Rapid extraction-free hepatitis C virus detection kit and method

Abstract

The invention relates to the technical field of medical examination, in particular to a rapid extraction-free hepatitis C virus detection kit and method. According to the invention, the material carrier is used for providing carrier support for reagent freeze-drying, and during use, the remelting buffer solution is used for remelting, so that the use effect before freeze-drying is achieved. The kit provided by the invention is used as a freeze-drying reagent, and solves the problem of cold-chain transportation of nucleic acid detection kits. The product simulates storage under different temperature conditions, detection results show that the product changes within 15 months, the storage period exceeds that of a control kit, and a new direction is laid for development and exploration of a later nucleic acid detection kit (pcr method). The kit disclosed by the invention lays a foundation for market occupation and long-term development by utilizing storage stability and transportation stability of the kit.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of medical examination, in particular to a rapid extraction-free hepatitis C virus detection kit and method. BACKGROUND

[0002] Hepatitis C virus (HCV) is a single-stranded RNA virus of the Flaviviridae family of the Hepacivirus genus. The virion is spherical, with a diameter of less than 80 nm, and has a lipid outer membrane derived from the host, in which viral gene-encoded glycoproteins (E1 and E2) are embedded, and a spherical nucleocapsid (C) in the center, which encloses the HCV RNA genome strand. The HCV RNA genome strand is about 9600 nucleotides (nt) long, with 5' and 3' non-coding regions on both sides, and a viral gene open reading frame (ORF) between the two ends. From 5' to 3', the ORF includes the core protein (C) coding region, the envelope protein (E) coding region, and the non-structural protein (NS) coding region, which is further divided into NS1-5 regions.

[0003] Hepatitis C (HCV) is a viral hepatitis caused by HCV infection, mainly transmitted through blood, sex and mother-to-child transmission. The incubation period of hepatitis C is 2 weeks to 6 months, with an average of 40 days. More than half of adult infected persons may develop chronic hepatitis C, and if not timely intervention, may develop cirrhosis and liver cancer. The HCV genome has strong variability, making it difficult to develop a hepatitis C vaccine, and no vaccine has been developed to prevent hepatitis C. According to the Global Hepatitis Report 2024, as of 2022, there are 50 million hepatitis C patients worldwide. In addition, the World Health Organization's Global Strategy and Goals for Eliminating Viral Hepatitis 2022-2030 report proposes a global public health strategy and goal to eliminate viral hepatitis by 2030: improve detection and discovery rates, with 90% of hepatitis virus infections being diagnosed, improve treatment coverage, with 80% of diagnosed cases receiving standard antiviral treatment, and significantly reduce new infections of hepatitis C. According to the Polaris report released in 2020, the diagnosis rate of hepatitis C in China is 30%, and the treatment rate is 10%, which is significantly different from the WHO's goal of 90% diagnosis rate and 80% treatment rate by 2030, and the road to prevention and treatment is still long and arduous.

[0004] The detection of hepatitis C virus (HCV) is a key link for the prevention and treatment of hepatitis C, but due to the virus characteristics, detection technology limitations, clinical population complexity and other factors, its detection process faces many difficulties. At present, hospitals mainly rely on antibody / antigen detection method, POCT rapid detection and real-time fluorescent quantitative PCR technology. Among them, the antibody / antigen method is simple and low in cost, but has a long window period, insufficient sensitivity, is easy to produce false negative results, and has a low early diagnosis effect. POCT has the advantage of instantaneity, and is convenient to operate, but has a high false negative rate due to low sensitivity, and has a high risk of missed diagnosis; Real-time fluorescent quantitative PCR is a widely used detection method, which realizes HCV detection through target gene specific amplification, has high sensitivity and strong specificity, and has the advantages of qualitative and quantitative analysis. However, before detection, sample nucleic acid extraction and detection reagent configuration are usually required, and the operation steps are complicated, and the strict low-temperature transportation and storage requirements of the matching reagent kit greatly increase the difficulty of reagent preservation, transportation and use, which seriously restricts the popularization and application of the grassroots. Therefore, the existing detection technologies all have significant limitations, and innovative solutions need to be developed to break through the existing technical bottlenecks.

[0005] In order to solve the above problems, the application provides a rapid extraction-free hepatitis C virus detection kit (rapid PCR method) and method, which uses a real-time fluorescent quantitative PCR instrument to automatically detect the content of hepatitis C virus in human serum and plasma, and confirms whether the patient is infected with hepatitis C virus. SUMMARY

[0006] The application provides a rapid extraction-free hepatitis C virus detection kit and method, and the kit is a detection and diagnosis reagent composed of a complex melting buffer, an A group eight-row reaction set, a B group eight-row reaction set and a C group eight-row reaction set. It can be transported at room temperature, and the hepatitis C virus detection can be completed rapidly in 30 minutes.

[0007] The application is realized by the following technical solutions: In a first aspect, the application provides a rapid extraction-free hepatitis C virus detection kit, which is a dry powder detection and diagnosis kit before use.

[0008] Further, the kit is composed of an A group reaction set, a B group reaction set, a C group reaction set and a complex melting buffer; the A group reaction set, the B group reaction set and the C group reaction set of the kit are in a dry powder state; and the complex melting buffer is in a liquid state.

[0009] Further, the reaction kit of group A is composed of HCV upstream primer F1, HCV downstream primer R1, HCV probe sequence P1, GAPDH upstream primer F2, GAPDH downstream primer R2, GAPDH probe sequence P2, dNTP, Taq polymerase, reverse transcriptase, magnesium sulfate, BSA, pyranose, polyethylene glycol 20000, guanidine hydrochloride, guanidine isothiocyanate, magnetic bead microspheres, preservative.

[0010] Further, the reaction kit of group B is composed of HCV upstream primer F1, HCV downstream primer R1, HCV probe sequence P1, GAPDH upstream primer F2, GAPDH downstream primer R2, GAPDH probe sequence P2, dNTP, Taq polymerase, reverse transcriptase, magnesium sulfate, BSA, pyranose, polyethylene glycol 20000, guanidine hydrochloride, guanidine isothiocyanate, magnetic bead microspheres, preservative, HCV pseudovirus.

[0011] Further, the reaction kit of group C is composed of HCV upstream primer F1, HCV downstream primer R1, HCV probe sequence P1, GAPDH upstream primer F2, GAPDH downstream primer R2, GAPDH probe sequence P2, dNTP, Taq polymerase, reverse transcriptase, magnesium sulfate, BSA, pyranose, polyethylene glycol 20000, guanidine hydrochloride, guanidine isothiocyanate, magnetic bead microspheres, preservative, hepatitis A pseudovirus, hepatitis B pseudovirus, hepatitis E pseudovirus.

[0012] Further, the complex melting buffer is composed of one or more of heps buffer, Mops buffer and Tris buffer.

[0013] Further, the sequence of HCV upstream primer F1 is shown in SEQ ID NO. 1, the sequence of HCV downstream primer R1 is shown in SEQ ID NO. 2, the sequence of HCV probe sequence P1 is shown in SEQ ID NO. 3, the sequence of GAPDH upstream primer F2 is shown in SEQ ID NO. 4, the sequence of GAPDH downstream primer R2 is shown in SEQ ID NO. 5, and the sequence of GAPDH probe sequence P2 is shown in SEQ ID NO. 6; specifically, the primer sequences are as follows: HCV upstream primer F1: AATGRAACTTATGACCACRAT; HCV downstream primer R1: CCYGGCARTTCCGGTGTAC; HCV probe sequence P1: FAM-CGGGAGAGCCATAGTGGTCTGC-BHQ1; GAPDH upstream primer F2: AGATCATCAGCAATGCCTCCT; GAPDH downstream primer R2: ATGAGTCCTTCCACGATACCAA; GAPDH probe sequence P2: CY5-CCACCAACTGCTTAGCACCCCT-BHQ2.

[0014] Further, the used freeze-drying carrier support is composed of BSA, pyranose, and polyethylene glycol 20000.

[0015] Further, the kit is transported at room temperature, and after adding the reconstitution buffer to each component, it is stored at -20±5℃.

[0016] In the second aspect, the application provides a method for using the kit, comprising the following steps: (1) Reconstitution operation: reconstitution buffer is added into the PCR tubes in group A (detection group), group B (positive control group), and group C (negative control group) respectively, wherein 40 μL of reconstitution buffer is added into the PCR tubes in group A, and 50 μL of reconstitution buffer is added into one tube in each of group B and group C; (2) Sample loading: 10 μL of the sample (human serum / plasma without nucleic acid extraction) to be detected is added into each tube in group A; (3) Mixing treatment: seal the PCR tubes in each group, and mix by inverting 3 times; (4) Machine detection: the reaction systems in groups A, B, and C are synchronously placed in a real-time fluorescent quantitative PCR instrument for amplification analysis.

[0017] The amplification procedure is performed as follows: (a) 50℃ for 10 min; (b) 95℃ for 5 min; (c) 95℃ for 5 sec; (d) 60℃ for 5 sec; steps (c)-(d) are cycled for 40 times.

[0018] In the application, the reaction liquid and the negative quality control, the positive quality control, the lysis liquid, the eluent, and the magnetic beads are provided in the form of dry powder through the freeze-drying process, and the reconstitution buffer is provided in the form of liquid. In the application, the effective components in the reaction liquid are attached to the carrier after being freeze-dried by using the freeze-drying carrier support, and after the reconstitution mixed liquid is added, no strong oscillation is needed, only 2-3 times of inverting is needed to complete the reconstitution, and the detection effect is equivalent to that before the reagent is freeze-dried.

[0019] The application provides a non-extraction hepatitis C virus detection kit (fluorescent PCR method) and method, and the selection of each substance is based on: Tris base mainly plays a buffering role, provides a stable reaction environment, and makes the detection result not affected by fluctuations.

[0020] dNTP is the main raw material for synthesizing the target fragment.

[0021] Taq polymerase acts on the polymerization reaction.

[0022] Reverse transcriptase is the enzyme that reverse transcribes RNA virus into DNA.

[0023] BSA, pyranose, polyethylene glycol 20000 as lyophilized carrier support.

[0024] Pseudovirus as target sequence, configured as standard and positive quality control.

[0025] Hepatitis A virus, hepatitis B virus and hepatitis E virus as possible cross-reacting substances, used as negative control in detection.

[0026] Magnesium sulfate provides MG required for reaction 2+ , catalyzes the reaction.

[0027] The present application uses a freeze dryer to freeze the reaction solution, negative quality control and positive quality control for 8 hours, and dry for 24 hours, with moisture content controlled below 1%.

[0028] The kit of the present application can be operated on a real-time fluorescent quantitative PCR instrument, and the specific operation mode is taken as an example of MA6000.

[0029] Compared with the prior art, the present application has the following advantages: The present application provides a rapid extraction-free hepatitis C virus detection kit (rapid PCR method), which can realize normal temperature transportation and storage by freeze-drying all reagent components except the thawing buffer into solid powder, overcomes the dependence of conventional fluorescent quantitative PCR reagents on cold chain transportation system and low temperature storage, greatly reduces the transportation and storage cost of detection reagents, and is convenient for promotion and use in primary medical institutions and remote areas.

[0030] The present application provides a rapid extraction-free hepatitis C virus detection kit (rapid PCR method), which can realize normal temperature transportation and storage by freeze-drying all reagent components except the thawing buffer into solid powder, overcomes the dependence of conventional fluorescent quantitative PCR reagents on cold chain transportation system and low temperature storage, greatly reduces the transportation and storage cost of detection reagents, and is convenient for promotion and use in primary medical institutions and remote areas.

[0031] The hepatitis C virus nucleic acid detection freeze-dried reagent prepared by the present application pre-mixes all reaction components such as primers, probes, enzymes and dNTPs into solid powder by freeze-drying. When used, only the thawing buffer needs to be added for one-step thawing, which can achieve the use effect before freeze-drying, is simple to operate, and avoids the complicated reagent preparation process. BRIEF DESCRIPTION OF DRAWINGS

[0032] The present application will be further described below in conjunction with the drawings.

[0033] Figure 1 Flow chart for use of the application; Figure 2 Figure for data storage of various conditions and control reagents in specific conditions for Example 1; Figure 3 Figure for data storage of various conditions and control reagents in specific conditions for Example 2. DETAILED DESCRIPTION

[0034] The present application provides a no-extraction hepatitis C virus amplification kit (fluorescent PCR method). Different regions, different years and different types of hepatitis C virus sequences are obtained through NCBI, and the homologous part is selected for primer probe design. The internal reference gene uses glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The enzyme is an enzyme in the glycolysis reaction, which is composed of 4 30-40kDa subunits, with a molecular weight of 146kDa. The enzyme gene is a housekeeping gene, which is highly expressed in almost all tissues, and the protein expression amount in the same cell or tissue is generally constant, and is not affected by the inducing substances such as part of the recognition site and phorbol.

[0035] The primers and probes are synthesized by Shanghai Shengong Bioengineering Co., Ltd., and the hepatitis C pseudovirus is prepared by Qianke Biology. The hepatitis A pseudovirus, hepatitis B pseudovirus and hepatitis E pseudovirus are synthesized by Qianke Biology. The hepatitis C standard is purchased from China Food and Drug Inspection Research Institute. The preservative is proclin300 preservative.

[0036] Example 1 In the specific implementation of the present application, the content of each component is as follows: Complex melting buffer composition: .

[0037] The composition of the reaction set of group A is: .

[0038] The composition of the reaction set of group B is: .

[0039] The composition of the reaction set of group C is: .

[0040] Hepatitis A pseudovirus, hepatitis B pseudovirus, hepatitis E pseudovirus 10 5 IU / mL.

[0041] The lyophilized material used in Comparative Example 1 was 5-10% (w / v) trehalose, 0.05-1 mol / L dithiothreitol (DTT), 0.01-0.05% (w / v) BSA, 0.006-0.01% (v / v) Tween-20, 8-10% (w / v) mannitol, 7-10% (w / v) dextran. The test was detected and analyzed as a control.

[0042] The specific composition is as follows: .

[0043] Example 2

[0044] In the specific implementation of the present application, the content of each component is as follows: The composition of the refusion buffer is: .

[0045] The composition of the reaction set of Group A is: .

[0046] The composition of the reaction set of Group B is: .

[0047] The composition of the reaction set of Group C is: .

[0048] The lyophilized material used in Comparative Example 1 was 5-10% (w / v) trehalose, 0.05-1 mol / L dithiothreitol (DTT), 0.01-0.05% (w / v) BSA, 0.006-0.01% (v / v) Tween-20, 8-10% (w / v) mannitol, 7-10% (w / v) dextran. The test was detected and analyzed as a control. .

[0049] The refusion buffer uses purified water.

[0050] Example 3

[0051] In the specific implementation of the present application, the content of each component is as follows: The composition of the refusion buffer is: .

[0052] The composition of the reaction set of Group A is: .

[0053] The composition of the reaction set of Group B is: .

[0054] The C-group reaction kit consists of: .

[0055] The hepatitis C virus primer and probe sequences used in control example 2 are as follows: Upstream F:CGGTGGTTTCTGGGGTGAC; Downstream R: AGGGGTTGGTTGGATGAADATAG; Primer probe P: GGTTAAT(Linker)AGCCCTTCGCCCTC; Reagents were prepared according to the existing market specifications (CN113234866B) of Shanghai Junyuan Biotechnology Co., Ltd. More than 100 clinical blood samples and national standard products were tested.

[0056] Example 4

[0057] In a specific implementation, the present invention comprises the following components: Composition of the reconstitution buffer: .

[0058] Group A reaction transfer composition: .

[0059] The reaction kit for group B consists of: .

[0060] The C-group reaction kit consists of: .

[0061] Example 5 Performance testing of the reagent kit of this invention Stability testing Storage stability The reagent kit of this invention (prepared according to the formulation in Example 1) was compared with a commercially available reagent kit (Hepatitis C Virus (HCV) Nucleic Acid Detection Kit (Fluorescent PCR Method) produced by Guangzhou Baochuang Biotechnology Co., Ltd., Production License No.: Yue Shi Yao Jian She Sheng Chan Xu 20091779). The instrument used was an MA6000. The reaction conditions were as follows: (a) 50℃ for 10 min; (b) 95℃ for 5 min; (c) 95℃ for 5 sec; (d) 60℃ for 5 sec; repeat steps (c)-(d) 40 times.

[0062] A simplified flowchart of the operation process of the reagent kit of this invention is shown below. Figure 1 As shown, the control reagent was used according to the instructions.

[0063] The data graphs of the reagents of Example 1 and the control reagents stored under various conditions and stored under specific conditions are shown in Figures 1 and 2, respectively. Figure 2 The detection results are shown in Table 1. Table 1. Stability detection results of the reagents of Example 1 and the control reagents of the present application (CT value) .

[0064] The reagent kit of the present application (prepared according to the formulation of Example 2) and the reagent kit currently on the market were compared using a MA6000 instrument. The reaction conditions were as follows: (a) 50℃ 10min; (b) 95℃ 5min; (c) 95℃ 5sec; (d) 60℃ 5sec; steps (c)-(d) were repeated for 40 times.

[0065] The control reagents were operated according to the instructions. The data graphs of the reagents of Example 2 and the control reagents stored under various conditions and stored under specific conditions are shown in Figures 3 and 4, respectively. Figure 3

[0066] Table 2. Stability detection results of the reagents of Example 2 and the control reagents of the present application (CT value) .

[0067] From Tables 1 and 2, it can be found that the change ratio of the reagent kit of the present application after 15 months under the conditions of -20℃, 4℃, 20℃, 37℃ and 42℃ is not more than 3%, wherein the change ratio of Example 1 is not more than 2.74% and the change ratio of Example 2 is not more than 0.31%, but the change ratio of the control reagent 1 under the condition of -20℃ is more than 14%; therefore, the storage stability of the reagent kit of the present application is significantly better than that of the control reagent kit, and the reagent kit of the present application has low requirements for storage temperature and has wide temperature range adaptability from -20℃ to 42℃.

[0068] Study on the effect of freeze-drying carrier on reagent stability The reagent kits of Example 1 (with freeze-drying carrier but without freeze-drying treatment) and Example 4 (without freeze-drying carrier and without freeze-drying treatment) of the present application were used for product stability tracking experiments using a MA6000 instrument. The reaction conditions were as follows: (a) 50℃ 10min; (b) 95℃ 5min; (c) 95℃ 5sec; (d) 60℃ 5sec; steps (c)-(d) were repeated for 40 times.

[0069] The detection results are shown in Table 3. Table 3. Results of the study on the effect of freeze-drying carrier on reagent stability .

[0070] ​From Table 3, it is found that the product without lyophilized carrier has a storage stability of less than 12 months at -20°C, and the product with lyophilized carrier has almost no change in storage stability within 15 months. When the two products are stored in a 2-8°C refrigerator, the results of periodic monitoring show that the product containing lyophilized carrier has a deviation of 4.45% within 15 days at 2-8°C, which meets the accuracy requirement; the product without lyophilized carrier has a deviation of 15.27% within 11 days at 2-8°C, which exceeds the accuracy deviation requirement. It is shown that the lyophilized carrier not only provides a carrier support function in the present application, but also has a certain effect on the stability of the product.

[0071] Jinan as the radiation center, under the condition of high temperature in summer, multi-dimensional transportation verification is carried out: south to Hainan, north to Heilongjiang Mohe, west to Xinjiang Urumqi, southwest to Tibet Lhasa, and the reagent returns to Jinan immediately after reaching the destination. In order to accurately evaluate the influence of transportation environment on the performance of reagent, the reagents of examples 1, 2 and 3 are sent to four places at the same time, and after reaching the destination, they return to Jinan and perform performance test in Jinan laboratory at the same time to ensure the comparability of the results. The instrument used is MA6000, and the reaction conditions are: (a) 50°C for 10 min; (b) 95°C for 5 min; (c) 95°C for 5 sec; (d) 60°C for 5 sec; steps (c)-(d) are cycled for 40 times. The test results are shown in Tables 4, 5 and 6.

[0072] The control reagent is operated according to the instructions.

[0073] Table 4 Detection results of kit of the present application after transportation of example 1 .

[0074] Table 5 Detection results of kit of the present application after transportation of example 2 .

[0075] Table 6 Detection results of kit of the present application after transportation of example 3 .

[0076] As shown in the detection results of Tables 4, 5 and 6, examples 1 and 3 respectively transported to Hainan and Xinjiang, the detection limit performance index did not reach 19 times detection in 20 times detection, this performance reached 90% detection, but example 2 was better.

[0077] Clinical sample detection experiment The kit of the present application and the comparative kit are randomly tested with N=103 samples, and the test results are embodied in the form of a table in the following table. Through the results recorded in the table 5, the consistency of the kit of the present application and the kit circulating in the market is calculated. The detection results are shown in Table 7: The kit of the present application (formulations of examples 1, 2 and 3) and the kit circulating in the market are compared, and the instrument is MA6000. The reaction conditions are: (a) 50℃ 10min; (b) 95℃ 5min; (c) 95℃ 5sec; (d) 60℃ 5sec; steps (c)-(d) are cycled 40 times.

[0078] The control reagent is operated according to the instructions.

[0079] Table 7 Clinical detection results of the kit of the present application and the control kit Table 7 Accuracy detection results of the reagent of example 3 of the present application and the control reagent (negative and positive) .

[0080] As shown in Table 7, 72 clinical samples are detected by the kit of the present application and the control example 2. It is found that there is only one inconsistency in sample 68 by comparing the results of example 1 and example 3 with the control example 2. The results of example 2 and the control example 2 are consistent. The sample 68 is sequenced by the present application, and the conclusion is that the hepatitis C virus type 4 is positive. Therefore, examples 1 and 3 are superior to the control example.

[0081] National standard product detection test Table 8 Detection results of national standard products .

[0082] Table 8 The detection of different types of hepatitis C virus of the national standard product is detected again to confirm that examples 1 and 3 can detect all types, but the control example 2 and example 2 cannot effectively detect the hepatitis C virus type 4.

[0083] Detection limit experiment The national standard product is diluted to prepare a detection limit reference product with a concentration of 5IU / mL. The reagent is configured and produced using the formulations of examples 1 and 3. The 5IU / mL detection limit reference product is detected, and the results are shown in Table 9: Table 9 Detection limit detection results .

[0084] As shown in Table 9, the reagent formulation of example 1 is superior to example 2 in the product detection limit, and can effectively detect 5IU / mL of hepatitis C virus. It can be used for early detection of mild or latent infections and assist in later diagnosis and treatment.

[0085] In summary, the kits of the present application are best formulated according to the formulation of Example 1.

Claims

1. A rapid, extraction-free hepatitis C virus detection kit, characterized in that, The kit was originally a dry powder detection and diagnostic kit.

2. The reagent kit according to claim 1, characterized in that, The kit consists of reaction kit A, reaction kit B, reaction kit C, and reconstitution buffer; reaction kits A, B, and C are in dry powder form; the reconstitution buffer is in liquid form.

3. The reagent kit according to claim 2, characterized in that, Group A reaction kit consists of HCV upstream primer F1, HCV downstream primer R1, HCV probe sequence P1, GAPDH upstream primer F2, GAPDH downstream primer R2, GAPDH probe sequence P2, dNTPs, Taq polymerase, reverse transcriptase, magnesium sulfate, BSA, pyranose, polyethylene glycol 20000, guanidine hydrochloride, guanidine isothiocyanate, magnetic microspheres, and preservatives.

4. The reagent kit according to claim 2, characterized in that, Group B reaction kit consists of HCV upstream primer F1, HCV downstream primer R1, HCV probe sequence P1, GAPDH upstream primer F2, GAPDH downstream primer R2, GAPDH probe sequence P2, dNTPs, Taq polymerase, reverse transcriptase, magnesium sulfate, BSA, pyranose, polyethylene glycol 20000, guanidine hydrochloride, guanidine isothiocyanate, magnetic microspheres, preservatives, and HCV pseudovirus.

5. The reagent kit according to claim 2, characterized in that, Group C reaction kit consists of HCV upstream primer F1, HCV downstream primer R1, HCV probe sequence P1, GAPDH upstream primer F2, GAPDH downstream primer R2, GAPDH probe sequence P2, dNTPs, Taq polymerase, reverse transcriptase, magnesium sulfate, BSA, pyranose, polyethylene glycol 20000, guanidine hydrochloride, guanidine isothiocyanate, magnetic microspheres, preservatives, and pseudoviruses for hepatitis A, hepatitis B, and hepatitis E.

6. The reagent kit according to claim 2, characterized in that, Reconstitution buffer is composed of one or more of heps buffer, mops buffer and tris buffer.

7. The reagent kit according to any one of claims 4-5, characterized in that, The HCV upstream primer F1 sequence is shown in SEQ ID NO.1, the HCV downstream primer R1 sequence is shown in SEQ ID NO.2, the HCV probe P1 sequence is shown in SEQ ID NO.3, the GAPDH upstream primer F2 sequence is shown in SEQ ID NO.4, the GAPDH downstream primer R2 sequence is shown in SEQ ID NO.5, and the GAPDH probe P2 sequence is shown in SEQ ID NO.

6.

8. The reagent kit according to claim 1, characterized in that, The freeze-dried carrier support is composed of BSA, pyranose, and polyethylene glycol 20000.

9. The reagent kit according to claim 1, characterized in that, The kit should be transported at room temperature and stored at -20±5℃ after adding reconstitution buffer to each component.

10. The method of using the reagent kit according to any one of claims 1-9, characterized in that, Includes the following steps: (1) Reconstitution operation: Add the reconstitution buffer to the eight-tube PCR tubes of the detection group A, the positive control group B, and the negative control group C respectively. Add 40 μL of reconstitution buffer to the PCR tube of group A, and add 50 μL of reconstitution buffer to one tube of each of groups B and C. (2) Sample loading: Add 10 μL of the sample to be tested to each tube in group A; (3) Mixing treatment: Seal each group of PCR tubes and invert to mix 3 times; (4) Detection on the instrument: The reaction systems of groups A, B, and C were simultaneously placed in a real-time fluorescence quantitative PCR instrument for amplification and analysis; the amplification program was performed as follows: (a) 50℃ for 10 min; (b) 95℃ for 5 min; (c) 95℃ for 5 sec; (d) 60℃ for 5 sec; repeat steps (c)-(d) 40 times.

Images