SNP (Single Nucleotide Polymorphism) marker combination for identifying variety of medicago sativa and application of SNP marker combination

Abstract

The invention relates to an SNP (Single Nucleotide Polymorphism) marker combination for identifying varieties of medicago sativa and application of the SNP marker combination. The SNP marker combination comprises nine SNP loci of an alfalfa gene, and the nine SNP loci are respectively and correspondingly positioned on the 18001982nd basic group on the No.1 chromosome of the 'Zhongshu No.1' genome; the 12608675 and the 43974777 basic groups on the chromosome 2; the 65095811 base and the 73001600 base on the chromosome 3; a base at the 22452696th site of the 22452695th site of the chromosome 5; and the 42623641st site and the 47691413th site on the No.8 chromosome are basic groups. Core SNP markers of medicago sativa are developed on the basis of a whole genome sequencing technology and a KASP technology, nine SNP markers with high specificity and sensitivity are finally screened out, and medicago sativa resources or varieties can be rapidly, accurately and effectively identified by using the marker combination.

Description

Technical Field

[0001] This invention belongs to the field of molecular genetic breeding technology, and relates to an SNP marker combination for the identification of alfalfa varieties and its application. Background Technology

[0002] alfalfa ( Medicago sativa Alfalfa (L.) is the world's most widely cultivated perennial leguminous forage grass, boasting high yield and nutritional value. It can combine with rhizobia to form a nitrogen-fixing system, exhibiting strong nitrogen-fixing capabilities, and also plays a role in soil protection, soil improvement, and moisture retention. Alfalfa is a cross-pollinated, homotetraploid with a highly heterozygous genotype and relatively complex genetic composition, leading to a chaotic alfalfa seed market and significantly increasing the difficulty of market management, ultimately affecting the healthy development of the alfalfa seed market. Traditional morphological identification methods are time-consuming and easily affected by external factors such as the environment. With the continuous advancement of molecular biology technology, researchers have begun to focus on DNA molecular marker technology for variety identification. Compared to traditional morphological identification methods, DNA molecular markers have advantages such as a large number of markers, fast detection speed, and stability. DNA fingerprinting technology is an emerging technology in the field of molecular biology, and is an important way to distinguish differences between the same species or between different species at the molecular level. Therefore, constructing an alfalfa DNA fingerprint map is of great significance for regulating the alfalfa seed market and protecting the legitimate rights and interests of breeders.

[0003] DNA molecular marker technologies can be broadly classified into three categories: RFLP (Restriction Fragment Length Polymorphism), based on molecular hybridization; SSR (Simple Sequence Repeat), RAPD (Random Amplified Polymorphic DNA), ISSR (Inter-Simple Sequence Repeat), and AFLP (Amplified Fragment Length Polymorphism), based on PCR technology; and SNP (Single Nucleotide Polymorphism), based on single nucleotide polymorphism.

[0004] SNP markers, formally proposed by Eric S. Lander in Science in 1996, are a third-generation molecular marker technology based on RAPD and SSR markers. SNP markers represent polymorphisms in nucleic acid sequences caused by changes in a single nucleotide base. At the same nucleotide site, most nucleotide sequences are identical, with only one base deviating. The types of deviations mainly include single-base transitions, transversions, and deletions. Normally, the bases at the mutation site are C, T, G, and A, but in SNPs, it often occurs between T and C. SNP markers have several advantages: abundant and high-density sites; high polymorphism; high stability; fast detection speed, enabling automated detection; dimorphism; and co-dominance. SNP detection technology has been recommended by international organizations such as the ISF (International Seed Federation) for crop variety identification, genetic diversity analysis, genotyping, DNA fingerprinting, molecular-assisted breeding, and gene mapping. KASP (Kompetitive Allele-Specific PCR) is a PCR-based genotyping technique primarily used to detect single nucleotide polymorphisms (SNPs) and other small-fragment genetic variations. By designing two allele-specific primers and one universal reverse primer, only perfectly matched primers can extend during PCR amplification, generating different fluorescent signals. Genotypes are then distinguished by fluorescence detection. However, to date, there are few reports on the application of SNP markers and KASP technology in alfalfa variety identification. Therefore, developing a rapid, accurate, and effective method for alfalfa variety identification and evaluation is essential. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the purpose of this invention is to provide an SNP marker combination for alfalfa variety identification and its application, so as to achieve accurate and efficient identification of alfalfa varieties and molecular-assisted breeding.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: This invention first proposes a combination of SNP markers for alfalfa variety identification, wherein the combination of SNP markers includes 9 SNP loci of the alfalfa gene, and the 9 SNP loci are as follows: SNP1 corresponds to the 18001982nd base on chromosome 1 of the 'Zhongmu 1' genome, and the variant type is A / T. SNP2 corresponds to the 12,608,675th base on chromosome 2 of the 'Zhongmu 1' genome, and the variant type is T / A. SNP3 corresponds to the 43,974,777th base on chromosome 2 of the 'Zhongmu 1' genome, and the variant type is A / T. SNP4 corresponds to the 65095811th base on chromosome 3 of the 'Zhongmu 1' genome, and the variant type is T / A. SNP5 corresponds to the 73001600th base on chromosome 3 of the 'Zhongmu 1' genome, and the variant type is C / G. SNP6 corresponds to the 22452695th base on chromosome 5 of the 'Zhongmu 1' genome, and the variant type is T / A. SNP7 corresponds to the 22452696th base on chromosome 5 of the 'Zhongmu 1' genome, and the variant type is T / A. SNP8 corresponds to the 42623641st base on chromosome 8 of the 'Zhongmu 1' genome, and the variant type is G / C. SNP9 corresponds to the 47691413th base on chromosome 8 of the 'Zhongmu 1' genome, and the variant type is T / A.

[0007] Preferably, the present invention also provides a primer combination for detecting the above-mentioned SNP marker combinations, the primer combination comprising: Primer set 1, used to amplify the SNP1 site; Primer set 2 for amplifying the SNP2 site; Primer set 3 for amplifying the SNP3 site; Primer set 4 for amplifying the SNP4 site; Primer set 5 for amplifying the SNP5 site; Primer set 6 for amplifying the SNP6 site; Primer set 7 for amplifying the SNP7 site; Primer set 8 for amplifying the SNP8 site; Primer set 9 for amplifying the SNP9 site; Among them, any one of primer sets 1, 2, 3, 4, 5, 6, 7, 8, and 9 includes allele forward primers F1 and F2 and reverse primer R.

[0008] Preferably, the tag sequence is as shown in SEQ ID NO.28 of the sequence listing; a HEX fluorescent tag sequence is added to the 5' end of the allele forward primer F2, and the tag sequence is as shown in SEQ ID NO.29 of the sequence listing.

[0009] Preferably, primer set 1 includes the primers shown in SEQ ID NO. 1-3 of the sequence listing; Primer set 2 includes the primers shown in SEQ ID NO. 4~6; Primer set 3 includes the primers shown in SEQ ID NO. 7~9 of the sequence listing; The primer set 4 includes the primers shown in SEQ ID NO. 10~12; Primer set 5 includes the primers shown in SEQ ID NO. 13~15; Primer set 6 includes the primers shown in SEQ ID NO. 16~18; Primer set 7 includes the primers shown in SEQ ID NO. 19~21; The primer set 8 includes the primers shown in SEQ ID NO. 22~24; Primer set 9 includes the primers shown in sequence listing SEQ ID NO. 25~27.

[0010] Furthermore, the present invention also proposes the application of the SNP marker combination or the primer combination in any of the following aspects: (1) Construction of alfalfa SNP fingerprinting; (2) Identification of alfalfa varieties; (3) Tracing the origins of alfalfa varieties; (4) Analysis of genetic diversity of alfalfa varieties; (5) Molecular-assisted breeding of alfalfa varieties; (6) Prepare products for identification and auxiliary identification of alfalfa varieties, molecular-assisted breeding, variety tracing, and genetic diversity analysis.

[0011] Furthermore, the present invention also proposes an alfalfa SNP fingerprint spectrum, which is constructed using the aforementioned SNP marker combination.

[0012] Furthermore, the present invention also proposes a product for the identification and auxiliary identification of alfalfa varieties, molecular-assisted breeding, variety tracing, and genetic diversity analysis, wherein the product contains the primer combination or SNP marker combination described above.

[0013] Furthermore, the present invention also proposes a method for identifying alfalfa varieties, the method comprising the following steps: S1. Genomic DNA was extracted from the leaves of 'Zhongmu No. 1' alfalfa using the CTAB method to obtain the whole genome. All SNPs were filtered to identify the core SNP sites. S2. Design primer sets targeting the core SNP sites, perform PCR amplification, and obtain detection results; S3. Based on the test results, use R language to filter out SNP marker combinations, and determine the alfalfa varieties to be tested through the filtered SNP marker combinations.

[0014] Preferably, in step S1, whole-genome resequencing is performed using the Illumina platform, and all SNPs are filtered three times to identify core SNP sites.

[0015] Preferably, the SNP marker combination can identify the genetic similarity coefficient of the Purple Fantasy alfalfa variety between 0.3372 and 0.6410.

[0016] Preferably, the alfalfa varieties include the following categories: WL354HQ, WL656, WL903, WL298HQ, WL366HQ, WL319HQ, WL343HQ, WL353IH, WL440HQ, WL358HQ, Gannong No. 3, Ningmu No. 1, Longmu No. 1, Zhongmu No. 1, Emperor, Gongnong No. 1, Zhaodong, Xinjiang Daye, Huaiyin Alfalfa, and Xinmu No. 2.

[0017] Compared with existing technologies, this invention has the following advantages and beneficial effects: Based on resequencing technology, this invention uses KASP technology to identify alfalfa varieties and construct fingerprint profiles, ultimately determining 9 core SNP marker combinations that can efficiently and accurately complete alfalfa variety identification. Based on this primer combination marker, 20 alfalfa varieties can be effectively distinguished, and it can be effectively used for alfalfa variety identification and fingerprint profile construction. Attached Figure Description

[0018] Figure 1 This is a schematic diagram showing the distribution of 217 SNP markers on the chromosome in an embodiment of the present invention; Figure 2 This is an SNP clustering diagram of 20 alfalfa varieties in an embodiment of the present invention; Figure 3 The fingerprint profiles of 20 alfalfa varieties in this embodiment of the invention are shown. Detailed Implementation

[0019] The present invention will now be described in detail with reference to specific embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make several adjustments and improvements without departing from the concept of the present invention. These all fall within the scope of protection of the present invention.

[0020] Example 1: Development of SNP markers in alfalfa Genomic DNA was extracted from the 'Zhongmu No. 1' alfalfa variety using the CTAB method. After the genomic DNA passed the test, whole-genome resequencing was performed using the Illumina platform. The clean reads obtained from the resequencing were aligned to the 'Zhongmu No. 1' alfalfa reference genome. Population variation was detected and annotated based on the aligned population data.

[0021] The original 231,858 SNP loci were screened using the following criteria: (1) The average depth is 10X, and the SNP is a biallelic gene; (2) No variation in the upstream and downstream 50bp sequences; (3) Minor allele frequency (MAF) greater than 0.05; (4) Missing rate less than 20%; (5) The polymorphic information content (PIC) is greater than 0.35; (6) Evenly distributed on chromosomes.

[0022] After screening 231,858 high-quality SNPs, 217 SNP loci were finally obtained, such as Figure 1 As shown.

[0023] Example 2: KASP Primer Design KASP primers were designed and synthesized for the 217 screened SNP sites. Each set of KASP primers consists of 3 sequences, including 2 SNP-specific primers (F1 / F2) and 1 universal primer (R); the 5' FAM fluorescent sequence of F1 is GAAGGTGACCAAGTTCATGCT, SEQ ID NO.28; the 5' HEX fluorescent sequence of F2 is GAAGGTCGGAGTCAACGGATT, SEQ ID NO.29.

[0024] Example 3: KASP primer screening (1) This embodiment uses 20 alfalfa varieties as experimental subjects (see Table 1).

[0025] Table 1: Details of 20 Alfalfa Varieties

[0026] (1) DNA extraction from alfalfa ① Take fresh tender leaves, add liquid nitrogen and grind them into powder; ② Add 700 μL of CTAB extraction solution preheated to 65 °C (add β-mercaptoethanol at a ratio of 100:1 before use, add immediately before use), mix well, and incubate in a 65 °C water bath for 40-50 min, gently shaking once every 10 min or so. ③ Remove from the water bath and cool to room temperature. Add 700 μL of chloroform / isoamyl alcohol at a volume ratio of 24:1 (or add 700 μL of chloroform directly without isoamyl alcohol) and mix well. ④ Centrifuge at 12,000 rpm for 10 min at room temperature; ⑤ Take the supernatant (about 600 μL) and transfer it to a new 1.5 mL centrifuge tube. Add about 2 / 3 volume of isopropanol pre-cooled to -20 °C, gently invert and mix 6-8 times, and let it stand. At this time, flocculent precipitate can be seen. ⑥ Centrifuge at 4 °C, 12000 rpm for 10 min; ⑦ Carefully discard the supernatant, taking care to avoid DNA leakage; ⑧ After washing with 500 μL ddH2O, centrifuge again at 4 °C, 12000 rpm for 5 min, and carefully discard the supernatant; ⑨ Repeat step ⑧; ⑩ Allow the centrifuge tubes to air dry at room temperature (about 5 min), then add 50 μL of ddH2O for storage and use in DNA concentration measurement.

[0027] The KASP primer combination PCR amplification system includes: 5 μL of 2×KASP Master Mixture; 1 μL each of two forward primers (F1 / F2); 1 μL of one reverse primer (R); 1 μL of DNA template; and ddH2O to a final volume of 10 μL.

[0028] The PCR amplification reaction conditions were as follows: pre-denaturation at 95℃ for 10 min, 1 cycle; 95℃ for 15 s; 50-65℃ for 30 s, decreasing by 0.6℃ per cycle, 10 cycles; 95℃ for 15 s; 55℃ for 60 s, for a total of 28 cycles. After the reaction was complete, the PCR amplification products were placed on a Bio-Rad CFX Connect real-time quantitative PCR instrument to obtain the corresponding product fluorescence signal values. If the genotyping was not obvious, 5 more cycles of 95℃ for 15 s and 55℃ for 60 s could be added before rereading the values ​​and observing the genotyping results again.

[0029] Using the KASP markers that were successfully genotyped, the genotypes of 20 alfalfa varieties were tested, and 9 high-quality KASP markers with clear genotypes were finally obtained. These 9 KASP markers can completely distinguish the 20 alfalfa varieties (Table 2).

[0030] Table 2: Information on molecular marker primers for alfalfa core SNPs developed based on KASP technology

[0031] Example 4: Application of KASP molecular markers in genetic diversity analysis of alfalfa Based on nine selected SNP loci, the genetic similarity coefficients of 20 alfalfa varieties were calculated. The genetic similarity coefficient measures the degree of similarity between varieties; a higher similarity coefficient indicates a closer kinship. The results showed that the genetic similarity coefficients of the 20 alfalfa varieties based on SNP markers ranged from 0.3372 to 0.6410, with an average of 0.4891. Among them, 'WL343HQ' and 'Gannong 3' had the highest genetic similarity coefficients, indicating a close genetic relationship; 'WL903' and 'Jiangsu Huaiyin', and 'Xinjiang Daye' and 'Ningmu 1' had the lowest genetic similarity coefficients, indicating a more distant genetic relationship. Unweighted class average (UPGMA) clustering analysis was performed on the 20 alfalfa varieties. The clustering results showed that the nine primer combinations could classify the 20 alfalfa varieties into three major groups. Category I contains 17 varieties, divided into 3 subcategories: Subcategory 1 contains 1 variety, 'Zhongmu No. 1'; Subcategory 2 contains 4 varieties, including 'Xinmu No. 2', 'Zhaodong', 'WL903', and 'WL440HQ'; Subcategory 3 contains 12 varieties, including 'Ganong No. 3', 'WL343HQ', 'Longmu No. 1', 'Gongnong No. 1', 'WL358HQ', 'Muxuwang', 'WL354HQ', 'WL656', 'WL298HQ', 'WL366HQ', 'WL319HQ', and 'WL353IH'. Category II contains two varieties, including 'Xinjiang Daye' and 'Jiangsu Huaiyin'. Category III contains 1 variety, 'Ningmu No. 1', such as... Figure 2 As shown.

[0032] Example 5: Application of SNP markers in alfalfa fingerprinting and construction of molecular identity cards DNA fingerprinting was constructed for 20 alfalfa varieties using the aforementioned nine core KASP markers (e.g., ...). Figure 3(As shown). Nine core KASP markers can completely distinguish 20 alfalfa varieties. For example, combining locus 1 and locus 2 can separately distinguish 'Huaiyin Alfalfa' and 'Zhongmu No. 1'. Red represents genotype AA, denoted by 0; blue represents gene behavior aa, denoted by 1; and green represents genotype Aa, denoted by 2. Taking 'Zhongmu No. 1' as an example, the genotype can be converted into a nine-digit code: 010011102. Following this method, the SNP data of the 20 alfalfa varieties were digitally encoded to obtain 20 molecular identification cards for alfalfa varieties, as detailed in Table 3. An online QR code generator can also be used to present alfalfa information in the form of QR codes.

[0033] Table 3: Molecular ID Cards for 20 Alfalfa Varieties

[0034] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A SNP marker combination for alfalfa variety identification, characterized in that, The SNP marker combination includes 9 SNP sites of the alfalfa gene, and the 9 SNP sites are as follows: SNP1 corresponds to the 18001982nd base on chromosome 1 of the 'Zhongmu 1' genome, and the variant type is A / T. SNP2 corresponds to the 12,608,675th base on chromosome 2 of the 'Zhongmu 1' genome, and the variant type is T / A. SNP3 corresponds to the 43,974,777th base on chromosome 2 of the 'Zhongmu 1' genome, and the variant type is A / T. SNP4 corresponds to the 65095811th base on chromosome 3 of the 'Zhongmu 1' genome, and the variant type is T / A. SNP5 corresponds to the 73001600th base on chromosome 3 of the 'Zhongmu 1' genome, and the variant type is C / G. SNP6 corresponds to the 22452695th base on chromosome 5 of the 'Zhongmu 1' genome, and the variant type is T / A. SNP7 corresponds to the 22452696th base on chromosome 5 of the 'Zhongmu 1' genome, and the variant type is T / A. SNP8 corresponds to the 42623641st base on chromosome 8 of the 'Zhongmu 1' genome, and the variant type is G / C. SNP9 corresponds to the 47691413th base on chromosome 8 of the 'Zhongmu 1' genome, and the variant type is T / A.

2. A primer combination for detecting the SNP marker combination of claim 1, characterized in that, include: Primer set 1, used to amplify the SNP1 site; Primer set 2 for amplifying the SNP2 site; Primer set 3 for amplifying the SNP3 site; Primer set 4 for amplifying the SNP4 site; Primer set 5 for amplifying the SNP5 site; Primer set 6 for amplifying the SNP6 site; Primer set 7 for amplifying the SNP7 site; Primer set 8 for amplifying the SNP8 site; Primer set 9 for amplifying the SNP9 site; Among them, any one of primer sets 1, 2, 3, 4, 5, 6, 7, 8, and 9 includes allele forward primers F1 and F2 and reverse primer R.

3. The primer combination according to claim 2, characterized in that, The 5' end of the allele forward primer F1 is provided with a FAM fluorescent tag sequence, as shown in SEQ ID NO.28 of the sequence listing; the 5' end of the allele forward primer F2 is provided with a HEX fluorescent tag sequence, as shown in SEQ ID NO.29 of the sequence listing.

4. The primer combination according to claim 2 or 3, characterized in that, The primer set 1 includes the primers shown in SEQ ID NO. 1-3 of the sequence listing; Primer set 2 includes the primers shown in SEQ ID NO. 4~6; Primer set 3 includes the primers shown in SEQ ID NO. 7~9 of the sequence listing; The primer set 4 includes the primers shown in SEQ ID NO. 10~12; Primer set 5 includes the primers shown in SEQ ID NO. 13~15; Primer set 6 includes the primers shown in SEQ ID NO. 16~18; Primer set 7 includes the primers shown in SEQ ID NO. 19~21; The primer set 8 includes the primers shown in SEQ ID NO. 22~24; Primer set 9 includes the primers shown in sequence listing SEQ ID NO. 25~27.

5. The application of the SNP marker combination of claim 1 or the primer combination of any one of claims 2 to 4 in any of the following aspects: (1) Construction of alfalfa SNP fingerprinting; (2) Identification and auxiliary identification of alfalfa varieties; (3) Tracing the origins of alfalfa varieties; (4) Analysis of genetic diversity of alfalfa varieties; (5) Molecular-assisted breeding of alfalfa varieties; (6) Prepare products for identification and auxiliary identification of alfalfa varieties, molecular-assisted breeding, variety tracing, and genetic diversity analysis.

6. An alfalfa SNP fingerprint spectrum, characterized in that, It is constructed using the SNP tag combination described in claim 1.

7. A product for the identification and auxiliary identification of alfalfa varieties, molecular-assisted breeding, variety tracing, and genetic diversity analysis, characterized in that, It includes the primer combination described in any one of claims 2 to 4.

8. A method for identifying alfalfa varieties, characterized in that, The method includes the following steps: S1. Genomic DNA was extracted from the leaves of 'Zhongmu No. 1' alfalfa using the CTAB method to obtain the whole genome. All SNPs were filtered to identify the core SNP sites. S2. Design primer sets targeting the core SNP sites, perform PCR amplification, and obtain detection results; S3. Based on the test results, use R language to filter out SNP marker combinations, and determine the alfalfa varieties to be tested through the filtered SNP marker combinations.

9. The identification method according to claim 8, characterized in that, The SNP marker combination can identify the genetic similarity coefficient of the Purple Fantasy alfalfa variety between 0.3372 and 0.6410.

10. The identification method according to claim 8 or 9, characterized in that, The alfalfa varieties include the following categories: WL354HQ, WL656, WL903, WL298HQ, WL366HQ, WL319HQ, WL343HQ, WL353IH, WL440HQ, WL358HQ, Gannong No. 3, Ningmu No. 1, Longmu No. 1, Zhongmu No. 1, Emperor, Gongnong No. 1, Zhaodong, Xinjiang Daye, Huaiyin Alfalfa, and Xinmu No. 2.

Images