Application of CsTPS7 protein in regulation and control of citrus sesquiterpene component and / or improvement of citrus canker resistance
By overexpressing CsTPS7 protein in citrus, the synthesis of sesquiterpenes was promoted, which solved the problems of citrus canker resistance and aroma quality improvement, and achieved the effect of enhancing the content of sesquiterpenes and resistance in citrus.
Patent Information
- Application Number
- CN202511336862.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-18
- Publication Date
- 2025-11-28
AI Technical Summary
There are few reports on the cloning of citrus terpene synthase genes and their effects on resistance to pathogens and improvement of aroma quality in the current technology, making it difficult to achieve both resistance to citrus canker and improvement of aroma quality at the same time.
By overexpressing CsTPS7 protein, the content of sesquiterpenoid components in citrus was increased. Recombinant expression vectors and recombinant bacteria were then introduced into citrus to promote sesquiterpenoid synthesis and enhance the resistance of citrus to citrus canker.
It significantly increased the content of sesquiterpenes in citrus fruits, improved aroma quality, and significantly enhanced resistance to citrus canker, reducing the area and severity of lesions.
Smart Images

Figure CN121022918A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of CsTPS7 protein in regulating sesquiterpene components in citrus and / or improving resistance to citrus canker. Background Technology
[0002] Terpenes are a wide variety of natural products with complex structures and broad biological activities. Based on the number of isoprene structural units in their structures, terpenes are classified into hemiterpenes (C5), monoterpenes (C10), sesquiterpenes (C15), diterpenes (C20), and their derivatives, which are produced by different terpene synthases (TPS). In plants, monoterpenes and sesquiterpenes are the main volatile compounds in the terpenoid family. Numerous studies have found that sesquiterpenes play an important role in plant disease prevention and the enhancement of aroma and flavor. For example, in Arabidopsis thaliana, sesquiterpene synthase genes... AtTPS21 Sesquiterpenes, including their metabolite β-caryophyllene, have been found to play a crucial role in plant resistance to bacterial pathogens. Citrus fruits are rich in sesquiterpenes, primarily including β-caryophyllene, α-cocoene, β-olene, α-linolene, and α-selenoene, with variations in the types found in different tissues. Disease resistance and aroma quality are two important target traits in citrus variety breeding. While the citrus genome contains numerous genes encoding terpene synthases, current research on the cloning of these genes and their effects on pathogen resistance and aroma enhancement is very limited. Summary of the Invention
[0003] The purpose of this invention is to provide the application of CsTPS7 protein in regulating sesquiterpene components in citrus and / or improving resistance to citrus canker. Overexpression of the gene encoding the CsTPS7 protein in citrus can promote the synthesis of sesquiterpene components in citrus, which is of great significance for improving the aroma of citrus; at the same time, it can improve the resistance of citrus to canker.
[0004] This invention provides the application of CsTPS7 protein in regulating the content of sesquiterpenoid components in citrus and / or resistance to citrus canker, the amino acid sequence of which is shown in SEQ ID NO.1.
[0005] As a preferred embodiment, the regulation includes: increasing the expression level of CsTPS7 protein, increasing the content of sesquiterpene components in citrus and / or resistance to citrus canker.
[0006] As a preferred embodiment, the sesquiterpene component includes sesquiterpenes and / or β-caryophyllene.
[0007] As a preferred embodiment, the nucleotide sequence of the gene encoding the CsTPS7 protein is shown in SEQ ID NO.2.
[0008] This invention also provides the application of CsTPS7 protein in cultivating citrus germplasm with high sesquiterpene content and / or high resistance to citrus canker, the amino acid sequence of which is shown in SEQ ID NO.1.
[0009] The present invention also provides a recombinant expression vector comprising a gene encoding the CsTPS7 protein; the amino acid sequence of the CsTPS7 protein is shown in SEQ ID NO.1.
[0010] The present invention also provides a recombinant bacterium, wherein the recombinant bacterium comprises the recombinant expression vector described in the above scheme.
[0011] The present invention also provides the application of the recombinant expression vector or the recombinant bacteria described above in improving the content of sesquiterpenoid components in citrus and / or resistance to citrus canker.
[0012] The present invention also provides a method for increasing the content of sesquiterpenoid components in citrus and / or resistance to citrus canker, comprising the following steps: introducing the recombinant expression vector or the recombinant bacteria described in the above scheme into citrus.
[0013] As a preferred embodiment, the citrus fruit includes citrus explants.
[0014] This invention provides the application of the CsTPS7 protein in regulating the content of sesquiterpenes in citrus and / or resistance to citrus canker. The amino acid sequence of the CsTPS7 protein is shown in SEQ ID NO.1. The CsTPS7 protein of this invention can promote sesquiterpene production in citrus. Overexpression vectors containing the CsTPS7 gene were transformed into citrus leaves for expression. Results showed that the expression level of the CsTPS7 gene in genetically transformed citrus leaves was upregulated by approximately 8-fold, and the β-caryophyllene content in the leaves increased by nearly 48-fold compared to the control group; the sesquiterpene content in transgenic citrus leaves was also significantly upregulated. This indicates that the CsTPS7 gene plays an important role in promoting the synthesis of citrus sesquiterpenes (especially β-caryophyllene) and can be used to regulate the aroma traits of citrus fruits. Furthermore, the transgenic plants obtained through transformation can significantly reduce the severity of citrus canker and decrease the area of lesions. Overexpression of the CsTPS7 gene can greatly improve the plant's resistance to citrus canker, which has significant application value for breeding citrus resistant to citrus canker. Attached Figure Description
[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0016] Figure 1 For the target gene CsTPS7 Agarose gel electrophoresis image of the amplification products; Figure 2 Genetically transformed citrus leaves CsTPS7 Relative gene expression levels; Figure 3 Phenotypic diagram of transgenic plants; Figure 4 Figure showing the results of GC-MS detection of sesquiterpenoid content in leaves of transgenic plants; Figure 5 Figure showing the results of GC-MS detection of β-caryophyllene content in leaves of transgenic plants; Figure 6 Symptoms of plants with overexpression of the causal agent canker 10 days after inoculation with the causal agent; Figure 7 A statistical chart showing the size of lesions on leaves of genetically modified citrus trees; Figure 8 A statistical chart showing the severity of disease (disease index) in leaves of genetically modified citrus trees; In the figure, * represents P <0.05, ** is P <0.01, *** is P <0.001. Detailed Implementation
[0017] This invention provides an application of CsTPS7 protein in regulating the content of sesquiterpenoid components in citrus and / or resistance to citrus canker, wherein the amino acid sequence of the CsTPS7 protein is shown in SEQ ID NO.1.
[0018] In one embodiment, the regulation includes: increasing the expression level of CsTPS7 protein to increase the content of sesquiterpenoid components in citrus and / or resistance to citrus canker. In another embodiment, the sesquiterpenoid components include sesquiterpenes and / or β-caryophyllene. The CsTPS7 protein of this invention can promote sesquiterpene production, increase the expression of CsTPS7 protein in citrus, thereby increasing the content of sesquiterpenoid components in citrus, improving resistance to citrus canker, and reducing lesion area and disease index.
[0019]
[0020] This invention also provides the application of CsTPS7 protein in cultivating citrus germplasm with high sesquiterpene content and / or high resistance to citrus canker, the amino acid sequence of which is shown in SEQ ID NO.1.
[0021] This invention also provides a recombinant expression vector containing a gene encoding the CsTPS7 protein; the amino acid sequence of the CsTPS7 protein is shown in SEQ ID NO.1. As one embodiment, the base vector of the recombinant expression vector includes the pNmGFPer vector, which is based on the pBI121 vector, with an EGFP gene inserted after position 7762, carrying the CaMV 35S promoter. The CaMV 35S promoter is a cauliflower mosaic virus promoter, a constitutive strong promoter isolated from cauliflower mosaic virus (CaMV), possessing the characteristic of driving the widespread expression of exogenous genes in plants.
[0022] The present invention also provides a recombinant bacterium comprising the recombinant expression vector described in the above-described scheme. As one embodiment, the base bacterium of the recombinant bacterium includes Agrobacterium.
[0023] The present invention also provides the application of the recombinant expression vector or the recombinant bacteria described above in improving the content of sesquiterpenoid components in citrus and / or resistance to citrus canker.
[0024] This invention also provides a method for increasing the content of sesquiterpenoid components and / or resistance to citrus canker, comprising the following steps: introducing the recombinant expression vector or the recombinant bacteria described in the above-described scheme into citrus. As one embodiment, the citrus includes citrus explants. The citrus explants of this invention can be cultured under in vitro conditions, facilitating the introduction of the recombinant expression vector, and the in vitro culture system is mature, enabling efficient regeneration of intact transgenic plants. As one embodiment, after the recombinant expression vector or the recombinant bacteria is introduced into the explant, the explant is cultured in vitro, subjected to fluorescence identification, and grafted to obtain transgenic plants. As one embodiment, the fluorescence identification includes real-time quantitative PCR; the real-time quantitative PCR is used to detect... CsTPS7 The primers used for gene expression level measurement have nucleotide sequences as shown in SEQ ID NO.6 (RT-F) and nucleotide sequences as shown in SEQ ID NO.7 (RT-R); the internal reference gene for the real-time quantitative PCR is citrus. Actin The gene was extracted using primers AC-F with nucleotide sequences as shown in SEQ ID NO.8 and AC-R with nucleotide sequences as shown in SEQ ID NO.9.
[0025] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0026] Example 1 Citrus CsTPS7 Cloning of gene coding sequences 1. RNA extraction and cDNA synthesis Total RNA was extracted from citrus (longleaf sweet orange) leaves using an RNA extraction kit (Adley, CAT: RN09). RNA quality was verified by agarose gel electrophoresis, and its concentration was determined using a concentration meter. cDNA was synthesized using recombinant DNase I (all reagents were purchased from TAKARA). The cDNA was stored at -20℃ for later use.
[0027] 2. CsTPS7 PCR amplification of gene coding sequences The CsTPS7 fragment was amplified from the citrus cDNA in step 1 using primers OE-F (SEQ ID NO.3: 5'-GGACAGGGTACCCGGGGATCCATGAGGGATCTTAAGAGTGTTCTTTC-3') and OE-R (SEQ ID NO.4: 5'-AGGGAATTCCTGCAGGTCGACTTACATGGGAAGAGGATCAACAAG-3'). The amplification results are shown below. Figure 1 As shown, the amplified fragment is 1704 bp in length (including restriction enzyme sites, SEQ ID NO.2), and the amplified DNA fragment, after sequencing analysis, is identified as citrus. CsTPS7 Gene coding sequence.
[0028] Amplification system: 10×PCR mix: 2.5 μL; primer OE-F (5 μmol / L): 1 μL; primer OE-R (5 μmol / L): 1 μL; cDNA approximately 60 ng; add dd Add H2O to 25 μL.
[0029] Amplification program: 94℃, 5 min; 94℃, 30 s, 56℃, 1 min 45 s, 72℃, 1.5 min, 35 cycles; extension at 72℃ for 10 min.
[0030] 3. DNA fragment recovery Under UV light, use a clean blade to cut off blocks of agarose gel containing the target fragment. Recover the fragments using a kit (Adley). CsTPS7 Gene fragments.
[0031] Example 2: Construction of overexpression vector and transformation of Agrobacterium tumefaciens All restriction endonucleases in this embodiment were purchased from Thermo Fisher Scientific and were used according to the instructions. The specific procedures are as follows: [The text then repeats the steps from Example 1.] CsTPS7 The gene fragment and the overexpression vector pNmGFPer were digested with restriction endonucleases BamHI and SalI, and then ligated overnight using the T4 DNA Ligase kit (purchased from TAKARA). The ligation product was transformed into E. coli DH5α, and plasmids were extracted from positive clones to obtain the CsTPS7 overexpression vector pNmGFPer-TPS7.
[0032] The overexpression vector pNmGFPer is based on the pBI121 vector, with the EGFP gene inserted after position 7762. It contains the CaMV 35S promoter, which is the promoter for cauliflower mosaic virus. The nucleotide sequence is shown in SEQ ID NO. 5: 5'-TGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACGCTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTG AAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGA AGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATAAGGAAGTTCATTTCATTTGGAG-3'.
[0033] Plasmid extraction was performed using a kit (Adley), and the constructed overexpression vector was introduced into Agrobacterium EHA105. After plaque growth, single colonies were picked for PCR verification. The primers used for PCR verification were OE-F (SEQ ID NO.3) and OE-R (SEQ ID NO.4).
[0034] PCR validation system: 2×Taq Master MIX (Novprotein) (10 μL), bacterial culture (1 μL), upstream primer (1 μL), downstream primer (1 μL), ddH2O (7 μL).
[0035] PCR validation procedure: 94℃ for 90s; 94℃ for 30s, 55℃ for 30s, 72℃ for 1000 bp / min, 32 cycles; 72℃ for 5 min; store at 4℃.
[0036] Example 3: Genetic Transformation of Citrus (Longleaf Orange) The culture media used in this experiment were: germination medium: MS 4.43 g / L, sucrose 30 g / L, agar 2.7 g / L.
[0037] Co-culture medium: MS 4.43 g / L, sucrose 30 g / L, agar 2.7 g / L, IAA 1 mL / L, IP 1 mL / L, 2,4-D 1 mL / L, AS 1 mL / L.
[0038] Screening medium: MS 4.43 g / L, sucrose 30 g / L, agar 2.7 g / L, IAA 0.5 mL / L, BA 1 mL / L, Cef 1.2 mL / L, Km 1 mL / L.
[0039] Seedling culture medium: MS 4.43 g / L, sucrose 50 g / L.
[0040] 1. Obtaining the hypocotyl from citrus seedlings Fresh citrus (longleaf sweet orange) fruits were washed, surface-sterilized with 70% alcohol, and seeds were extracted under aseptic conditions. The seed coat was removed, and the seeds were placed on germination medium to germinate. They were then cultured in the dark at 28°C for 2 weeks, followed by 1 week of 16 h light / 8 h dark conditions. Under aseptic conditions, the epicotyls of the germinating seedlings were cut into 1 cm stem segments for Agrobacterium tumefaciens genetic transformation.
[0041] 2. Preparation of Agrobacterium tumefaciens bacterial culture The Agrobacterium tumefaciens bacterial suspension (containing the CsTPS7 overexpression vector, prepared in Example 2) used for transfection was added to 30% sterile glycerol and stored in an ultra-low temperature incubator at -80°C. Before transfection, the suspension was streaked onto LB solid medium containing 50 mg / L kanamycin. Single colonies were picked and inoculated into 25 mL of LB liquid medium containing the same antibiotic, and cultured overnight at 28°C with shaking. After determining the concentration, the bacterial suspension was diluted to OD=0.1 and shaken twice at 28°C and 220 rpm. After about 3 h, when the bacterial suspension OD=0.5, it was centrifuged at 5000 r / min for 10 min, the supernatant was discarded, and the suspension was resuspended in MS liquid medium at pH 5.4 for transfection.
[0042] 3. Transformation of Citrus Epicotyl Stem Segments After soaking the citrus hypocotyl stem segments in Agrobacterium tumefaciens solution for 13 min and drying them, the stem segments were transferred to a co-culture medium and cultured in the dark at 26°C for 2 days.
[0043] 4. Screening of transformants After co-culture, the epicotyls were transferred to the selection medium and cultured in the dark at 28°C for 7 days. The exogenous bodies were cultured at 28°C with 16 hours of light and 8 hours of darkness. Subculture was performed every two weeks, and then the cells were preliminarily identified by green fluorescent protein.
[0044] 5. Seedling culture of transformants When the seedlings grow to more than 1 cm, they are cut off and grafted onto Late Orange seedlings in sterile test tubes and cultured in a seedling culture medium. When the seedlings grow to about 5 cm, they are grafted onto Trifoliate orange seedlings and cultured in a greenhouse to obtain transgenic lines OE1 and OE2. The grafting method can be any conventional method in this field.
[0045] Example 4: Validation of transgenic plants 1. Analysis of CsTPS7 gene expression levels Total RNA (Adelai, CAT No: RN09) was extracted from leaves of wild-type citrus line WT and transgenic lines OE1 and OE2, respectively, and cDNA was synthesized using recombinant DNase I. The expression levels of the target genes were detected by qRT-PCR using RT-F (SEQ ID NO. 6: 5'-AGCACTCCTCTAGCTGACCA-3') and RT-R (SEQ ID NO. 7: 5'-AGCTCTATCCGGTGTAACGC-3'). The detection primers for the internal reference gene Actin were AC-F (SEQ ID NO. 8: 5'-CATCCCTCAGCACCTTCC-3') and AC-R (SEQ ID NO. 9: 5'-CCAACCTTAGCACTTCTCC-3').
[0046] The reaction volume was 12 μL: 2×SP qPCR Mix (6 μL), H2O (3.4 μL), RTF (0.3 μL), RTR (0.3 μL), and cDNA sample (2 μL). Reaction conditions: 95℃ for 3 min; 94℃ for 10 s; 56℃ for 10 s; 72℃ for 10 s, 40 cycles; 72℃ for 10 min. The experiment was repeated three times.
[0047] Use 2 -△△Ct The relative expression level of the CsTPS7 gene in transgenic plants was calculated as follows: The water-treated sample was defined as the reference factor, with a CsTPS7 expression level of 1. The fold increase in gene expression relative to the reference factor in transgenic citrus was then calculated. -△△Ct The relative expression level is shown in Table 1. The detection results are shown in Table 1 and... Figure 2 As shown.
[0048] Table 1. Relative expression levels of the CsTPS7 gene in transgenic lines
[0049] According to Table 1 and Figure 2 It can be seen that the CsTPS7 gene is expressed at a high level in transgenic plants compared with wild-type plants (>7.9 times).
[0050] 2. Phenotypic observation of transgenic plants The phenotypes of two transgenic plants, OE1 and OE2, and the wild-type WT plant were observed and analyzed separately. The results are as follows: Figure 3 As shown in the figure. The results showed that the transgenic plants were not significantly different from the wild type in appearance and growth. This indicates that overexpression of the CsTPS7 gene did not produce direct and significant changes in the plant's phenotype and development.
[0051] Example 5: Detection of volatile substances in transgenic citrus leaves using GC-MS Leaves from the wild-type citrus line WT and the transgenic lines OE1 and OE2 were ground into fine powder using liquid nitrogen, and 0.5 g of each powder was transferred to a 2 mL microcentrifuge tube. 1 mL of n-hexane was added to the sample, and trans-2,4-nonadienal (Sigma) was added as an internal standard at a final concentration of 200 ppm. Extraction was performed by sonication at 4°C for 40 min. After extraction, the sample was centrifuged at 12,000 rpm for 1 min. 0.2 mL of the organic layer was collected and analyzed by GC-MS in full scan mode.
[0052] Citrus volatiles analysis conditions: HP-5MS column (50 m × 0.22 mm × 0.025 µm). Helium carrier gas flow rate was 0.7 mL / min. The following GC temperature program was used: hold at 50 °C for 3 min, then increase to 200 °C at a rate of 5 °C / min, then increase to 250 °C at a rate of 10 °C / min, and finally hold at 250 °C for 2 min. The injector and detector temperatures were 250 °C and 180 °C, respectively.
[0053] The results of GC-MS detection of sesquiterpenes and β-caryophyllene content in citrus leaves are shown in Table 2 and 3. Figures 4-5 As shown in the figure. The results indicated that the content of sesquiterpenes (i.e., total sesquiterpenes, OE1 of 153895.5 ng / g) in citrus leaves overexpressing CsTPS7 was significantly higher than that in the wild type (2122.3 ng / g). Figure 4 The β-caryophyllene content in citrus leaves of the transgenic line (OE1) (68674.1 ng / g) was significantly higher than that of the control group (CK) (1450.1 ng / g), being 47.36 times higher. Figure 5 ).
[0054] Table 2. Sesquiterpenes and β-caryophyllene content in transgenic lines
[0055] Example 6: Evaluation of resistance in transgenic plants Mature leaves of citrus wild-type line WT and transgenic lines OE1 and OE2 with consistent development were selected. The mature leaves were washed, disinfected with 75% alcohol, and rinsed with sterile water. They were then placed in a clean bench. Needling was performed centered on the leaf veins, with six needles per group, two groups per side. Samples with an OD value of 0.5 were then pipetted onto samples of citrus canker (…). Xanthomonas citri subsq. citri ) bacterial suspension, the pathogen of citrus canker is published in the literature [Wang Y, Fu XZ, Liu JH, HongL.2011.Differential structure and physiological response to canker challenge between 'Meiwa' kumquat and 'Newhall' navel orange with contrasting resistance. Scientia Horticulturae,128(20):115-113], 1 μL (1×10) was spotted in each pinhole 5CFU / mL). Cultured in a 28℃ constant temperature and light incubator (16 h light / 8 h dark). Leaves were photographed 10 days after incubation following inoculation. Figure 6 As shown, the lesion area was statistically analyzed using ImageJ V1.47 software. The experiment was repeated three times to ensure the accuracy of the results. The results are shown in Table 3 and... Figure 7 As shown.
[0056] The severity of the disease is calculated using the disease severity index formula: the disease is divided into grades 0 to 7 according to the area of the lesions, with the letter R representing the lesion area, grade 0 (R ≤ 0.25 mm). 2 Level 1 (0.25 mm) 2 <R≤0.5 mm 2 Level 2 (0.5 mm) 2 <R≤0.75 mm 2 Level 3 (0.75 mm) 2 <R≤1 mm 2 Level 4 (1.0 mm) 2 <R≤1.25 mm 2 Level 5 (1.25 mm) 2 <R≤1.5 mm 2 Level 6 (1.5 mm) 2 <R≤1.75 mm 2 Level 7 (R > 1.75 mm) 2 The severity of the disease was calculated using the formula: DI = 100 × Σ [number of lesions at each level × corresponding level value] / (total number of lesions × maximum level). The above experiment was repeated three times to ensure the accuracy of the results. The statistical results are shown in Table 3 and... Figure 8 As shown.
[0057] The results showed that 10 days after in vitro inoculation with *Cyclophorus ulcerans*, all inoculated plants developed the disease to varying degrees, with differences in lesion size. The lesion area of transgenic plants was significantly smaller than that of the empty vector control group, with OE2 plants showing even smaller lesions. Figure 7 Statistical analysis of the disease severity in transgenic plants revealed that the disease severity in transgenic plants was significantly lower than that in the empty vector control group, especially in OE2, where it was approximately 29% of that in the control group. Figure 8 ).
[0058] Table 3. Lesion area and disease index of transgenic lines
[0059] This demonstrates that overexpression of CsTPS can significantly reduce the lesion area of citrus bacterial canker and alleviate the severity of the disease.
[0060] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. The application of CsTPS7 protein in regulating the content of sesquiterpenoid components in citrus and / or resistance to citrus canker, wherein the amino acid sequence of the CsTPS7 protein is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, The regulation includes: increasing the expression level of CsTPS7 protein, increasing the content of sesquiterpene components in citrus and / or resistance to citrus canker.
3. The application according to claim 2, characterized in that, The sesquiterpene components include sesquiterpenes and / or β-caryophyllene.
4. The application according to any one of claims 1 to 3, characterized in that, The nucleotide sequence of the gene encoding the CsTPS7 protein is shown in SEQ ID NO.
2.
5. Application of CsTPS7 protein in the cultivation of citrus germplasm with high sesquiterpene content and / or high resistance to citrus canker, wherein the amino acid sequence of the CsTPS7 protein is shown in SEQ ID NO.
1.
6. A recombinant expression vector, characterized in that, The recombinant expression vector contains a gene encoding the CsTPS7 protein; the amino acid sequence of the CsTPS7 protein is shown in SEQ ID NO.
1.
7. A recombinant bacterium, characterized in that, The recombinant bacteria comprises the recombinant expression vector of claim 6.
8. The application of the recombinant expression vector of claim 6 or the recombinant bacteria of claim 7 in improving the content of sesquiterpenoid components in citrus and / or resistance to citrus canker.
9. A method for increasing the content of sesquiterpenoid components in citrus and / or resistance to citrus canker, characterized in that, The procedure includes the following steps: introducing the recombinant expression vector of claim 6 or the recombinant bacteria of claim 7 into citrus.
10. The method according to claim 9, characterized in that, The citrus fruits include citrus explants.