Wheat 5K low-density SNP chip based on targeted capture sequencing and application thereof

Abstract

The invention discloses a wheat 5K low-density SNP chip based on targeted capture sequencing and application thereof, and belongs to the field of wheat molecular genetic breeding. The chip contains 5486 SNP (Single Nucleotide Polymorphism) loci, and mainly comprises significant loci obtained based on AB-NAMIC and NP populations, SNP loci of 27 functional genes and polymorphic markers uniformly distributed on 4883 chromosomes. The genotyping point location is based on a Chinese spring wheat reference genome RefSeq v2.1. According to the 5K wheat molecular marker chip provided by the invention, the detection cost of a single sample is reduced to 100 RMB, the threshold of molecular breeding is greatly reduced, a solution with high cost performance is provided for a breeding unit in the aspects of material selection evaluation, group optimization, gene positioning and the like, and an important technical support is provided for molecular breeding of wheat.

Description

Technical Field

[0001] This invention relates to the fields of wheat molecular breeding and genotyping technology, specifically to a wheat 5K low-density SNP chip based on targeted capture sequencing and its applications. Background Technology

[0002] With the rapid development of high-throughput molecular breeding technology, microarray breeding has become an important means of modern wheat genetic improvement. Compared with whole-genome sequencing, microarrays have advantages such as low cost, high throughput, and high degree of data standardization, making them particularly suitable for breeding applications such as genetic diversity analysis of large-scale germplasm resources, genome selection (GS), and marker-assisted selection (MAS).

[0003] Currently, various high-density wheat genome chips are widely used in basic research and molecular marker development, but their high cost limits their widespread application in breeding practices. To improve the efficiency and economy of molecular breeding, there is an urgent need to develop a low-density chip that covers the entire genome, is cost-effective, and provides an appropriate amount of information. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to quickly and cost-effectively detect wheat agronomic traits.

[0005] To this end, in a first aspect, a chip for detecting wheat is provided, the chip comprising reagents for specifically detecting SNP sites; the SNPs consist of 5486 SNP sites listed in Table 1; the location information of the SNP sites is determined based on alignment with a wheat genome reference sequence, the wheat genome reference sequence being the Chinese spring wheat reference genome RefSeqv2.1 version.

[0006] In some specific embodiments of the present invention, the reagent is a probe.

[0007] In some specific embodiments of the present invention, the probe is single-stranded DNA.

[0008] In one specific embodiment of the present invention, the probes are designed based on the target sites in the SNP / InDel sites. The probes specific to the 5486 SNP sites in Table 1 are 5486 single-stranded DNAs, and the nucleotide sequence of each single-stranded DNA is complementary to its target sequence. The target site is located within a total range of 120 bp upstream and downstream of the location of the SNP site.

[0009] The starting and ending positions of the target points in the aforementioned chip are shown in Table 1.

[0010] In the aforementioned chip, the probe design method is as follows: Based on the 5486 SNP sites, a target site is selected within a total range of 120 bp upstream and downstream of the SNP site (as shown in Table 1). The target site covers the SNP site. One probe is designed for each target site, and the nucleotide sequence of the probe is complementary to the nucleotide sequence of the target site. To ensure that the target SNP is covered, probes are designed and screened for probes with a GC content of 40-60%, no repetitive sequences, no SSRs, and a distance of no less than 100 bp from the marker.

[0011] In the aforementioned chips, the location information of the loci and their targets in Table 1 was determined by comparison with the Chinese spring wheat reference genome RefSeqv2.1 (https: / / urgi.versailles.inra.fr / download / iwgsc / IWGSC_RefSeq_Assemblies / v2.1 / ). In Table 1, Chr1A, Chr1B, Chr1D, Chr2A, Chr2B, Chr2D, Chr3A, Chr3B, Chr3D, Chr4A, Chr4B, Chr4D, Chr5A, Chr5B, Chr5D, Chr6A, Chr6B, Chr6D, Chr7A, Chr7B, and Chr7D represent the chromosomes where the SNP sites are located.

[0012] In Table 1, under the “SNP Loci” column, the character before the colon (:) is the chromosome number, and the Arabic numeral after the colon (:) is the physical location of the SNP locus on that chromosome. The nucleotide after the Arabic numeral and before the ">" is the wild-type nucleotide, and the nucleotide after the ">" is the mutant nucleotide. For example, in “Chr1A:10956000G>A”, “Chr1A” represents chromosome 1A, and “10956000” indicates the specific location of the SNP locus on chromosome 1A in the Chinese Spring reference genome RefSeq v2.1. “G>A” indicates that the wild-type nucleotide at this SNP locus is G, and the mutant nucleotide is A.

[0013] In the target site diagram, the character before the "-" indicates the start position of the target site, and the character after the "-" indicates the end position. The target site is the location where the probe is designed for the preceding SNP site. The nucleotide sequence of the probe is complementary to the nucleotide sequence of the target site. The start and end positions of the target site, such as number 2746, correspond to positions 67248578 and 67248697 of chromosome 4A in the Chinese Spring reference genome RefSeq v2.1, respectively, with the nucleotide sequence (5'→3'): TGCAAGTCCAACTCTTAAATATGATACTTCATGTGTACTGGTTTCAGCACAGGTTACCACAATATTTTTTTACAATCCGGATGTATATAAATGTAGT GCTATAAGCTAAGCGGAACCACA (SEQ ID NO: 1). This sequence is complementary to the nucleotide sequence of the single-stranded DNA probe targeting this SNP, which has the probe sequence (5'→3'): TGTGGTTCCGCTTAGCTTATAGCACTACATTTATATACATCCGGATTGT AAAAAAATATTGTGGTAACCTGTGCTGAAACCAGTACACATGAAGTATCATATTTAAGAGTTGGACTTGCA (SEQ ID NO: 2).

[0014] It should be noted that, given the reference genome and its version number, and the specific location of the target site within it, obtaining the specific sequence information of each probe is very easy for those skilled in the art. Due to space limitations, the specific sequence information of each probe is not presented visually in this article.

[0015] As described above, the principle of liquid-phase microarray is to design probes near the target mutation site and hybridize them with the target fragment region of the genome. After elution, amplification, and library construction, all captured gene fragments are subjected to next-generation sequencing to obtain the genotype of the target mutation site. The specific steps are as follows: (1) First, extract the genomeic DNA of the test material, and then construct the genomic DNA library. According to the principle of DNA complementarity, design probes covering the target mutation site for each test site (including the 5486 SNP sites in Table 1 of this invention), and modify the target probes (i.e., the probes for the 5486 SNP sites in this invention) using biotin; (2) Add the biotin-modified probes and the genomic DNA library to the PCR solution so that the biotin-modified probes and the target segment of the genome form a hybrid double strand; (3) Use magnetic beads coupled with streptavidin to capture the hybrid double strands of the probes with biotin modification and the target segment of the genome; (4) Elute, amplify by PCR, and perform high-depth sequencing on the captured target sequence to identify the genotype of the target mutation site.

[0016] Furthermore, in the chip, each of the nucleotide probes is modified with biotin.

[0017] Accordingly, the chip also includes magnetic beads modified with streptavidin.

[0018] In one embodiment of the present invention, the chip is a liquid-phase probe hybridization chip.

[0019] Liquid-phase chips capture labeled probes in suspension solutions, overcoming the technical shortcomings of solid-phase chips such as poor repeatability, slow reaction rate, and poor flexibility. They have advantages such as high throughput, low cost, simple and quick operation, and flexible use.

[0020] Secondly, this invention provides the application of the chip described above in wheat breeding.

[0021] Thirdly, this invention provides the application of the chip described above in wheat genotyping detection.

[0022] In this application, the agronomic traits included in the genotyping are at least one of the following:

[0023] A1) Heading stage;

[0024] A2) Flowering period;

[0025] A3) Plant height;

[0026] A4) Ear length;

[0027] A5) Number of spikelets;

[0028] A6) Number of grains per ear;

[0029] A7) 1000-grain weight;

[0030] A8) Resistant to powdery mildew;

[0031] A9) Leaf rust;

[0032] A10) Particle length;

[0033] A11) Particle thickness;

[0034] A12) Protein sedimentation (quality trait).

[0035] Different SNP loci correspond to different agronomic traits. For example, locus 374 (Chr1B:445854245T>G) is related to plant height; locus 496 (Chr1B:680056286G>C) is related to resistance to powdery mildew; locus 4247 (Chr6A:62877501C>T) is related to flowering time; and locus 642 (Chr1D:447039G>A) is related to leaf rust.

[0036] The wheat 5K microarray, primarily based on previous sequencing and SNP discovery results, combined with information on population traits and superior alleles, carefully screens representative, evenly distributed, and functionally defined SNP loci. It addresses the dual needs of diversity analysis and breeding stock selection, providing an efficient and reliable molecular tool for breeding decisions. This microarray achieves a single-sample detection cost as low as 100 RMB, significantly lowering the barrier to molecular breeding and providing breeding units with a highly cost-effective solution for stock evaluation, population optimization, and gene mapping.

[0037] This wheat 5K chip covers major growth, development, yield, and disease resistance-related traits in wheat, including plant height, thousand-grain weight, flowering time, leaf rust, etc. The SNP sites selected in the chip are distributed in key functional regions of the whole genome, providing excellent functional annotation background and breeding application value. Furthermore, through systematic analysis of core germplasm resources and multi-environment phenotypic data, this chip achieves an organic combination of functional markers and genomic background markers, which can be used for precise screening of target traits and also assist in constructing the genetic structural framework of breeding populations.

[0038] In addition, some markers in the chip have been significantly associated with the measured phenotypes and can be directly used for the rapid detection and aggregation of superior alleles, thus accelerating the efficiency of material selection and combination optimization.

[0039] In practical applications, this chip has been successfully used in germplasm resource evaluation and parental selection research, demonstrating good versatility and stability, and is particularly suitable for molecular evaluation and high-throughput detection needs for large-scale populations. Combined with a sample cost as low as 100 yuan, it provides a practical solution for the popularization of wheat molecular breeding. Attached Figure Description

[0041] Figure 1 This is a distribution map of the 5486 SNP sites contained in the 5K wheat chip of this invention on the chromosome. Detailed Implementation

[0042] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0043] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0044] The following examples use software such as Python and R to process the data. The accuracy of the whole genome selection results is expressed as the average value of the Pearson correlation coefficient R: a five-fold crossover iteration was used, randomly repeated 20 times for a total of 100 times, and the average value was taken.

[0045] Example 1: Design and fabrication of a wheat 5K low-density SNP chip based on targeted capture sequencing according to the present invention.

[0046] 1. SNP site screening

[0047] 1.1 GWAS analysis and screening of AB-NAMIC population

[0048] Adding sites that are significantly associated with the target trait to the chip can help improve the accuracy and efficiency of trait selection and accelerate the aggregation of superior genes and the breeding process.

[0049] Therefore, this chip incorporates significant loci from GWAS (genome-wide association study) analyses of traits and SNPs based on the main domestic wheat parent lines and the superior breeding population AB-NAMIC obtained through backcrossing of these main parent lines. In the AB-NAMIC and NP populations, 2932 and 1096 significant loci were obtained, respectively. Furthermore, based on these significant loci, the frequencies of alleles in the NP and AB-NAMIC populations were calculated. If the frequency in the AB-NAMIC population was significantly higher than that in the NP population, it was considered a superior allele. The AB-NAMIC population was hybridized with three widely planted superior wheat varieties: Zhoumai 18 (high-yield), Zhengmai 366 (improved variety), and Handan 6172. The hybridization and calculation methods are described in the following literature: Fast integration and accumulation of beneficial breeding alleles through an AB-NAMIC strategy in wheat. Further screening based on probe design conditions revealed that the final number of significant GWAS loci (including superior allele loci and significant loci) corresponding to the traits recorded on the chip were as follows: plant height: 91; panicle length: 86; flowering time: 68; 1000-grain weight: 62; heading time: 60; effective tiller number: 53; leaf rust: 50; number of grains per panicle: 47; number of spikelets: 44; grain length: 41; powdery mildew resistance: 41; stripe rust: 33; grain width: 27; grain thickness: 15. For example, locus 374 (Chr1B: 445854245T>G) is related to plant height, and locus 496 (Chr1B: 680056286G>C) is related to powdery mildew resistance.

[0050] 1.2 Addition of functional genes

[0051] In wheat breeding, key functional genes play a central role in regulating crop growth and development, yield formation, and stress resistance. These genes often significantly enhance wheat's adaptability and yield levels under specific environmental conditions. Introducing or aggregating these key genes can not only accelerate the selection of superior varieties but also effectively achieve precise control over breeding objectives. For example, by screening for superior disease-resistant gene allelic variations, the disease resistance spectrum and stability of varieties can be significantly improved, reducing pesticide input; while genes regulating flowering time or plant height can optimize plant architecture and increase population yield. The discovery, verification, and application of these functional genes in microarray detection and molecular breeding are indispensable key links in modern wheat breeding.

[0052] Therefore, 27 SNP sites for functional genes were added, including the following traits and corresponding SNP site numbers: starch content: 5; yellow flour: 6; necrosis: 2; free threshing ability: 2; premature senescence: 2; leaf rust: 3; glume blight: 1; flowering time: 2; Fusarium head blight: 1; heat tolerance: 1; boron tolerance: 1; vernalization and flowering: 1; powdery mildew resistance: 1; awn: 1; plant height: 1; grain texture: 1; grain hardness: 1; starch synthesis and thousand-grain weight: 1; heading date: 1; grain protein, zinc and iron content: 1; stem rust: 1.

[0053] For example, locus 4247 Chr6A:62877501C>T is related to flowering time, and locus 642 Chr1D:447039G>A is related to leaf rust.

[0054] 1.3 Background Marker Supplement

[0055] Introducing uniformly distributed background markers on chromosomes into wheat breeding chip design aims to ensure whole-genome coverage, facilitating subsequent genetic analyses such as population structure analysis, genome selection, QTL mapping, and backcross background selection. Uniform background markers also improve genotype imputation accuracy, aid in monitoring chromosomal structural variations, and play a crucial role in quality control. They are an indispensable foundation for efficient and precise breeding. Therefore, when supplementing background markers, a 3M sliding window was set on the chromosomes, and 4883 polymorphic markers uniformly distributed on chromosomes were added to this chip.

[0056] 2. Deduplication of probe targets.

[0057] After removing duplicates from the AB-NAMIC population and NP population significant loci suitable for probe design obtained through the above screening, the SNP loci of 27 functional genes, and the 4883 polymorphic markers evenly distributed on the chromosome, 5486 SNP loci were finally identified, and their distribution on the chromosome is as follows: Figure 1 As shown.

[0058] The target-based probe design method is as follows: Based on the aforementioned 5486 SNP sites, a target site is selected within a total range of 120 bp upstream and downstream of the SNP site (as shown in Table 1). The target site covers the SNP site. One probe is designed for each target site, and the nucleotide sequence of the probe is complementary to the nucleotide sequence of the target site. The SNP sites and target sequences in Table 1 are based on the Chinese Spring genome 2.1 genome as a template to ensure that the target SNP is covered. Probes are designed and screened to have a GC content of 40-60%, no repetitive sequences, no SSRs, and a distance of no less than 100 bp from the marker.

[0059] Detailed information on the 5486 SNP loci and probes is shown in Table 1. Chr1A, Chr1B, Chr1D, Chr2A, Chr2B, Chr2D, Chr3A, Chr3B, Chr3D, Chr4A, Chr4B, Chr4D, Chr5A, Chr5B, Chr5D, Chr6A, Chr6B, Chr6D, Chr7A, Chr7B, and Chr7D represent the chromosomes where the SNP loci are located. Specific locus information is shown in Table 1.

[0060] The location information of the loci and their targets in Table 1 was determined by comparison using the Chinese spring wheat reference genome RefSeq v2.1 (https: / / urgi.versailles.inra.fr / download / iwgsc / IWGSC_RefSeq_Assemblies / v2.1 / ). In the “SNP loci” column of Table 1, the character before the “:” is the chromosome number, and the Arabic numeral after the “:” is the physical location of the SNP locus on that chromosome.

[0061] Nucleotides following the Arabic numerals and preceding the ">" are wild-type nucleotides, while those following the ">" are mutant nucleotides. For example, in "Chr1A:10956000G>A", "Chr1A" represents chromosome 1A, and "10956000" indicates the specific location of the SNP site on chromosome 1A in the Chinese Spring reference genome RefSeq v2.1. "G>A" indicates that the wild-type nucleotide at this SNP site is G, and the mutant nucleotide is A.

[0062] In the target field, the character before the "-" indicates the start position of the target, and the character after the "-" indicates the end position. The target is the location where the probe is designed for the preceding SNP site. The nucleotide sequence of the probe is complementary to the nucleotide sequence of the target. For example, SNP site Chr4A:66889618T>C, numbered 2746, corresponds to position 66889618 on chromosome 4A of the Chinese Spring reference genome RefSeq v2.1, and its nucleotide type is either T or C. The start and end positions of the target site corresponding to number 2746 are positions 67248578 and 67248697 of chromosome 4A in the Chinese Spring reference genome RefSeq v2.1, respectively, with a nucleotide sequence (5'→3'): TGCAAGTCCAACTCTTAAATATGATACTTCATGTGTACTGGTTTCAGCACAG GTTACCACAATATTTTTTTACAATCCGGATGTATATAAATGTAGTGCTATAAGCTAAGCGGAACCACA (SEQ ID NO: 1). This sequence is complementary to the nucleotide sequence of the single-stranded DNA probe targeting this SNP, which has the following sequence (5'→3'): TGTG GTTCCGCTTAGCTTATAGCACTACATTTATATACATCCGGATTGTAAAAAAATATTGTGGTAACCTGTGCTGAAACCAGTACACATGAAGTATCATATTTAAGAGTTGGACTTGCA (SEQ ID NO: 2).

[0063] Table 1. SNP site information of wheat 5K chip

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126] The nucleotide information of the wild-type nucleotides is consistent with the corresponding nucleotides in the Chinese Spring Reference Genome RefSeq v2.1 version.

[0127] It should be noted that, given the reference genome and its version number, and the specific location of the target site within it, obtaining the specific sequence information of each probe is very easy for those skilled in the art. Due to space limitations, the specific sequence information of each probe is not presented visually in this article.

[0128] 3. Chip fabrication and usage methods

[0129] The principle of liquid-phase microarrays is to design probes near target variant sites and hybridize them with the target genomic fragment region. After elution, amplification, and library construction, all captured gene fragments are subjected to next-generation sequencing to obtain the genotype of the target variant site. The specific steps are as follows: First, a gDNA library is constructed from the material to be tested. Simultaneously, based on the principle of DNA complementarity, probes covering the target SNP (5486 target sites in Table 1) are designed for each test site (5486 SNP sites in Table 1), and the target probes are modified with biotin labeling. Then, in a liquid state, the biotin-modified probes hybridize with the target genomic region to form double strands. Subsequently, streptavidin-coated magnetic beads are used to molecularly adsorb the biotin-modified probes, thereby capturing the target sites hybridized with the probes. Finally, the captured target site sequences are eluted, amplified, and sequenced to obtain the genotype of the target SNP.

[0130] Example 2: Application of the wheat 5K molecular marker chip obtained by the present invention

[0131] To verify the effectiveness of the 5k wheat chip prepared in Example 1, genotypic and phenotypic data from 590 wheat samples obtained using this chip and the Affymetrix Axiom Wheat660 chip (an existing commercial chip) were combined to perform genomic selection (GS) analysis. Genomic selection is a breeding method that uses whole-genome molecular marker information to predict an individual's estimated genomic breeding value (GEBV). Its core idea is to simultaneously consider the cumulative effect of all markers in the entire genome on the target trait, without relying on the significance test of a single locus. By establishing statistical or machine learning models of genotype and phenotype, GS can fully capture the genetic variation of complex quantitative traits, thereby predicting the breeding value of an individual. This method aims to improve the accuracy of complex trait selection, shorten the breeding cycle, and provide a reliable basis for efficient breeding. This experiment evaluates the application value of the chip in wheat molecular breeding by comparing the GS prediction accuracy of the 5k chip and the Wheat660 chip on the same batch of samples. In this experiment, we used the GBLUP (Genomic Best Linear Unbiased Prediction) method based on a mixed linear model to predict the genomic estimated breeding value (GEBV) of the samples.

[0132] First, DNA was extracted from 590 wheat samples and sequenced using microarrays to obtain raw sequencing data. The sequencing data underwent quality control to remove low-quality reads and adapter sequences, resulting in clean reads. These clean reads were then aligned to the reference genome using BWA-MEM with IWGSC RefSeq v2.1, and a set of variant site SNPs was obtained using gatk. Subsequently, vcftool was used for further quality control of the variant results, and plink was used to construct a high-quality genotype matrix.

[0133] Next, the genotype matrix (SNP markers) of wheat samples was converted into a genome relation matrix using the R package BGLR. The phenotypic value of the target trait was used as the response variable to construct a GBLUP model. Then, five-fold cross-validation was used to calculate the difference between the predicted GEBV value and the actual phenotype to estimate the model's predictive ability. Finally, the correlation between GEBV obtained using the 5k chip in this embodiment and the Affymetrix Wheat660 chip was compared with the actual phenotype to evaluate the predictive accuracy of different chips in genome-wide selection. The accuracy of the 5k chip was generally slightly higher than or equal to that of the existing 660K chip. The accuracy comparison results are shown in Table 2.

[0134] The accuracy calculation process in the table below is as follows: 590 wheat samples are randomly divided into 5 subsets of approximately equal size; in each iteration, 4 subsets are selected as the training set to build the GBLUP model and estimate the individual's Genome Estimated Breeding Value (GEBV); the remaining subset is used as the validation set to test the model's predictive ability; after each training iteration, the predicted GEBV value for each sample in the validation set is calculated and compared with its actual phenotypic value; the Pearson correlation coefficient (r) is used as a measure of prediction accuracy, i.e., the correlation between the predicted GEBV and the actual phenotypic value is calculated; the above process is repeated 5 times, with each subset used as the validation set once, until all samples are validated, and then 20 random samplings are performed for a total of 100 iterations; finally, the average of the correlation results obtained from the 100 iterations is taken as the prediction accuracy of the chip for the target trait.

[0135] Table 2. Accuracy Comparison of 5k Chip and Wheat660 Chip (660k)

[0136] Phenotype 660K 5K Heading stage 0.8968 0.9122 Flowering period 0.8926 0.9114 Plant height 0.6587 0.7268 ear length 0.7821 0.8274 number of spikelets 0.7098 0.7442 number of grains per ear 0.7157 0.7507 1000 grains weight 0.7486 0.8025 Powdery mildew resistance 0.7779 0.787 Leaf rust 0.693 0.7251 Particle length 0.7874 0.8205 Grain thickness 0.6388 0.6746 Protein sedimentation (quality trait) 0.8584 0.8522

[0137] The aforementioned 590 wheat accessions were progeny obtained through backcrossing of major domestic core germplasm with Zhoumai 18 (high-yield), Zhengmai 366 (improved variety), and Handan 6172. The 5K low-density genome chip provided by this invention has lower detection costs than existing high-density chips. Furthermore, compared to existing high-density chips, this invention's 5K chip is based on GWAS analysis of traits and SNP loci conducted by the team in previous work using the main domestic wheat parent lines and the superior breeding population AB-NAMIC obtained through backcrossing of these main parent lines. This increases the number of alleles with superior multiple traits, as well as functional genes for major wheat traits. It can be applied to whole-genome selection and genetic defect identification in wheat, which is of great significance for early wheat breeding, selection and mating, and accelerating genetic progress.

[0138] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A chip for detecting wheat, characterized in that, The chip includes reagents for specifically detecting SNP sites; the SNPs consist of 5486 SNP sites listed in Table 1; the location information of the SNP sites is determined by comparison with the wheat genome reference sequence, which is the Chinese spring wheat reference genome RefSeq v2.1 version.

2. The chip according to claim 1, characterized in that, The reagent is a probe.

3. The chip according to claim 1 or 2, characterized in that, The probe is a single-stranded DNA.

4. The chip according to claim 3, characterized in that, The probe consists of 5486 probes, each targeting a SNP site. The nucleotide sequence of each probe is complementary to the nucleotide sequence of its target site, and the target site is located within a total range of 120 bp upstream and downstream of the SNP site.

5. The chip according to any one of claims 2-4, characterized in that: The probe was modified with biotin.

6. The chip according to any one of claims 1-5, characterized in that: The chip also includes magnetic beads modified with streptavidin.

7. The chip according to any one of claims 1-5, characterized in that: The chip is a liquid-phase probe hybridization chip.

8. The application of the chip according to any one of claims 1-6 in wheat breeding.

9. The application of the chip according to any one of claims 1-6 in wheat genotyping detection.

10. The application according to claim 9, characterized in that, The genotyping includes at least one of the following agronomic traits: A1) Heading stage; A2) Flowering period; A3) Plant height; A4) Ear length; A5) Number of spikelets; A6) Number of grains per ear; A7) 1000-grain weight; A8) Resistant to powdery mildew; A9) Leaf rust; A10) Particle length; A11) Particle thickness; A12) Protein sedimentation (quality trait).

Images