic mice were randomly divided into 4 groups: model group (Mod), metformin group (Met, 250 mg / kg), low-dose Fuc-S group (P-L, 100 mg / kg), and high-dose Fuc-S group (P-H, 200 mg / kg), and continuously administered by gavage for 5 weeks.

[0045] Detection of metabolic parameters: The body weight, food intake, and fasting blood glucose of the mice were recorded weekly. Before the end of the experiment, the mice were fasted for 16 h for an oral glucose tolerance test (OGTT). After intragastric administration of a glucose solution (2 g / kg), the blood glucose levels were measured at 0, 30, 60, 90, and 120 min, and the area under the curve (AUC) was calculated to evaluate glucose tolerance.

[0046] Histopathological analysis: Liver and colon tissues were taken, fixed with 4% paraformaldehyde, embedded in paraffin, and sectioned (4-5 μm) for HE staining. Pathological evaluation was performed by an observer who was unaware of the grouping situation according to the standard.

[0047] Detection of biochemical indexes: Liver tissue was added to a protein extraction buffer containing protease / phosphatase inhibitors and homogenized, and the total protein concentration was determined by the BCA method. According to the kit instructions, the levels of SOD, CAT, GSH-Px, MDA, ALT, AST, and inflammatory factors (IL-6, TNF-α) in liver tissue, as well as the contents of serum AST, ALT, TG, LDL-C, and HDL-C, were detected respectively.

[0048] Fecal 16S rRNA gene sequencing analysis:

[0049] Total DNA was extracted from fecal samples using DNA extraction kit, and the quality and concentration of DNA were evaluated by measuring the absorbance ratios of 260 nm / 280 nm and 260 nm / 230 nm. The V3-V4 hypervariable region of 16S rRNA gene was amplified using specific primers 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT). The PCR products were purified by QIAquick Gel Extraction Kit, and after detecting the concentration by real-time quantitative PCR, they were subjected to double-end sequencing on the Illumina MiSeq PE300 platform. Bioinformatics analysis: the original fastq files were quality controlled using Cutadapt (v1.9.1), and UPARSE (v7.0.1001) was used to cluster operational taxonomic units (OTUs) at 97% similarity, UCHIME was used to remove chimeric sequences, and finally, species annotation was performed by RDP classifier (http: / / rdp.cme.msu.edu / ) based on the SILVA ribosomal RNA gene database.

[0050] Short-chain fatty acids (SCFAs) quantitative analysis:

[0051] Accurately weigh 100 mg of fecal sample, add 0.4 mL of deionized water, homogenize, acidify with 0.1 mL of 50% H2SO4, then add 0.5 mL of 2-ethylbutyric acid (internal standard), centrifuge at 12000 rpm at 4°C for 15 min, take the supernatant and extract with 0.5 mL of diethyl ether, and analyze using a Shimadzu GC-2010 Plus gas chromatograph equipped with an FID detector and a ZKAT-624 chromatographic column (30 m x 0.53 mm x 0.3 μm, Zhongke Antai). The carrier gas (nitrogen) flow rate is 6 mL / min (split ratio 10:1), the injection volume is 1 μL, and the injection port / detector temperature is 300°C. The program temperature is raised to 140°C for 13.5 min, then to 250°C at 120°C / min for 5 min. The data is analyzed using GCSolution software (Shimadzu).

[0052] RNA extraction and real-time quantitative PCR:

[0053] Total RNA was extracted from colon tissue, GAPDH was used as an internal reference, and quantitative analysis was performed using the 2-ΔΔCT method. The primer sequences are as follows:

[0054] Mouse ZO-1:

[0055] F: ACCCGAAACTGATGCTGTGGATAG;

[0056] R: GCTGGCTGGCTGTACTGTGAG),

[0057] Mouse occludin:

[0058] F: AGGCAGCCTCGGTACAGCAG;

[0059] R: AGGCAGCCTCGGTACAGCAG),

[0060] Mouse GAPDH:

[0061] F: CATCACTGCCACCCAGAAGACTG;

[0062] R: ATGCCAGTGAGCTTCCCGTTCAG).

[0063] Western blot analysis:

[0064] Cell or colon tissue proteins were collected, transferred to a membrane after SDS-PAGE electrophoresis, incubated with occludin diluted 1:1000 and GAPDH primary antibody (Cell Signaling Technology, USA), and then subjected to ECL staining. The bands were then analyzed by ImageJ software.

[0065] The data were analyzed using GraphPad Prism 6.0 software for one-way ANOVA. The data are expressed as mean ± standard error, and P < 0.05 was considered statistically significant.

[0066] Experimental results:

[0067] like Figure 2 As shown, although the body weight of mice in the Fuc-S treatment group increased only slightly and without statistical significance compared to the diabetic model group ( Figure 2 A), but it significantly improved the hyperphagia characteristic of diabetes, with effects comparable to metformin. Figure 2 B). Notably, after 5 weeks of treatment, both Fuc-S and metformin significantly reduced fasting blood glucose levels (P<0.001 or P<0.05 compared to the model group); Figure 2 C). The oral glucose tolerance test (OGTT) further confirmed the hypoglycemic effect of Fuc-S, showing that it not only improves impaired glucose tolerance but also significantly reduces the area under the blood glucose curve (AUC). Figure 2 E, 2F). These results collectively confirm that Fuc-S has a significant hypoglycemic effect in experimental type 2 diabetes mellitus (T2DM). This demonstrates the therapeutic effect of Fuc-S on STZ / high-fat diet-induced diabetic mice.

[0068] Diabetic dyslipidemia is characterized by elevated serum triglycerides (TG), total cholesterol (TC), and low-density lipoprotein (LDL), and decreased high-density lipoprotein (HDL), and is an important risk factor for cardiovascular complications. Figure 3 The results showed that Fuc-S intervention significantly reversed these abnormalities, restoring the lipid profile to near-normal levels. This indicates that Fuc-S exerts a dual benefit in the treatment of type 2 diabetes mellitus by simultaneously regulating glucose and lipid metabolism.

[0069] Systematic liver pathological evaluation showed that Fuc-S treatment significantly improved the characteristic lesions of diabetic liver disease. Figure 4 Histological analysis showed that Fuc-S could reduce lipid droplet accumulation and steatosis in hepatocytes. Figure 4 A), and restored the liver-to-body ratio to normal levels (P<0.05); Figure 4 B). Consistent with this, Fuc-S significantly reduced serum AST and ALT levels (key indicators of liver injury), confirming its hepatoprotective efficacy. Figure 4 C). This indicates that the Fuc-S provided by the present invention can alleviate diabetes-induced liver damage.

[0070] Mechanistic studies have found that Fuc-S restores the liver's redox balance by upregulating the activity of antioxidant enzymes (SOD, CAT, GSH-Px) and inhibiting the production of lipid peroxidation products (MDA). Figure 5 Meanwhile, the decrease in pro-inflammatory cytokine (IL-6, TNF-α) levels further indicates that Fuc-S alleviates diabetes-related liver injury through synergistic antioxidant and anti-inflammatory effects, and plays a role in regulating hepatic antioxidant defense and inflammatory response.

[0071] Figure 6 High-throughput sequencing results showed that Fuc-S did not change the overall α diversity (Chao1 / Shannon index); Figure 6 A, Figure 6 Under the premise of (B), selective remodeling of the gut microbiota was induced. PCA analysis confirmed significant changes in microbial community structure. Figure 6 C), scientifically speaking, this is manifested as the enrichment of beneficial bacteria such as Bacteroidaceae and Desulfovibrionaceae. Figure 6 D). More refined taxonomic analysis showed that Fuc-S promotes the proliferation of probiotics such as Bacteroides and Sutterella (at the genus level). Figure 6 E), in particular, significantly increased the abundance (species level) of Bacteroides acidifaciens, which has anti-diabetic properties; Figure 6 F). Fuc-S has the effect of remodeling the gut microbiota in diabetic mice.

[0072] Targeted metabolomics analysis showed that Fuc-S could reverse the decrease of physiologically active SCFAs (acetic acid, propionic acid and butyric / isobutyric acid) caused by diabetes( Figure 7 ), suggesting that it may exert therapeutic effects by regulating microbial metabolites.

[0073] Based on the promotion of SCFAs production, Fuc-S also improved the intestinal damage caused by diabetes( Figure 8 A、 Figure 8 B). Histopathology and molecular analysis showed that Fuc-S could restore the intestinal epithelial structure, reduce inflammatory infiltration, and up-regulate the expression of tight junction proteins (ZO-1, occludin) Figure 8 C、 Figure 8 D), which collectively confirmed its intestinal protection properties.

[0074] The above data demonstrate that fucoidan Fuc-S can significantly improve glycemic control (reduce fasting blood glucose, enhance glucose tolerance) and lipid profile (reduce TG, TC, LDL-C, and increase HDL-C) in diabetic mice, while reducing liver steatosis and lowering serum ALT / AST levels, showing significant liver protection. Mechanistically, Fuc-S regulates intestinal flora (enriching Bacteroides acidifaciens) and increases the production of short-chain fatty acids (SCFAs, including acetic acid, propionic acid and butyric acid), thereby reducing liver oxidative stress (restoring SOD / CAT / GSH-Px activity, reducing MDA) and inflammatory response (reducing IL-6 / TNF-α). These findings reveal that Fuc-S exerts multi-target therapeutic effects through the "intestinal flora-SCFA-liver" axis, providing a theoretical basis for the development of new therapeutic strategies for T2DM and its complications.

[0075] T2DM-related liver damage usually goes through the development process of NAFLD, liver fibrosis and even cirrhosis, and its pathogenesis involves insulin resistance, oxidative stress, chronic low-grade inflammation and intestinal flora imbalance. Histopathology results Figure 4 A) confirmed the characteristic vacuolation changes of hepatocytes in diabetic mice, highlighting the central role of lipid metabolism disorders. This metabolic abnormality is derived from three key pathological changes mediated by insulin resistance: (1) enhanced peripheral lipolysis leading to overflow of free fatty acids (FFA) to the liver; (2) activation of de novo lipogenesis in the liver through the SREBP-1c pathway; (3) impaired very low density lipoprotein (VLDL) secretion capacity. Notably, Fuc-S not only reduced serum TG levels, but also alleviated liver steatosis, indicating its ability to regulate the dynamic balance of liver lipid uptake, synthesis and output.

[0076] Excessive lipid accumulation in the liver leads to mitochondrial dysfunction and overproduction of reactive oxygen species (ROS). The data of the present invention show that the activities of antioxidant enzymes (SOD, CAT, GSH-Px) in the liver of diabetic mice are significantly reduced, and the level of MDA is increased ( Figure 5 ), confirming the central role of oxidative stress in diabetic liver disease. ROS exacerbates liver injury through multiple mechanisms: direct oxidative damage to cellular components, activation of inflammatory pathways (consistent with our observation of increased TNF-a and IL-6), induction of endoplasmic reticulum stress and apoptosis. Fuc-S can simultaneously improve oxidative and inflammatory markers, indicating its unique ability to break the vicious cycle of diabetic liver damage by synergistic antioxidant and anti-inflammatory effects.

[0077] Recent studies suggest that intestinal dysbiosis is the initiating factor of T2DM-associated liver injury. The 16S rRNA sequencing results of the present invention ( Figure 6 ) show that diabetic mice have significant dysbiosis, mainly manifested as a decrease in the abundance of SCFAs-producing bacteria (such as Bacteroides acidifaciens), which is consistent with clinical observations in T2DM patients. Intestinal dysbiosis affects liver physiology through the following pathways: (1) disruption of intestinal barrier function leading to LPS translocation, activation of Kupffer cells; (2) alteration of bile acid metabolism affecting the FXR signaling pathway; (3) weakening of SCFAs-mediated anti-inflammatory effects through G protein-coupled receptors. Fuc-S can maintain intestinal barrier integrity ( Figure 8 ) and increase SCFAs levels, confirming its mechanism of action through the gut-liver axis.

[0078] Compared with traditional hypoglycemic drugs, Fuc-S has unique multi-system regulation characteristics: (1) remodeling of intestinal flora (enriching beneficial bacterial families such as Bacteroidaceae); (2) regulating metabolism by increasing SCFAs levels; (3) directly reducing oxidative stress and inflammatory response to protect the liver. This comprehensive mode of action allows it to simultaneously intervene in multiple pathological aspects of T2DM-associated liver injury, which may be the reason why Fuc-S is superior to metformin ( Figures 4-5 ) in improving liver steatosis and inflammation. It is particularly noteworthy that Fuc-S can significantly enrich Bacteroides acidifaciens ( Figure 6 F) — a bacterial species that can improve insulin resistance and suppress intestinal inflammation by producing succinic acid — which may be a key mediator of the therapeutic effect of Fuc-S and is worth further study.

[0079] In summary, the present application demonstrates that low molecular weight fucoidan component Fuc-S has a significant protective effect on T2DM-induced liver injury. The main mechanism of action includes: remodeling the intestinal flora structure by specifically enriching Bacteroides acidifaciens and other beneficial bacteria, and promoting the production of short-chain fatty acids (SCFAs) with liver protection. These changes in flora and metabolism together improve the oxidative stress state of the liver, inhibit pro-inflammatory responses, and reduce lipid accumulation. The research results of the present application establish the molecular mechanism of Fuc-S exerting multi-target treatment effect through the "gut flora-short-chain fatty acid-liver" axis, and provide a new nutritional intervention strategy for the prevention and treatment of T2DM and its liver complications.

[0080] In the above embodiments, the description of each embodiment has its own focus, and the parts not described in detail in a certain embodiment can be referred to the relevant description of other embodiments.

[0081] The above is a specific embodiment of the present application, but the protection scope of the present application is not limited thereto, and any person skilled in the art can easily think of various equivalent modifications or replacements within the technical scope disclosed by the present application, and these modifications or replacements should be covered within the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.

Claims

1. Application of Fucoidan degradation product Fuc-S in the preparation of pharmaceutical compositions for the prevention, relief or treatment of type 2 diabetes.

2. Application of Fucoidan degradation product Fuc-S in the preparation of pharmaceutical compositions for the prevention, relief or treatment of liver injury.

3. The application according to claim 1, characterized in that, The liver injury is selected from one or more of the group consisting of fatty liver, hepatitis, liver fibrosis, and cirrhosis.

4. The application as described in claim 3, characterized in that, The fatty liver mentioned is non-alcoholic fatty liver disease.

5. The application as described in claim 4, characterized in that, The non-alcoholic fatty liver disease mentioned is diabetic non-alcoholic fatty liver disease.

6. The application as described in any one of claims 1-5, characterized in that, The pharmaceutical composition has one or more of the following characteristics (1) to (4): (1) Decreased serum ALT and / or AST concentrations (2) Increased concentration of short-chain fatty acids (SCFAs) (3) Increased abundance of Bacteroides acidifaciens in the gut. (4) Decreased concentrations of inflammatory factors IL-6 and / or TNF-α.

7. The application as described in claim 6, characterized in that, The short-chain fatty acids (SCFAs) include at least one of acetic acid, propionic acid, and butyric acid.

8. A food composition for preventing, alleviating, or treating type 2 diabetes, characterized in that, The food composition uses Fuc-S, a degradation product of fuc-polysaccharide, as its active ingredient.

9. A food composition for preventing, alleviating, or treating liver damage, characterized in that, The food composition uses Fuc-S, a degradation product of fuc-polysaccharide, as its active ingredient.

Images