Application of FveBRI1 gene in regulation and control of strawberry inflorescence branching

Abstract

The invention provides an application of an FveBRI1 gene in regulation and control of strawberry inflorescence branching, a coding sequence of the FveBRI1 gene is shown as SEQ ID NO.1, and an amino acid sequence of protein coded by the FveBRI1 gene is shown as SEQ ID NO.2. The invention further provides an application of the FveBRI1 gene in regulation and control of strawberry inflorescence branching. The research finds that the wild type inflorescence of the forest strawberry belongs to a top branching type, and the inflorescence is changed into a middle branching type and a base branching type after the FveBRI1 gene is mutated; in addition, FveBRI1 mutation also affects leaf development and leads to leaf rounding and middle small petiole elongation, the leaf mutation phenotypes enable mutants to be recognized in the seedling stage, and convenience is provided for early screening. From the aspect of application, the strawberry inflorescence structure can be optimized by regulating and controlling the expression of the FveBRI1, so that the yield and the quality of fruits are improved, and the FveBRI1 has a relatively great application prospect.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology technology, specifically involving FveBRI1 Application of genes in regulating strawberry inflorescence branching. Background Technology

[0002] Strawberries are an important economic crop of the Rosaceae family. Octoploid strawberries, with their large fruit and high yield, are the main species cultivated commercially. Forest strawberries, due to their small genome and short growth cycle, are often used as model plants for studying strawberry development. Strawberry inflorescences are cymose, and their development exhibits a clear hierarchical structure: flowers differentiate first at the apex of the inflorescence stalk, called primary flowers; subsequently, flowers develop on either side of the pedicel of the primary flowers, called secondary flowers; tertiary flowers can then form on either side of the pedicel of the secondary flowers, and so on, forming flowers of even higher orders. This branching pattern directly affects the flowering sequence and fruit size of strawberries. Based on the branching position of the inflorescence, strawberry inflorescences can be classified as apical branching, intermediate branching, and basal branching. Currently, most cultivated varieties have apical branching inflorescences, characterized by primary branching points near the apex, longer pedicels, and the largest fruits formed from primary flowers. However, as the order increases, fruit size decreases significantly, leading to an imbalance in yield and quality. In contrast, the fruit size difference between different orders of basal branching inflorescences is smaller and the distribution is more uniform, resulting in higher production potential, but its molecular regulatory mechanism is still unclear.

[0003] Existing research has found that FveTFL1 and FveFT Genes influence the timing of inflorescence branching termination and inflorescence complexity by regulating the activity of inflorescence meristems. However, research on the regulatory mechanisms of inflorescence branching types remains scarce.

[0004] Therefore, identifying the regulatory genes of strawberry inflorescence branching and elucidating their molecular mechanisms of action can not only enrich the theory of plant developmental biology, but also provide important targets for breeding high-yield and high-quality new strawberry varieties. Summary of the Invention

[0005] In view of this, the present invention has successfully isolated and identified key genes regulating strawberry inflorescence branching type. FveBRI1 This provides a new approach for cultivating high-yield and high-quality new strawberry varieties.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: One of the objectives of this invention is to provide FveBRI1 The application of genes in regulating strawberry inflorescence branching, the aforementioned FveBRI1 The gene coding sequence is shown in SEQ ID NO.1;

[0007] The second objective of this invention is to provide the above-mentioned FveBRI1 The application of a gene-encoded protein in regulating strawberry inflorescence branching, the amino acid sequence of which is shown in SEQ ID NO.2;

[0008] A third objective of this invention is to provide a gene expression cassette, the gene expression cassette comprising the above-mentioned... FveBRI1 Gene.

[0009] The fourth objective of this invention is to provide a recombinant expression vector, which includes the gene expression cassette described above.

[0010] The fifth objective of this invention is to provide an engineered bacterium, which includes the recombinant expression vector described above.

[0011] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention successfully isolated and identified key genes regulating strawberry inflorescence branching patterns. FveBRI1 This gene encodes a receptor for brassinolide. Studies have found that the wild-type inflorescence of forest strawberry is terminally branching, while... FveBRI1 After gene mutation, the inflorescence becomes either centrally branched or basally branched; in addition... FveBRI1 The mutations also affect leaf development, causing leaves to become rounder and the central petiole to elongate. These leaf mutation phenotypes allow mutants to be identified at the seedling stage, facilitating early screening. From an application perspective, by regulating... FveBRI1 The expression of this technology can optimize the structure of strawberry inflorescences, thereby improving fruit yield and quality, and has great application potential. Attached Figure Description

[0012] Figure 1 This is a comparison diagram of the wild-type and mutant inflorescence results in Example 1 of the present invention; Figure A shows a schematic diagram of three inflorescence patterns of strawberry (PF: primary flower; SF: secondary flower; TF: tertiary flower). Figure B shows the inflorescence types of wild-type and mutant plants (YW, bbi2-1 , Rügen and bbi2-2 (type 1 to 4 inflorescences). Figure C shows the inflorescence peduncle and pedicel lengths (YW) for wild-type and mutant varieties. bbi2-1 , Rügen and bbi2-2 (inflorescence peduncle and pedicel length); Figure D shows the proportional distribution of wild-type and mutant inflorescence types (YW, bbi2-1 , Rügen and bbi2-2 (Proportional distribution of the four inflorescence types in China).

[0013] Figure 2 The wild-type YW and mutant in Example 1 of this invention bbi2-1 Leaf phenotypes; where Figure A shows YW and bbi2-1Mature plant and leaves, arrows indicate petioles of the middle leaflets, scale bar: 5 cm; Figure B shows YW and bbi2-1 The leaf length-to-width ratio; C:YW and bbi2-1 The length of the petiole.

[0014] Figure 3 The mutant in Example 1 of this invention bbi2-1 and bbi2-2 The results of the localization of mutagenic genes; Among them, Figure A is bbi2-1 Distribution of associated ΔSNP indices across the seven chromosomes of *Strombocybe spp.* Figure B is FveBRI1 Gene and protein structures and mutation sites; Figure C is FveBRI1 Phylogenetic tree analysis.

[0015] Figure 4 In Embodiment 1 of the present invention FveBRI1 Inflorescence and leaf phenotypes of gene overexpression; where Figure A represents 35S: BRI1 (#1 and #2) Comparison of inflorescence phenotypes with wild-type (H4) plants, scale bar: 5 cm; Figure B shows H4, 35S: BRI1 Measurements of the lengths of fully developed peduncles and peduncles in #1 and #2; Figure C shows the RT-qPCR detection. FveBRI1 In H4, 35S: BRI1 Relative expression levels in leaves #1 and #2; Figure D shows mature plants and leaves of H4 and 35S:BRI1#2, scale bar: 5 cm; Figure E represents H4 and 35S: BRI1 The aspect ratio of the #2 leaf blade; Figure F shows H4 and 35S: BRI1 #2 petiole length. Detailed Implementation

[0016] The present invention will be further described in detail below with reference to specific embodiments, so that those skilled in the art can more clearly understand the present invention. Unless otherwise specified, the technical means used in the following embodiments are all conventional means well known to those skilled in the art, and all reagents and consumables are commercially available products.

[0017] Example 1 This embodiment provides FveBRI1 The specific steps for gene screening and function determination are as follows: 1.1 Construction of Mutant Materials Wild-type forest strawberries all have terminally branched inflorescences. The forest strawberry materials used in this embodiment include three wild types: Yellow Wonder (YW, white fruit, no runners, terminally branched inflorescence), Rügen (red fruit, no runners, terminally branched inflorescence), and Hawaii4 (H4, with runners, terminally branched inflorescence). Through EMS mutagenesis of the wild types, two mutant materials with basally branched inflorescences were screened from the M2 generation materials. basal-branching inflorescence ) bbi2-1 (EMS-induced mutagenesis, YW background) and bbi2-2 (EMS mutagenesis, Rügen background). The growth environment throughout the mutagenesis process was a temperature of 22°C and a light intensity of 100 μmol m... -2 s -1 The photoperiod is 16 hours of light and 8 hours of darkness.

[0018] 1.2 Morphological Analysis 1.2.1 Statistical analysis of inflorescence structural characteristics: The lengths of the peduncle and pedicels of fully developed wild-type and mutant inflorescences were measured and statistically analyzed to identify differences. The proportions of different inflorescence branching types were also statistically analyzed to assess the impact of mutations on inflorescence structure.

[0019] 1.2.1 Leaf morphology analysis: The aspect ratio and petiole length of wild-type and mutant leaves were measured to analyze the effect of mutation on leaf morphogenesis.

[0020] The following results were obtained through morphological observation: In a strawberry inflorescence, the structure supporting the entire inflorescence and connecting it to the stem is called the peduncle, the small branch supporting each flower is called the pedicel, and the structure connecting the peduncle and the pedicel is called the rachis. Based on the branching positions of the rachis and pedicel, strawberry inflorescences are generally classified into three types: apical branching, mid-branching, and basal branching. Figure 1 A). The wild-type YW and Rügen inflorescences are terminally branched, characterized by long peduncles. The mutants screened by EMS mutagenesis... bbi2-1 and bbi2-2 The inflorescence peduncle is relatively short, while the pedicel is relatively long ( Figure 1 BC). To further classify inflorescence branching types, this invention divides inflorescences into four categories: type 1: long peduncle, short pedicel (wild type); type 2: short peduncle, long pedicel; type 3: long pedicel (with a rachis but no peduncle); type 4: only pedicel (no pedicel and rachis). Compared to the wild type, bbi2-1 and bbi2-2 The proportion of type 2-4 inflorescences is higher, among which bbi2-2 The proportion of type 4 inflorescences is higher than bbi2-1 The higher the value, the more likely it is to indicate bbi2-2 The mutant phenotype is stronger ( Figure 1 B, D). In addition, bbi2-1 and bbi2-2 It also exhibits a mutant phenotype characterized by rounded leaves, elongated middle petioles, and shortened petioles. Figure 2 (AC). These results demonstrate the differential elongation of the peduncle and pedicel. bbi2-1 and bbi2-2 The main reasons for the variation in inflorescence structure in mutants.

[0021] 1.2 Allele Testing Will bbi2-1 and bbi2-2 The mutants were backcrossed to obtain the F1 generation, and their leaf and inflorescence phenotypes were observed. It was found that the F1 population all exhibited the mutant phenotype, indicating that... bbi2-1 and bbi2-2 It is caused by the same gene mutation. Furthermore, bbi2-1 The mutant was crossed with the wild-type YW to obtain the F1 generation, all of which were wild-type. The F2 generation, obtained by self-crossing the F1 generation, exhibited phenotypic segregation with a mutant:wild-type ratio of 38:132, close to 1:3, which passed the chi-square test (χ²). 2 =0.64, χ 2 0.05= 3.84), Explanation bbi2-1 Mutants are recessive genetic traits controlled by a single gene.

[0022] 1.3 Localization of Mutagenic Genes First, with mutants bbi2-1 Using wild-type YW as the male parent, crosses were performed to obtain the F1 generation. After self-pollination, the F2 generation was obtained. Within the F2 generation, the plants were divided into mutant and wild-type pools based on phenotype. Equal amounts of leaves from 20 plants in each pool were mixed, and genomic DNA was extracted using the CTAB method. After the genomic DNA quality was verified, paired-end library construction and sequencing were performed using the Illumina HiSeq X Ten platform by Beijing Novogene Biotechnology Co., Ltd. The sequencing data were then analyzed using bioinformatics methods to identify mutagenic genes. First, the sequenced reads were aligned to the Forest Strawberry version 4 (v4.0) genome using Bowtie2. Then, SNPs were searched using Samtools. The following principles were followed in the SNP localization process: (1) The SNP changes from G to A or from C to T; (2) The homozygosity of this SNP is 100% in the mutant pool and less than 50% in the wild-type pool; (3) Prioritize the coding area.

[0023] After screening for candidate SNPs, DNA from other unsequencing mutant phenotype individuals was extracted from the F2 segregating population and used as templates. Primers were designed to amplify the candidate SNPs using polymerase chain reaction (PCR), and the amplified fragments were then sequenced using Sanger sequencing to further confirm their identity. bbi2-1 Mutant genes.

[0024] Mixed-pool sequencing results showed that: bbi2-1 The candidate mutation site is located on chromosome 1 ( Figure 3 A), further localization revealed that the mutagenic gene was FvH4_1g23130, which underwent a C-to-T mutation at base 830, resulting in the 227th amino acid changing from serine to phenylalanine. bbi2-2 Sanger sequencing revealed a C-to-T mutation at nucleotide 133 of the same gene, causing the 45th amino acid to change from leucine to phenylalanine. Figure 3 B). FvH4_1g23130 is Arabidopsis thaliana. BRI1 The homologous gene was therefore named FveBRI1 (The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2). This gene encodes a brassinolide receptor, and there are two other genes with high homology in forest strawberries. FveBRL1 and FveBRL2 , possibly with FveBRI1 There is functional redundancy ( Figure 3 C).

[0025] 1.4 Verification FveBRI1 Genes can regulate strawberry inflorescence branching Furthermore, in order to verify FveBRI1 Genes can regulate strawberry inflorescence branching, so we constructed overexpression plants for analysis.

[0026] 1.4.1 Construction FveBRI1 Overexpression vector The pENTR1A vector plasmid was double-digested with SalI and XhoI, and then according to... FveBRI1 Primers were designed based on the coding sequence and the pENTR1A vector sequence to amplify molecules containing homologous arms. FveBRI1 The full-length sequence (using YW cDNA as a template) was used, and primers were designed to amplify the 3×HA tag sequence fused to it. FveBRI1 After obtaining the full-length sequence (using pH7LIC8.1 plasmid as a template), the required primers are as follows: BRI1-overlap-F: AAAGGAACCAATTCAGTCGAC AAGATGAAACCCCACAGACC; BRI1-nonstop-R: CTGCTTGCCCGGTTCAGGGT; 3×HA-overlap-F: ACCCTGAACCGGGCAAGCAG GTCGACAGGCCTCTTCCCTAT; 3×HA-overlap-R: GCTGGGTCTAGATATCTCGAG AGCATGGCCGCGGGATATCA.

[0027] In this text, the underlined lines represent the homologous arms on the pENTR1A vector, and the wavy lines represent the SalⅠ and XhoⅠ restriction sites, respectively.

[0028] The PCR system is as follows:

[0029] The amplification kit used in the above PCR system is Phanta Max Super-Fidelity DNA Polymerase (Vazyme, P505).

[0030] The PCR reaction procedure is as follows:

[0031] The two amplified fragments were purified with the enzyme-digested pENTR1A vector and then subjected to homologous recombination to generate an Entry clone. The Entry clone was then subjected to an LR reaction with the final vector pK7WG2D to finally generate... FveBRI1 The overexpression vector pK7WG2D-BRI1.

[0032] 1.4.2 Stable transformation of forest strawberries The Agrobacterium-mediated transformation of forest strawberry callus was employed, and the specific operational steps are as follows: Preparation of sterile seedlings: Place the seeds of forest strawberries in centrifuge tubes and soak them in 2% sodium hypochlorite for 4-5 minutes (shaking). Observe the seed coat discoloration, then blot dry the sodium hypochlorite. Wash the seeds 4-5 times with sterile water, blot dry the sterile water, and sow the seeds on petri dishes containing 1 / 2 MS medium (MS 2.22 g / L + sucrose 20 g / L + agar 7 g / L, pH 5.8). After culturing at 4℃ for 14 days, transfer them to a tissue culture room for germination. When two true leaves have grown, transfer them to tissue culture bottles containing 1 / 2 MS medium for later use.

[0033] Callus culture: In a clean bench, cut the leaves of the sterile seedlings with scissors and cut them into several small pieces (each leaflet was cut about 3 times). Place them on 5++ medium (MS 4.44 g / L + sucrose 20 g / L + agar 7 g / L + indolebutyric acid 0.3 mg / L + 6-benzylaminopurine 3.4 mg / L, pH 5.8), with about 20 pieces on each plate, with the upper surface of the leaves facing down. Incubate in the dark at 22℃ for 15-30 days until callus tissue grows from the cut.

[0034] Preparation of bacterial culture: Transform the overexpression vector pK7WG2D-BRI1 plasmid into Agrobacterium strain GV3101, pick positive single clones and place them in 10 mL of liquid LB medium containing resistance (yeast extract 5 g / L + peptone 10 g / L + NaCl 10 g / L + rifampin 50 μg / mL + spectinomycin 50 μg / mL), and shake overnight at 28°C.

[0035] Transformation: Centrifuge to collect Agrobacterium culture, discard the supernatant, and resuspend the cells in 50 mL of infiltration buffer (liquid MS + acetylsalicylic acid 500 mg / L) to allow OD to reach the target concentration. 600 When the pH reaches approximately 0.6, shake at 28°C in the dark for 3 hours. Then add callus tissue to approximately 6 culture dishes, shake gently at room temperature in the dark for 1 hour, wash the callus tissue 2-3 times with sterile water, blot dry the surface moisture with filter paper, place on 5++ culture medium with the leaf face down, and co-culture at room temperature in the dark for 3-5 days.

[0036] Cleaning the callus: After co-culturing for 3-5 days, Agrobacterium tumefaciens will be generated near some of the callus. The callus will be cleaned with sterile water 3-4 times, blotted dry with filter paper, and placed on CT medium (MS 4.44 g / L + sucrose 20 g / L + agar 7 g / L + indolebutyric acid 0.3 mg / L + 6-benzylaminopurine 3.4 mg / L + carbenicillin 250 mg / L + termethin 250 mg / L, pH 5.8). After 7 days of treatment at room temperature in the dark, the callus will be transferred to the growth chamber for further culture (growth chamber: 16 h light, 8 h dark, 22℃).

[0037] Subculture: After culturing on CT medium for 14 days, the callus tissue was transferred to resistance medium (MS 4.44 g / L + sucrose 20 g / L + agar 7 g / L + indolebutyric acid 0.3 mg / L + 6-benzylaminopurine 3.4 mg / L + carbenicillin 250 mg / L + termethin 250 mg / L + kanamycin 5 mg / L, pH 5.8). The medium was changed every month thereafter until the callus differentiated into shoots.

[0038] Rooting culture: After the callus produces shoots, the shoots are cut off from the tissue and transferred to rooting medium (1 / 2 MS 2.22 g / L + glucose 20 g / L + agar 7 g / L + indolebutyric acid 0.1 mg / L + carbenicillin 200 mg / L + termethin 200 mg / L + kanamycin 5 mg / L, pH 5.8) for culture until roots are formed.

[0039] 1.4.3 Positive identification of transgenic plants Genomic DNA was extracted from leaves of transgenic plants exhibiting green fluorescence and used as a template. Primers were designed to amplify the vector and gene sequences separately using the overexpression vector pK7WG2D-BRI1. Plants that amplified the correct size band were confirmed as positive transgenic plants. The primers used are as follows: BRI1-F: ATGAGTGCAATGGACACTCAT; pK7WG2D-R: GATTTTTTGCGGACTCTAGCAT.

[0040] The PCR system is as follows:

[0041] The amplification kit used in the above PCR system is Phanta Max Super-Fidelity DNA Polymerase (Vazyme, P505).

[0042] The PCR reaction procedure is as follows:

[0043] RNA was extracted from leaves of positive transgenic plants and wild-type H4 plants, and the resulting cDNA was obtained by reverse transcription. This cDNA was then used as a template for real-time quantitative PCR (RT-qPCR). In positive transgenic plants... FveBRI1 The transcriptional level should be significantly higher than that of wild-type H4, and the primers used are as follows: 11892-qRT-F:AGCCTAACGCAGAGGTTCCAAA; 11892-qRT-R:GCAGCCCACATTGAAGGGTCTATAGT; BRI1-qRT-F: TGAATGGTTCAATCCCTCCTGG; BRI1-qRT-R:CCATGGCACTCCTTACTTCCAT.

[0044] The PCR system is as follows:

[0045] The PCR system described above uses the PerfectStart Green qPCR SuperMix (Transgen, AQ601) amplification kit.

[0046] The PCR reaction procedure is as follows:

[0047] Finally, under the wild-type H4 background, two independent overexpression lines (35S:BRI1#1 and #2) were successfully obtained by stable transformation of the overexpression vector pK7WG2D-BRI1. Phenotypic analysis showed that the inflorescence peduncles of these two overexpression lines were significantly shortened compared with wild-type H4. Figure 4 (AB), but the inflorescence type remained type 4. Notably, these transgenic plants also exhibited narrower leaves and longer petioles, which is consistent with... bbi2 The mutant phenotypes show a clearly opposite trend ( Figure 4 DF). RT-qPCR analysis confirmed that in both overexpression lines FveBRI1 The transcriptional level was significantly higher than that of wild-type H4 ( Figure 4 C) indicates that the overexpression vector performed its intended function. In summary, FveBRI1 The results of gene mutation and overexpression experiments showed that FveBRI1 Genes play a crucial role in the formation of inflorescence structure.

[0048] The above series of experiments demonstrate that this invention has successfully isolated and identified key genes regulating strawberry inflorescence branching patterns. FveBRI1 This gene encodes a receptor for brassinolide. The wild-type inflorescence of forest strawberry is terminally branching, while... FveBRI1 After gene mutation, the inflorescence becomes either centrally branched or basally branched. Furthermore, FveBRI1 The mutations also affect leaf development, causing leaves to become rounder and the central petiole to elongate. These leaf mutation phenotypes allow mutants to be identified at the seedling stage, facilitating early screening. From an application perspective, by regulating... FveBRI1 The expression of this technology can optimize the structure of strawberry inflorescences, thereby improving fruit yield and quality, and has great application potential.

[0049] Unless otherwise specified, all raw materials used in this invention are existing substances that can be purchased directly from the market.

[0050] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. FveBRI1 The application of genes in regulating strawberry inflorescence branching is characterized by, The FveBRI1 The gene coding sequence is shown in SEQ ID NO.

1.

2. The claim 1 FveBRI1 The application of gene-encoded proteins in regulating strawberry inflorescence branching is characterized by, The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. A gene expression cassette, characterized in that, The gene expression cassette comprises the one described in claim 1. FveBRI1 Gene.

4. A recombinant expression vector, characterized in that, The recombinant expression vector includes the gene expression cassette as described in claim 3.

5. An engineered bacterium, characterized in that, The engineered bacteria include the recombinant expression vector described in claim 4.

Images