Methods for obtaining new self-pollinating varieties of Leymus chinensis and the self-pollinating gene of Leymus chinensis

Abstract

This invention belongs to the field of molecular marker breeding technology, specifically relating to a method for obtaining new self-fertile varieties of Leymus chinensis and the self-fertile gene and its application.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker breeding technology, specifically relating to a method for obtaining new self-fertile varieties of Leymus chinensis and the self-fertile gene of Leymus chinensis and its application. Background Technology

[0002] Leymus chinensis (Trin.) Tzvel., also known as alkali grass, belongs to the genus Leymus in the family Poaceae and is one of the important dominant species in meadow steppes and arid steppes in the eastern Eurasian steppe region. Leymus chinensis possesses strong resistance to cold, drought, and salinity, and also exhibits excellent characteristics such as early greening, high nutritional value, good palatability, and the ability to be harvested for hay, making it an important forage resource. Besides its use as forage, its rhizomes have extremely strong penetrating and spreading capabilities, forming a well-developed underground rhizome network that effectively binds and stabilizes the soil, making it an excellent plant for grassland restoration and soil and water conservation. However, the "three lows" in the reproductive characteristics of Leymus chinensis—low seed setting rate, low germination rate, and low forage yield—limit its seed production, artificial grassland construction, and livestock development. As a gametophyte-type self-incompatible plant, Leymus chinensis has a low self-pollination rate, making it difficult to obtain genetically stable, high-self-pollination-rate superior strains. Therefore, analyzing the self-incompatibility mechanism of Leymus chinensis, creating self-compatibility breeding technology, and cultivating Leymus chinensis varieties with high self-pollination and seed setting rates have become urgent problems that need to be solved for the development of Leymus chinensis industry in my country.

[0003] Self-incompatibility (SI) refers to the inability of fertile, hermaphroditic plants to produce seeds during self-pollination. In grasses (Poaceae), SI is controlled by two non-linked multiple alleles, S and Z. When the S and Z genotypes of pollen and pistil match, the pollen tube cannot grow normally on the stigma surface, resulting in a self-incompatibility response. Cork barley (Hordeum bulbosum Linn.) is closely related to cultivated barley (Hordeum vulgare), exhibits strong environmental adaptability and good stress resistance, and is a diploid species with self-incompatibility. Lundqvist demonstrated that the genetic mechanism of self-incompatibility in cork barley is a gametophyte self-incompatibility system controlled by two S and Z loci (Lundqvist, 1962). Later, Kekeda et al. used RFLP markers of the genus *Triticum* to detect corm barley populations and found that corm barley contained two self-incompatible sites. Subsequently, Kekeda et al. used cDNA-AFLP technology to identify cDNAs specifically expressed in style and anther, obtaining three candidate genes (HPS10, HAS31, and HAS175). HPS10 and HAS175 showed style- and anther-specific expression patterns, respectively. Researchers speculated that HPS10 is polymorphic and found its homologous gene on rice chromosome 5, considering it to be a candidate style S factor (Kakeda et al., 2008; Kakeda, 2009). In 2023, Wang et al. used CRISPR-Cas9 editing technology to knock out the OlHPS10-S pollen gene at the S locus in self-incompatible, long-stamened wild rice (Oryza sativa var. tatarica), changing it from self-incompatible to self-compatible, and the self-compatible trait could be stably inherited by offspring (Wang et al., 2023). Rohner et al. proposed that among the six candidate determinants of self-incompatibility at the S and Z loci, the absence of at least one gene copy may result in self-compatibility (Rohner et al., 2023).

[0004] Molecular marker-assisted selection (MMR) breeding technology achieves the goal of selecting target traits by selecting molecular markers closely linked to them. It is simple, rapid, and unaffected by environmental factors. Selecting relevant genes from germplasm resources allows for knowledge of the gene composition of each material before configuring hybridization combinations, ensuring successful hybridization and saving significant manpower, resources, and time. Summary of the Invention

[0005] To address the problem of low self-pollination seed setting rate in Leymus chinensis, making it difficult to obtain genetically stable and high-yielding superior lines, this invention provides a molecular marker for high seed setting in Leymus chinensis (Trin.) Tzvel.

[0006] The molecular marker for the high-yielding quality of the sheepgrass is the LcHPS10-Z3 gene, whose nucleotide sequence is shown in SEQ ID NO.1.

[0007] This invention provides primer pairs for the molecular marker LcHPS10-Z3, wherein the forward primer is ATGGTTGCGAAAGCGTTCAT (SEQ ID NO.7); and the reverse primer is CTAACATGCTCTTGCCCTGC (SEQ ID NO.8).

[0008] The molecular marker LcHPS10-Z3 and its primer pair described in this invention can be applied to marker-assisted selection of high-fruiting Leymus chinensis varieties to rapidly create new high-fruiting Leymus chinensis varieties and provide new genes and germplasm resources for improving high-fruiting seed production of Leymus chinensis.

[0009] This invention provides the following technical solution:

[0010] 1. A method for obtaining new varieties of Leymus chinensis, the method comprising: screening Leymus chinensis carrying the LcHPS10-Z3 gene by performing gene detection on unknown strains of Leymus chinensis, wherein the nucleotide sequence of the LcHPS10-Z3 gene is shown in SEQ ID NO.1.

[0011] 2. The method described in Project 1, characterized in that the method further includes: using the sheepgrass carrying the LcHPS10-Z3 gene as the parent, obtaining offspring sheepgrass through hybridization, self-pollination and / or backcrossing, and screening out sheepgrass carrying the LcHPS10-Z3 gene from the offspring sheepgrass.

[0012] 3. The method described in Project 1 or 2, characterized in that the method for screening *Leymus chinensis* carrying the LcHPS10-Z3 gene includes a step of PCR amplification using primer pairs, wherein the primer pairs are:

[0013] The forward primer, whose nucleotide sequence is shown in SEQ ID NO.7; and

[0014] The reverse primer has the nucleotide sequence shown in SEQ ID NO.8.

[0015] 4. A method for improving the self-pollination and seed setting rate of Leymus chinensis, the method comprising planting Leymus chinensis plants carrying the LcHPS10-Z1D gene or the LcHPS10-Z2D gene, wherein the nucleotide sequence of the LcHPS10-Z1D gene is shown in SEQ ID NO.5 and the nucleotide sequence of the LcHPS10-Z2D gene is shown in SEQ ID NO.6.

[0016] 5. A method for improving the self-pollination and seed setting rate of Leymus chinensis, the method comprising planting Leymus chinensis plants carrying the LcHPS10-Z3 gene, the nucleotide sequence of the LcHPS10-Z3 gene being shown in SEQ ID NO.1.

[0017] 6. A gene for self-pollination of Leymus chinensis, wherein the gene is the LcHPS10-Z1D gene or the LcHPS10-Z2D gene, the nucleotide sequence of the LcHPS10-Z1D gene is shown in SEQ ID NO.5, and the nucleotide sequence of the LcHPS10-Z2D gene is shown in SEQ ID NO.6.

[0018] 7. A gene for self-pollination of Leymus chinensis, wherein the gene is the LcHPS10-Z3 gene, and the nucleotide sequence of the LcHPS10-Z3 gene is shown in SEQ ID NO.1.

[0019] 8. Primer pair for detecting the LcHPS10-Z3 gene, wherein the primer pair is:

[0020] The forward primer, whose nucleotide sequence is shown in SEQ ID NO.7; and

[0021] The reverse primer has the nucleotide sequence shown in SEQ ID NO.8; the nucleotide sequence of the LcHPS10-Z3 gene is shown in SEQ ID NO.1.

[0022] 9. A method for detecting the LcHPS10-Z3 gene, the method comprising detecting the LcHPS10-Z3 gene by PCR, wherein the PCR method includes a step of PCR amplification of the LcHPS10-Z3 gene, wherein the primer pair used for PCR amplification is:

[0023] The forward primer, whose nucleotide sequence is shown in SEQ ID NO.7; and

[0024] The reverse primer has the nucleotide sequence shown in SEQ ID NO.8;

[0025] The nucleotide sequence of the LcHPS10-Z3 gene is shown in SEQ ID NO.1.

[0026] 10. The application of the genes described in Project 6 or 7 and / or the primer pairs described in Project 8 in molecular marker-assisted breeding of Leymus chinensis.

[0027] The plants, or parts thereof, seeds, cells, or progeny of this invention can be used in plant breeding programs. The purpose of plant breeding is to combine multiple desired traits in a single variety or hybrid. For field crops, these traits may include, for example, resistance to diseases and insects, tolerance to heat and drought, reduced crop maturity time, higher yield, and better agronomic qualities. Traditional plant breeding is an important tool for developing new and improved commercial crops. This invention also covers methods for producing progeny plants by crossing transgenic plants of a first parent with plants of a second parent.

[0028] Plant breeding techniques used in plant breeding programs, as is well known in the art, include, but are not limited to, hybridization, recurrent selection, bulk selection, mixed selection, backcrossing, pedigree breeding, free pollination breeding, selection for enhanced restriction fragment length polymorphism, selection for enhanced genetic markers, double haploids, and transformation.

[0029] As used herein, the term "backcross" refers to a method by which progeny plants are repeatedly backcrossed with one of their parents. In a backcross scheme, the "donor" parent is the parent plant that possesses the desired gene or locus to be introgressed. The "recipient" parent (used once or multiple times) or "recurrent" parent (used twice or more) is the parent plant in which the gene or locus is introgressed.

[0030] As used in this article, the term "hybridization" refers to the fusion of gametes through pollination to produce offspring (e.g., cells, seeds, or plants).

[0031] Based on the molecular marker LcHPS10-Z3 provided by this invention, the self-incompatibility barrier of Leymus chinensis can be effectively overcome, providing a new technical means for high-fruiting breeding of Leymus chinensis through self-pollination, rapidly creating new high-fruiting Leymus chinensis varieties, which is conducive to the development and utilization of excellent Leymus chinensis germplasm resources, and provides new genes and germplasm resources for the development of Leymus chinensis industry in my country. Attached Figure Description

[0032] Figure 1 These are photos of seeds from the self-pollinating, high-fruiting Lc65 strain (Figure A) and the wild-type Lc6 strain (Figure B).

[0033] Figure 2 Image A shows the LcHPS10-Z gene sequence alignment at the Z locus of the self-pollinating high-fruiting Lc65 and self-pollinating non-fruiting Lc6 lines of Leymus chinensis. The red box indicates the deleted fragment region. LcHPS10-Z1 and LcHPS10-Z2 are the Z locus gene sequences of the Lc6 line, and LcHPS10-Z3 and LcHPS10-Z4 are the Z locus gene sequences of the Lc65 line. Image B shows the first-generation sequencing image of the LcHPS10-Z3 sequence after PCR amplification.

[0034] Figure 3 The image shows an electrophoresis pattern of the LcHPS10-Z3 molecular marker used to identify the presence of the LcHPS10-Z3 gene in different strains of Leymus chinensis. The trnH-psbA gene fragment is used as a control (CK).

[0035] Figure 4 Figure A shows the PCR detection results of the Z locus genotype of Lc65 self-pollinated generation 1 (Figure A), a photograph of the grains of Lc65 self-pollinated generation 2 (Figure B), and a PCR detection result of the Z locus genotype of Lc65 self-pollinated generation 2 (Figure C). In Figure A, lines 1, 2, 3...12 represent different lines of self-pollinated generation 1, and in Figure C, lines 1, 2, 3...8 represent different lines of self-pollinated generation 2. The trnH-psbA gene fragment serves as a control (CK).

[0036] Figure 5 The image shows a photograph of the seeds of the first generation of hybrids of Lc65 and Lc6 (Figure A), and a PCR detection image of the Z locus genotype of the first generation of hybrids of Lc65 and Lc6 (Figure B). In Figure B, 1, 2, 3...17 represent different lines of the first generation of hybrids, and the trnH-psbA gene fragment serves as a control (CK). Detailed Implementation

[0037] The technical solutions in the embodiments of the present invention will now be clearly and completely described with reference to the accompanying drawings. Obviously, the described embodiments are merely a part of the implementation methods of the present invention, and not all of them. All other embodiments that can be obtained by those skilled in the art based on the embodiments of the present invention are within the scope of protection of the present invention.

[0038] The method for obtaining new varieties of Leymus chinensis according to the present invention first involves genetic testing of unknown strains of Leymus chinensis to screen for those carrying the LcHPS10-Z3 gene. This testing can be performed by extracting DNA from Leymus chinensis cells and sequencing it. The extraction of Leymus chinensis DNA can be carried out using conventional methods known to those skilled in the art, such as chloroform extraction, centrifugation column method, and magnetic bead method. The lysis buffer used in the cell lysis process can be a commonly used lysis buffer known to those skilled in the art, such as SDS or CTAB.

[0039] The sequencing methods include gene sequencing technologies known to those skilled in the art (including Sanger sequencing, high-throughput sequencing, third-generation sequencing, etc.). PCR amplification of the target DNA may be required before sequencing. The amplification primers used in the PCR amplification process can be designed and synthesized using conventional methods known to those skilled in the art.

[0040] In this invention, preferably, after screening for Leymus chinensis carrying the LcHPS10-Z3 gene, in order to cultivate a homozygous inbred line with stable traits, the Leymus chinensis is used as the parent, and through one or more generations of self-pollination, a more stable Leymus chinensis carrying the LcHPS10-Z3 gene is obtained. To create new gene combinations and demonstrate hybrid vigor, after screening for Leymus chinensis carrying the LcHPS10-Z3 gene, the Leymus chinensis is used as the parent, and through hybridization with other lines, followed by one or more generations of self-pollination, a more stable Leymus chinensis carrying the LcHPS10-Z3 gene is obtained. To make the genetic background closer to the recipient, after screening for Leymus chinensis carrying the LcHPS10-Z3 gene, the Leymus chinensis is used as the parent, and through one or more backcrosses with the parent, followed by one or more generations of self-pollination, a more stable Leymus chinensis carrying the LcHPS10-Z3 gene is obtained.

[0041] In the self-pollination method, lines carrying the LcHPS10-Z3 molecular marker can be selected for single-ear bagging self-pollination. The grains of the F1 generation are harvested, and the grains of the F1 generation with high seed setting rate are selected. Under suitable conditions, the grains of the F2 generation are harvested. Based on the seed setting rate and PCR detection, new Leymus chinensis lines with a self-pollination seed setting rate of 60% or higher, carrying the LcHPS10-Z3 gene, and with a genetic background closer to the recipient are selected. In a specific implementation, three more self-pollinations can be performed to obtain highly homozygous F5 Leymus chinensis inbred lines carrying the LcHPS10-Z3 gene and with a genetic background closer to the recipient.

[0042] In the hybridization method, a line carrying the LcHPS10-Z3 molecular marker can be selected as the donor parent, and the Lc6 line without the LcHPS10-Z3 molecular marker can be selected as the recipient parent. Conventional sexual hybridization is then performed to obtain the F1 generation. The presence of the LcHPS10-Z3 gene in the F1 generation plants is detected by PCR. Individual plants from lines carrying the LcHPS10-Z3 gene are selected for single-ear bagging self-pollination. The grains of the F2 generation are harvested. Based on the seed setting rate and PCR detection, a new Leymus chinensis line with a self-pollination seed setting rate of 60% or higher, carrying the LcHPS10-Z3 gene, and with a genetic background closer to the recipient is selected. In a specific implementation, three more self-pollinations can be performed to obtain a highly homozygous F5 Leymus chinensis line carrying the LcHPS10-Z3 gene, with a genetic background even closer to the recipient.

[0043] In the backcross method, F1 offspring can be obtained through hybridization. Individual F1 plants are then backcrossed multiple times (generally five or more times) with the parent (wild type). PCR identification is used to screen for lines carrying the LcHPS10-Z3 gene. Individual plants carrying the LcHPS10-Z3 gene are then self-pollinated using single-ear bagging. The grains of F2 offspring are harvested. Based on the seed setting rate and PCR testing, new Leymus chinensis lines with a self-pollination seed setting rate of 60% or higher, carrying the LcHPS10-Z3 gene, and with a genetic background closer to the recipient are selected. In a specific implementation, three more self-pollinations can be performed to obtain a highly homozygous F5 Leymus chinensis line carrying the LcHPS10-Z3 gene and with a genetic background even closer to the recipient.

[0044] Example 1: Screening for high-fruiting self-pollinating lines of Leymus chinensis

[0045] The Leymus chinensis germplasm resources used were collected from Zhaodong City, Zhaoyuan County, Lanxi County, Dumeng County, and Anda City in Heilongjiang Province. Based on the different collection sites, they were numbered as Lc65, Lc6, Lc60, Lc80, Lc89, Lc90, Lc93, Lc109, Lc112, Lc117, Lc101, Lc108, Lc113, Lc116, and Lc120 lines. High-fruiting lines were selected through bagging and self-pollination. Specific self-pollination procedures are as follows:

[0046] 1. Before flowering, select healthy Leymus chinensis plants, taking 5-10 single spikelets from each plant line. The selection criteria are as follows:

[0047] 1) The spike-like inflorescence has fully emerged from the flag leaf, and the florets on the spike are well-developed and completely unopened (the outermost floret on the middle and lower spikelets is peeled open, and the anthers are not fully mature).

[0048] 2) Select ears of grain that are as similar in height as possible;

[0049] 3) To prevent the stems from becoming brittle and bending due to a decrease in water content later on, which would affect fruit setting, select spikelets from tillers that are close together.

[0050] 2. Insert an iron rod near the selected ear of grain, securing the middle of the stem to the rod. Care should be taken to avoid bending the stem at this point.

[0051] 3. Cover the ears and iron stalks with a self-fertilizing net bag; the top of the iron stalk should be slightly higher than the top of the ears. Support the net bag, tighten the lower drawstring, and then wrap it with tape for secondary fixation.

[0052] For self-pollination bagging, use nylon mesh bags (45×15 cm). In order to isolate the pollen of the selected ear from that of other ears, the mesh size of the nylon mesh bag should be at least 600 mesh.

[0053] 4. Label each plant with its lineage number, self-crossing symbol, and date of operation for subsequent statistical purposes.

[0054] 5. After the sheepgrass reaches full maturity, harvest the sheepgrass seeds, conduct seed testing, count the number of seeds produced by each lineage, and calculate the self-pollination seed setting rate (self-pollination seed setting rate = number of seeds produced / total number of seeds).

[0055] According to the above procedures, self-pollination was performed on single-spike bags of Leymus chinensis germplasm resources. It was found that only line Lc65 could produce seeds, while line Lc6 did not (e.g., ...). Figure 1 (As shown in Table 2). Specifically, the seed setting rate of line Lc65 was 64.2 ± 0.18%, while the seed setting rates of other lines (Lc6, Lc60, Lc80, Lc89, Lc90, Lc93, Lc109, Lc112, Lc117, Lc101, Lc108, Lc113, Lc116, Lc120) were all 0 (Table 2). Thus, the Lc65 line of Leymus chinensis with high self-pollination and seed setting was obtained.

[0056] Example 2: Identification of molecular markers in the self-pollinating high-fruiting Lc65 line

[0057] Leaves of the Lc65 strain of Leymus chinensis were subjected to third-generation genome sequencing (PacBio HiFi sequencing). The sequencing data were assembled at the contig level using Hifiasm software (https: / / github.com / chhylp123 / hifiasm) based on sequence overlap. The contigs were then mounted onto chromosomes using RagTag software (https: / / github.com / malonge / RagTag) based on their collinearity with the self-incompatible Lc6 strain of Leymus chinensis. The S and Z loci sequences of self-incompatible perennial ryegrass (Lolium perenne) and long-stamened wild rice (Oryza longistaminata) were used as reference sequences, and BLAST homology comparisons were performed with the Lc6 and Lc65 strains of Leymus chinensis (e-value < 1×10⁻⁶). -80 The results showed that self-incompatible S / Z loci exist on chromosomes 1Xm and 2Xm of Lc65.

[0058] Further identification of the pollen gene LcDUF247 and the style gene LcHPS10 at the Z locus was performed. Pollen and style samples from Lc6 were collected for full-length transcriptome sequencing. After aligning the raw sequencing reads to the genome, the alignment results were visualized using Apollo software (www.github.com / GMOD / Apollo), and gene structure annotations were manually corrected based on the transcripts. The full-length transcriptome provides not only accurate gene structure but also expression level information. Quantification of the DUF247 and HPS10 genes on the Xm genome revealed that DUF247 is expressed specifically in pollen, and HPS10 is expressed specifically in style. The tissue-specific expression characteristics of these two genes are consistent with those of the DUF247 and HPS10 genes in perennial ryegrass, supporting the identification of DUF247 and HPS10 genes in Lc6 Leymus chinensis as key genes for self-incompatibility.

[0059] By comparing the sequences of LcHPS10-Z1 and LcHPS10-Z2 in Leymus chinensis strain Lc6, two deletions were found in LcHPS10-Z3 (as shown in SEQ ID NO.1) of Leymus chinensis strain Lc65, located at positions 161 to 193 and 252 to 266 from the 5' end of the alignment result, respectively (as shown in SEQ ID NO.1). Figure 2 As shown in the image). After PCR amplification, Sanger sequencing (Beijing Liuhe BGI Genomics Co., Ltd.) revealed clear sequencing peaks on both sides of the deletion, indicating that this mutation truly exists. Figure 2 Self-incompatibility occurs only when the types of pollen Z alleles and stigma Z alleles correspond; self-compatibility occurs when they do not correspond. Two deletions in LcHPS10-Z3 result in a 50% mismatch between the style gene LcHPS10-Z3 and the pollen Z allele, leading to self-fertility. Therefore, LcHPS10-Z3 is a molecular marker for high self-fertility in the Lc65 line. Similarly, the same phenomenon exists in LcHPS10-Z1 (SEQ ID NO.2) and LcHPS10-Z2 (SEQ ID NO.3). Mutations (deletion or premature termination) at the corresponding sites also result in a 50% mismatch with the pollen Z allele genotype, leading to self-fertility. The deletion of these two segments in the LcHPS10-Z1 gene (see...) Figure 2 The portion within the red box, specifically positions 158 to 190 and 245 to 259 of the LcHPS10-Z1 gene from the 5' end, is the LcHPS10-Z1D gene (SEQ ID NO. 5), which is a deletion of these two segments from the LcHPS10-Z2 gene (see [link to gene description]). Figure 2The part in the red box, namely the LcHPS10-Z2 gene from position 161 to 193 and from position 247 to 261 from the 5' end, is the LcHPS10-Z2D gene (SEQ ID NO. 6). Similarly, the two deletions in the LcHPS10-Z1D or LcHPS10-Z2D gene result in a 50% mismatch between the style gene LcHPS10-Z1D or LcHPS10-Z2D and the pollen Z allele, thus causing it to exhibit self-pollination. Therefore, the LcHPS10-Z1D and LcHPS10-Z2D genes are also molecular markers for high self-pollination and fruit setting in Leymus chinensis.

[0060] Example 3: DNA extraction and PCR detection of the LcHPS10-Z3 gene

[0061] 1. DNA was extracted from Leymus chinensis using the CTAB method, the specific method of which is as follows:

[0062] (1) Take fresh leaves of Leymus chinensis and put them into a 2 mL centrifuge tube. Then add two small steel balls with a diameter of 4 mm and 500 μL of CTAB (as shown in Table 1). Invert the tube to mix thoroughly. Use a high-throughput tissue homogenizer (model: MM400, Retsch) to homogenize the leaves. Then place the tube in a water bath at 65°C for 1 hour. Invert the sample gently every 10-15 minutes during this time.

[0063] Table 1. Genomic DNA Extraction Buffer (CTAB) Formulation

[0064]

[0065] (2) After the liquid from the previous step has cooled to room temperature, add 500 μL of a mixture of chloroform and isoamyl alcohol (volume ratio of 24:1), gently invert and mix, and centrifuge at 12000 rpm for 10 minutes.

[0066] (3) Transfer 400 μL of supernatant to a new 1.5 mL centrifuge tube and add an equal volume of isopropanol. Mix by inverting and place in a -20 °C refrigerator for 1 hour to precipitate.

[0067] (4) Centrifuge at 13000 rpm for 10 minutes, discard the supernatant and keep the bottom precipitate.

[0068] (5) Add 1 mL of 70% ethanol to clean the tube wall and precipitate, discard the supernatant, and repeat the operation twice.

[0069] (6) Dry at room temperature to allow the ethanol to evaporate completely.

[0070] (7) Add 100 μL of sterile deionized water to dissolve the DNA and store at -20℃ for later use.

[0071] 2. PCR amplification:

[0072] PCR amplification reactions were performed on a GT9612 PCR amplification instrument (BIO-GENER).

[0073] (1) The reaction system is as follows:

[0074] 10 μL of 2×Phanta Master Mix (Novizan), 1 μL of 100 μg / mL template DNA, 8 μL of ddH2O, and 10 μM primers (0.5 μL each of forward and reverse primers). PCR amplification primers were designed based on the LcHPS10-Z3 gene, with the forward primer being: ATGGTTGCGAAAGCGTTCAT (SEQ ID NO.7); and the reverse primer being: CTAACATGCTCTTGCCCTGC (SEQ ID NO.8). Primers were synthesized using the solid-phase phosphoramidite triester method.

[0075] (2) The PCR reaction procedure is as follows: 95℃ pre-denaturation for 3 minutes, 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 75 seconds, 36 cycles, 72℃ extension for 5 minutes, and storage at 4℃.

[0076] 3. PCR product detection: Take 5 μL of PCR product, electrophoresis in a 1.5% agarose gel, stain with EB, and record the results using a gel imaging system.

[0077] Electrophoresis images of the PCR products of the LcHPS10-Z3 gene were obtained from multiple Leymus chinensis strains. Figure 3 As shown, the LcHPS10-Z3 gene was confirmed to be present in Lc65, while other lines (Lc6, Lc60, Lc80, Lc89, Lc90, Lc93, Lc109, Lc112, Lc117, Lc101, Lc108, Lc113, Lc116, Lc120) did not contain the LcHPS10-Z3 gene. Combining this with the seed set rate data from Example 1, the self-pollination seed set rate of lines containing the LcHPS10-Z3 gene was greater than 0, indicating they could self-pollinate and produce seeds; the self-pollination seed set rate of lines without the LcHPS10-Z3 gene was 0, as shown in Table 2. The presence of the LcHPS10-Z3 gene was completely positively correlated with self-pollination seed set (r=1, p<0.001).

[0078] Table 2

[0079]

[0080] Example 4: Progeny validation of the LcHPS10-Z3 gene

[0081] The Lc65 line carrying the LcHPS10-Z3 gene was self-pollinated, and the resulting seeds were planted under suitable conditions. Fresh leaves were taken, and DNA was extracted and the Z locus genotype was detected by PCR using the method described in Example 3. All F1 generations carried the LcHPS10-Z3 gene. Figure 4 A). The first generation of generals ( Figure 4 Seeds of strain 3 were planted under suitable conditions and tested using the method described in Example 3. All F2 generations carried the LcHPS10-Z3 gene ( Figure 4 C). Therefore, the LcHPS10-Z3 gene can be stably inherited by offspring.

[0082] Nucleotide sequence alignment ( Figure 2 Compared to the self-infertile L6 line, the Lc65 line showed a genotypic variation at the Z locus involving two small deletions at LcHPS10-Z3 (e.g., Figure 2 As shown, the alignment results are from positions 161 to 193 and from positions 252 to 266 from the 5' end. Plants with this deletion can self-pollinate and produce seeds, indicating that in the L65 line, the variation that breaks self-incompatibility only occurs in the Z3 haplotype.

[0083] Example 5: Breeding a new high-yielding self-pollinating line of Leymus chinensis using the molecular marker LcHPS10-Z3.

[0084] The method for breeding high-fruiting self-pollinating lines of Leymus chinensis using the molecular marker LcHPS10-Z3 may include the following steps:

[0085] (1) Hybridization

[0086] In the hybridization, the Lc65 line carrying the LcHPS10-Z3 molecular marker was selected as the donor parent, and the Lc6 line without the LcHPS10-Z3 molecular marker was selected as the recipient parent. Conventional sexual hybridization was carried out to obtain the F1 generation.

[0087] (2) PCR identification

[0088] DNA was extracted using the method described in Example 3, and PCR was used to detect whether the F1 generation plants carried the LcHPS10-Z3 gene. The results showed that lines 1, 2, 3, 4, 5, 6, 7, 8, 12, and 17 carried the LcHPS10-Z3 gene. Figure 5 ).

[0089] (3) Self-pollination and breeding of high-fruiting varieties

[0090] Single plants carrying the LcHPS10-Z3 gene were selected and self-pollinated using the method described in Example 1. Seeds of Leymus chinensis were harvested, and seed testing was conducted. The seed setting rate of each line was counted, and new Leymus chinensis lines with a self-pollination seed setting rate of 60% or higher, carrying the LcHPS10-Z3 gene, and with a genetic background closer to the recipient were selected.

[0091] References

[0092] 1. Lundqvist A (1962a) Self-incompatibility in diploid Hordeumbulbosum L. Hereditas 48: 138-152.

[0093] 2. Kakeda K (2009) S locus-linked F-box genes expressed in anthers ofHordeum bulbosum. Plant Cell Rep 28: 1453-1460

[0094] 3. Kakeda K, Ibuki T, Suzuki J, Tadano H, Kurita Y, Hanai Y, KowyamaY (2008) Molecular and genetic characterization of the S locus in Hordeumbulbosum L., a wild self-incompatible species related to cultivated barley. Mol Genet Genomics 280: 509-519.

[0095] 4. Rohner M, Manzanares C, Yates S, Thorogood D, Copetti D, Lübberstedt T, Asp T, Studer B (2023) Fine-mapping and comparative genomic analysis reveal the gene composition at the S and Z self-incompatibility lociin grasses. Mol Biol Evol 40: msar259.

[0096] 5. Wang et al., (2023) Control of gametophytic self-incompatibility in the African wild rice. Research Square, doi:10.21203 / rs.3.rs-2121145 / v1.

[0097] Sequence List

[0098] SEQ ID NO.1: LcHPS10-Z3 gene

[0099] ATGGTTGCGAAAGCGTTCATTGCCCTCAGCATCCTTCTTATTGCCAATAGCCCGCTTGTATGGGCATCGCGGCAAGTGCCACTCGGAGAACCAATGGTGACTACACACTCTTCGCTGGGTGTTACTAACAAGGACGAACCGACTTCAAACGGTATATATGGCTCCTTCTCGTTCATTTTGGCTGCAATTTGCTGTGTTTACATAACTTGTTACTTTTCTCTAGGTCTAGGAGTTTATAAACTTGGCCATGTTACAGAAGAGAAGGGAATAATGTATGCACCCGACATTACGTTCCGTCCTCCCCGCCTTCCACCTTGCAGGGCAAGAGCATGTTAG

[0100] SEQ ID NO.2: LcHPS10-Z1 gene

[0101] ATGGTCATGAAAGCAGCCTCCGTGTTCACCTTTCTCTTGCTCTCGAGCAATATACTGCTTGTCGCCGTTGCCACACCAGAGGTTCCACCGGCGTCTCCGACCATCAGCGCTGACTCTTTTCGGCGTGAAGCTGGCCAGGTCGTGTCAGCACCACCTTTGCAGAAGATGCGTGAATACAAGCCCATCACTGGTTCGCATTTCATTTTTCTATACACGAATCTCCTTAATCGTTTCTCCATGTGAAGACTGATCTCGAGCTTTGTTTTTCTCACTTGGCATGCAGGTGAGGGCCTCAAACATATTACCCAGGAGAAAATAGTAATGACCGGACCCAATAATTTTGTCTGGCCGCCACGCCTTGCACCATGCAGATCACGGGCATGCTAA

[0102] SEQ ID NO.3: LcHPS10-Z2 gene

[0103] ATGGCCACCAGAGCAGCGCTCCTGTTCGGCTTTCTACTCTTGCTGTCGACCAACATGCTCGTTTCCGTTGTGGCATCGCGAGAGGTTCCATCGGCAGATCCGAGTAATCCAGCAAACTCACTCCTGGGCGGAACTGGTGGCAAATTCACAATGTCACGTGTGGAGAAGACACGGGAATACAAGCCCGTGACTGGTACGCATTTCATCGTCTTACGGTCGATTTAACTGTTAGTATATGAGATATCAGACTGATCGAGAGCTTAAATTTTTGCTGCTCCGCAGGTGAGGGTGTCAGGGCTATTTCCCAGGAGAAGGTGATTTTCACTGCGCCCAATAATTTTGTCTGGCCGACGCGCCTTCCGCCGTGCAGAGCACGAGCATGCTAA

[0104] SEQ ID NO.4: LcHPS10-Z4 gene

[0105] ATGAAGATTGTTCATTATTCCGCTCTCAGCCTCGCCATCCTGCTGGTGACGACAAGCACGATCGTCCCTCCGATATCAGCTCGAGCGATTCCATTTCCAAGCGAGACGAACGATGCTTCTGTGGCTGCAAGCGATTCCCAGATGATTGGTTCGTAAATCTCCCTATATCTCTTTTTCGGCCTTCTTCTCAATCCTATATAGGAGCAATTGTACATTACTTAATTATCTGATTTTCTATCAGGGCGAAACGTTGTACCCATGGAAGGTAGAGACGAGAAGATGTTTGCTACTTGGAGCAACAATTTTGGACCTCCACGACGCCTTCCACCATGCATGTCAAGGGCTTGTTAG

[0106] SEQ ID NO.5: LcHPS10-Z1D gene

[0107] ATGGTCATGAAAGCAGCCTCCGTGTTCACCTTTCTCTTGCTCTCGAGCAATATACTGCTTGTCGCCGTTGCCACACCAGAGGTTCCACCGGCGTCTCCGACCATCAGCGCTGACTCTTTTCGGCGTGAAGCTGGCCAGGTCGTGTCAGCACCACCTTGTTCGCATTTCATTTTTCTATACACGAATCTCCTTAATCGTTTCTCCATGTGAATTGTTTTTCTCACTTGGCATGCAGGTGAGGGCCTCAAACATATTACCCAGGAGAAAATAGTAATGACCGGACCCAATAATTTTGTCTGGCCGCCACGCCTTGCACCATGCAGATCACGGGCATGCTAA

[0108] SEQ ID NO.6: LcHPS10-Z2D gene

[0109] ATGGCCACCAGAGCAGCGCTCCTGTTCGGCTTTCTACTCTTGCTGTCGACCAACATGCTCGTTTCCGTTGTGGCATCGCGAGAGGTTCCATCGGCAGATCCGAGTAATCCAGCAAACTCACTCCTGGGCGGAACTGGTGGCAAATTCACAATGTCACGTGGTACGCATT TCATCGTCTTACGGTCGATTTAACTGTTAGTATATGAGATATCATAAATTTTTGCTGCTCCGCAGGTGAGGGTGTCAGGGCTATTTCCCAGGAGAAGGTGATTTTCACTGCGCCCAATAATTTTGTCTGGCCGACGCGCCTTCCGCCGTGCAGAGCACGAGCATGCTAA

[0110] SEQ ID NO.7: Forward primer for molecular marker LcHPS10-Z3

[0111] ATGGTTGCGAAAGCGTTCAT

[0112] SEQ ID NO.8: Reverse primer for molecular marker LcHPS10-Z3

[0113] CTAACATGCTCTTGCCCTGC

[0114] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A method of obtaining a self-fertile Leymus mollis, the method comprising: A parent guinea grass carrying a LcHPS10-Z3 gene is crossed, selfed and / or backcrossed to obtain progeny guinea grasses, and a guinea grass carrying the LcHPS10-Z3 gene is screened from the progeny guinea grasses, wherein the nucleotide sequence of the LcHPS10-Z3 gene is shown in SEQ ID NO.

1.

2. The method of claim 1, wherein, The method for screening the guinea grass carrying the LcHPS10-Z3 gene comprises a step of PCR amplification using a primer pair, wherein the primer pair is: a forward primer with a nucleotide sequence shown in SEQ ID NO. 7; and a reverse primer with a nucleotide sequence shown in SEQ ID NO.

8.

3. A gene for selfing seed of guinea grass, wherein the gene is a LcHPS10-Z3 gene, and the nucleotide sequence of the LcHPS10-Z3 gene is shown in SEQ ID NO.

1.

4. A primer pair for detecting a LcHPS10-Z3 gene, wherein the primer pair is: a forward primer with a nucleotide sequence shown in SEQ ID NO. 7; and a reverse primer with a nucleotide sequence shown in SEQ ID NO. 8; and the nucleotide sequence of the LcHPS10-Z3 gene is shown in SEQ ID NO.

1.

5. Use of the gene of claim 3 in molecular marker assisted breeding of guinea grass, wherein the assisted breeding is for obtaining a guinea grass with high selfing seed.

Images