Potato hp1 gene, protein and application thereof in increasing potato tuber yield

Abstract

The application provides a potato HP1 gene, a protein and application thereof in improving potato tuber yield. Through research, a key protein HP1 and a gene HP1 for regulating potato tuber yield are identified. Compared with wild-type potatoes, potatoes overexpressing the protein HP1 or the HP1 gene can effectively improve nitrogen utilization efficiency of the potatoes, increase plant height of the potatoes and effectively improve tuber yield of the potatoes under full nitrogen and 1 / 10 nitrogen culture conditions. Therefore, the potato HP1 gene can be used as an important excellent allele for regulating potato tuber yield, and has important significance in improving potato tuber yield and cultivating high-yield potato varieties.

Description

Technical Field

[0001] This invention belongs to the field of bio-agricultural technology, specifically relating to the potato HP1 gene, protein, and its application in increasing potato tuber yield. Background Technology

[0002] Potatoes are characterized by their high nutritional value and yield. Unlike other seed crops, potatoes are harvested as tubers. While seed crops store matter and energy in their seeds, potatoes store nitrogen in their tubers through the absorption, translocation, transformation, and fixation of nitrogen, in the form of storage proteins and free amino acids. Nitrogen use efficiency is crucial to potato yield. Due to the high heterozygosity of the tetraploid potato genome, the genetic mechanisms of agronomic traits in offspring are exceptionally complex. Current techniques cannot locate superior alleles for nitrogen use efficiency in potatoes by constructing segregating tetraploid populations. No superior allele has yet been identified in the potato nitrogen use pathway that increases yield.

[0003] Therefore, finding superior alleles that can improve nitrogen use efficiency in potatoes is of great application value for increasing potato tuber yield. Summary of the Invention

[0004] Based on this, the purpose of this invention is to provide the potato HP1 gene, protein, and its application in increasing potato tuber yield.

[0005] To achieve the above objectives, the present invention adopts the following technical solution.

[0006] The first aspect of the present invention provides a protein (HP1) for increasing potato tuber yield, the amino acid sequence of which is shown in SEQ ID NO: 3.

[0007] A second aspect of the invention provides a nucleic acid molecule (HP1) for increasing potato tuber yield, the nucleic acid molecule encoding the protein described above.

[0008] In some embodiments, the nucleotide sequence of the coding region of the nucleic acid molecule is shown in SEQ ID NO: 2.

[0009] In some embodiments, the nucleic acid molecule also includes a promoter that initiates transcription of the coding region in potato cells.

[0010] In some of these embodiments, the nucleotide sequence of the promoter is shown in SEQ ID NO: 1.

[0011] A third aspect of the present invention provides a biomaterial for increasing potato tuber yield, said biomaterial being any one of the following (a1) to (a7):

[0012] (a1) Expression cassette for expressing the protein as described above;

[0013] (a2) An expression cassette containing the nucleic acid molecules described above;

[0014] (a3) Recombinant vectors expressing the proteins described above;

[0015] (a4) A recombinant vector containing nucleic acid molecules as described above;

[0016] (a5) Host cells expressing the proteins described above;

[0017] (a6) A host cell containing nucleic acid molecules as described above;

[0018] (a7) A host cell containing any of the biological materials described in (a1)-(a4).

[0019] In some of these embodiments, the host cell is a bacterial or fungal cell.

[0020] A fourth aspect of the invention provides for any of the following applications of the protein, nucleic acid molecule, or biological material as described above:

[0021] (b1) Improve nitrogen use efficiency in potatoes;

[0022] (b2) Increase potato tuber yield.

[0023] A fifth aspect of the present invention provides a method for cultivating potatoes, the method comprising overexpressing, in a recipient plant, a protein or nucleic acid molecule as described above, to obtain a target plant. Compared to the recipient plant, the target plant exhibits increased nitrogen use efficiency and / or increased tuber yield.

[0024] In some of these embodiments, the method of overexpressing the protein or nucleic acid molecule described above in the recipient plant includes one or more of the following: promoter editing technology, codon optimization, using a strong promoter, inserting an intron, using a viral vector, and fusion protein technology.

[0025] A sixth aspect of the present invention provides a method for producing potato plants and plant parts thereof, the method comprising:

[0026] 1) Introduce the protein, nucleic acid molecule, or biological material as described above into plant protoplasts, cells, or callus tissue to grow and form a plant; or obtain a plant using the cultivation method described above;

[0027] 2) Self-pollinating the plants in 1) to form offspring, and growing the offspring to form plants and their plant parts;

[0028] Alternatively; doubling the plant chromosomes in 1) to form polyploid offspring, and growing the offspring to form plants and their plant parts;

[0029] Or; hybridize the plant in 1) with other varieties to form offspring, and grow the offspring to form plants and plant parts thereof.

[0030] Compared with the prior art, the present invention has the following beneficial effects.

[0031] This invention, through research combining BSA-seq and QTL-seq data, identified a key protein, HP1, and gene, HP1, that regulate potato tuber yield. Compared to wild-type potatoes, potatoes overexpressing either the HP1 protein or the HP1 gene showed significantly improved nitrogen use efficiency, increased plant height, and overall tuber yield under both total nitrogen and 1 / 10 nitrogen culture conditions. Therefore, the potato HP1 gene of this invention can serve as an important and superior allele for regulating potato tuber yield, and is of great significance in increasing potato tuber yield and breeding high-yielding potato varieties. Attached Figure Description

[0032] Figure 1 The image shows the identification results of plants overexpressing HP1.

[0033] Figure 2 The results of improving nitrogen use efficiency in potatoes by overexpressing HP1 are shown in the figure.

[0034] Figure 3 The results of overexpressing HP1 to increase potato tuber yield are shown in the figure. Detailed Implementation

[0035] Unless otherwise specified, the experimental methods described in the following embodiments of the present invention are generally performed under conventional conditions or as recommended by the manufacturer. All commonly used chemical reagents used in the embodiments are commercially available products.

[0036] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention.

[0037] The terms "comprising" and "having," and any variations thereof, are intended to cover non-exclusive inclusion. For example, a process, method, apparatus, product, or device that includes a series of steps is not limited to the steps or modules listed, but may optionally include steps not listed, or may optionally include other steps inherent to such process, method, product, or device.

[0038] HP1: Nitrate transporter protein.

[0039] In this invention, HP1 or HP1 represents a gene or protein, which can be determined based on the context.

[0040] Sequence 1 (HP1 gene promoter)

[0041]

[0042] Sequence 2 (HP1 gene CDS)

[0043]

[0044] Sequence 3 (HP1 protein)

[0045] SEQ ID NO: 3:

[0046] The potatoes described in this invention include diploid potatoes, triploid potatoes, tetraploid potatoes, or other polyploid potatoes.

[0047] In specific embodiments provided by the present invention, the methods of overexpressing the HP1 gene or HP1 protein in the recipient plant include one or more of the following: promoter editing technology, codon optimization, using strong promoters, inserting introns, using viral vectors, and fusion protein technology.

[0048] In some embodiments, the overexpression method includes the following optional methods:

[0049] A. Achieving overexpression using various promoter editing techniques. Promoter editing techniques include the following optional methods: a) Small-scale alterations to the endogenous promoter (base deletion or omission, but all operations are performed on the original endogenous promoter) (Rodriguez-Leal, D., Lemmon, ZH, Man, J., Bartlett, ME, and Lippman, ZB, 2017. Engineering Quantitative Trait Variation for CropImprovement by Genome Editing. Cell 171, 470-480 e478). (10.1016 / j.cell.2017.08.030.): Using CRISPR / Cas9 technology, sequences covering the entire promoter region can be designed. The resulting modified promoter sequence affects the binding ability of transcription factors, thus affecting the expression of downstream genes. Some promoters contain uORFs encoding small peptides. During gene transcription, the transcription of uORFs can affect the transcription of downstream genes, thus affecting their expression. Modifying these uORFs using CRISPR / Cas9 technology can also alter the expression of downstream genes. b. Using CRISPR / Cas technology, enhancers or other gene expression-enhancing elements can be inserted into existing endogenous promoters to enhance gene expression. c. Direct replacement of the endogenous promoter corresponding to the gene: First, use knock-in to replace the endogenous promoter with a strong promoter (such as 35S, or a constitutively strong expression promoter); Second, use CRISPR / Cas9 technology to induce chromosome inversion, thereby exchanging promoters of different genes and increasing the expression of the target gene (Schwartz, C., Lenderts, B., Feigenbutz, L., Barone, P., Llaca, V., Fengler, K., and Svitashev, S. ,2020. CRISPR-Cas9-mediated 75.5-Mb inversion in maize. NatPlants 6, 1427-1431. 10.1038 / s41477-020-00817-6.).

[0050] B. Transgenic methods are used to introduce the DNA sequence encoding the target gene into cells. The following methods can be used individually or in combination: First, altering the DNA sequence corresponding to the endogenous gene through codon optimization; Second, utilizing strong promoters (constitutive strong promoters achieve overexpression in all tissues, while tissue-specific promoters achieve overexpression in specific tissues); Third, certain introns can enhance gene expression; inserting these introns into the target gene can enhance its expression (Gallegos, JE, and Rose, AB, 2019. An intron-derived motif strongly increases gene expression from transcribed sequences through a splicing independent mechanism in Arabidopsisthaliana. Sci Rep 9, 13777. 10.1038 / s41598-019-50389-5.); Fourth, fusing certain solubilizing or anti-degradation tags or protein sequences to the end of the target gene to enhance the expression level of the target protein or prevent its degradation.

[0051] C. Overexpression of the target gene using viral vectors (DNA viruses and RNA viruses) (Torti, S., Schlesier, R., Thummler, A., Bartels, D., Romer, P., Koch, B., Werner, S., Panwar, V., Kanyuka, K., Wiren, NV, et al., 2021. Transient reprogramming of cropplants for agronomic performance. Nat Plants 7, 159-171. 10.1038 / s41477-021-00851-y.). The virus replicates extensively in plant cells, greatly increasing the copy number of the target gene and thus achieving overexpression.

[0052] D. Other ways to achieve the purpose of overexpression.

[0053] The following description is based on specific implementation methods.

[0054] Example 1: Transgenic HP1 gene driven by its own promoter

[0055] The HP1 gene was transgenic using Agrobacterium GV3101 to obtain potato plants overexpressing the HP1 gene. The specific steps are as follows:

[0056] Step 1: Selection of HP1 gene and promoter

[0057] The self-promoter of the HP1 gene was selected, and its nucleotide sequence is shown in SEQ ID NO: 1, with a length of 2000 bp.

[0058] Step 2: Construction of the HP1 vector

[0059] The promoter sequence and CDS sequence (nucleotide sequence such as SEQ ID NO: 2) of the HP1 gene were fused using a gene fusion method, constructed into the Agrobacterium binary vector VMV047 using Novizan ClonExpress technology, and the sequence consistency with the genomic reference sequence was verified by sequencing.

[0060] Step 3: Obtaining transgenic plants

[0061] The correctly constructed Agrobacterium binary vector VMV047 was transformed into Agrobacterium strain GV3101 by electroporation at 1800V for 5 seconds. Colony PCR of the Kan resistance gene confirmed the recombinant strain GV3101 / VMV047. The recombinant strain was then transformed into tetraploid Desiree potato plants using potato stem segment transformation. Finally, tissue culture seedlings were screened for Kan resistance. The specific genetic transformation process is as follows:

[0062] Explant preparation: Take stem segments from sterile potato seedlings (usually with 1-2 axillary buds or stem nodes) and cut them into small segments of 0.5-1 cm in length.

[0063] Agrobacterium infection: Immerse the stem segments in an Agrobacterium solution containing the target gene for 10-20 minutes, allowing the Agrobacterium to adhere to the surface of the stem segments and potentially enter the cells.

[0064] Co-culture: After infection, remove excess bacterial solution and place the stem segment on a culture medium without antibiotics. Incubate in the dark at around 25°C for 2-3 days to promote the interaction between Agrobacterium and stem segment cells, which is beneficial for T-DNA transfer and integration.

[0065] Sterilization and screening: The stem segments were transferred to a Kan selection marker medium to eliminate untransformed cells and retain positive transformants.

[0066] Regenerated plants: Positive stem segments are induced to differentiate into buds on differentiation medium. Once the buds have grown to a certain length, they are cut off and transferred to rooting medium to induce rooting, thus obtaining complete transformed plants.

[0067] Example 2 Identification of HP1 transgenic material

[0068] Potato leaves of the T0 generation transgenic plants obtained in step 3 of Example 1 were collected, and genomic DNA was extracted for Kan resistance identification.

[0069] The primer sequences for Kan resistance gene detection are as follows:

[0070] Kan-CDS-F:CTCGGCAGGAGCAAGGTGAGATGAC (SEQ ID NO: 4).

[0071] Kan-CDS-R:CGGCTATGACTGGGCACAACAGACAAT (SEQ ID NO: 5).

[0072] RNA was extracted from leaves of Kan-resistant plants and reverse transcribed into cDNA for qRT-PCR to detect HP1 gene expression.

[0073] The qRT-PCR identification primers are as follows:

[0074] HP1-qRT-F:ATGGGATCGGATGAAAG (SEQ ID NO: 6).

[0075] HP1-qRT-R:GTTGTATTAGTTGCTGCACC (SEQ ID NO: 7).

[0076] Gene quantification was performed using actin as an internal reference. Primers are as follows:

[0077] actin-qRT-F: GGGATGGAGAAGTTTGGTGGTGG (SEQ ID NO: 8).

[0078] actin-qRT-R: CTTCGACCAAGGGATGGTGTAGC (SEQ ID NO: 9).

[0079] The qRT-PCR reaction system is as follows:

[0080] 2×PerfectStart® Green qPCR SuperMix, 10 μL; Universal PassiveReference Dye(50×), 0.4 μL; Forward Primer(10μM), 0.4 μL; Reverse Primer(10μM), 0.4 μL; Nuclease-free Water, 6.8 μL; cDNA, 2 μL. The total volume is 20 μL.

[0081] The qRT-PCR reaction procedure is as follows: 94℃, pre-denaturation for 30 seconds; 94℃, denaturation for 5 seconds; 60℃, annealing for 30 seconds; 95℃, extension for 15 seconds; for melting curve analysis, react at 60℃ for 60 seconds, then at 95℃ for 15 seconds.

[0082] The results are as follows Figure 1 As shown, two plants, pHP1:HP1-4 and pHP1:HP1-5, were identified in the T0 generation that overexpressed the HP1 gene, with a significantly increased expression level of the HP1 gene. These identified T0 generation HP1 transgenic plants were used for subsequent identification of potato tuber growth phenotypes.

[0083] Example 3: HP1 transgenic material can improve nitrogen use efficiency and yield of potato tubers.

[0084] The T0 generation HP1 gene overexpressing plants pHP1:HP1-4 and pHP1:HP1-5 obtained in Example 2 were planted in a greenhouse in Kunming, Yunnan Province during winter, with the T0 generation wild-type plants as a control.

[0085] pHP1:HP1-5 were treated with full-N Hogland medium and 1 / 10N Hogland medium, respectively, and plant height was measured after 4 weeks. The full-N Hogland medium formula was: 435 mg / L K₂SO₄, 136 mg / L KH₂PO₄, 241 mg / L MgSO₄, 36.7 mg / L FeNaEDTA, 0.83 mg / L KI, 6.2 mg / L H₃BO₃, 16.9 mg / L MnSO₄·H₂O, 8.6 mg / L ZnSO₄·7H₂O, 0.25 mg / L Na₂MoO₄·2H₂O, 0.025 mg / L CuSO₄·5H₂O, 0.025 mg / L CoCl₂·6H₂O, 444 mg / L CaCl₂ 2, 506 mg / L KNO3, 80 mg / L NH4NO3. The concentrations of KNO3 and NH4NO3 in 1 / 10N Hogland medium were replaced with 50.6 mg / L and 8 mg / L, respectively, while other components and concentrations remained unchanged.

[0086] After pHP1:HP1-4 and pHP1:HP1-5 were cultured in N-rich soil for 4 months, the tuber size and yield of the transgenic plants were statistically analyzed.

[0087] like Figure 2 As shown, compared with wild-type plants, pHP1:HP1-5 plants showed significantly increased height under both full N and 1 / 10 N treatments, indicating that overexpression of HP1 improves nitrogen use efficiency in potatoes.

[0088] like Figure 3 As shown, compared with wild-type Desiree plants (WT), the yields of potato tubers from HP1 transgenic plants pHP1:HP1-4 and pHP1:HP1-5 were significantly increased. The yields per plant for WT, pHP1:HP1-4, and pHP1:HP1-5 were 264.1g, 337.7g, and 345.4g, respectively. These results indicate that the HP1 gene is an important and superior allele regulating potato tuber yield, and overexpression of the HP1 gene can effectively increase potato tuber yield. The currently reported yield of wild-type Desiree potato plants is 3650 catties / mu. Based on the increased yield per plant for pHP1:HP1-4 and pHP1:HP1-5, it is estimated that HP1 gene overexpression in potato varieties can increase yield by 500-800 catties / mu, resulting in an additional income of 1000-1600 yuan.

[0089] Currently, potato yield per mu (a Chinese unit of area, approximately 0.067 hectares) varies considerably due to factors such as variety, planting techniques, and soil conditions. Generally, potato yield per mu ranges from 2000 to 8000 jin (a Chinese unit of weight, approximately 4000 catties). For example, under excellent water and fertilizer conditions, the average yield of "Yu Potato No. 5" reaches 6152 jin (a Chinese unit of weight, approximately 340 kg) per mu. The HP1 gene of this invention can be applied to both conventional and high-yielding potato varieties to further increase the tuber yield of these varieties.

[0090] In summary, the potato HP1 gene of this invention can serve as an important superior allele for regulating potato tuber yield, and is of great significance in improving potato tuber yield and breeding high-yield potato varieties.

[0091] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0092] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. Application of a protein with an amino acid sequence as shown in SEQ ID NO: 3 in increasing potato tuber yield.

2. Application of nucleic acid molecules encoding proteins with amino acid sequences as shown in SEQ ID NO: 3 in increasing potato tuber yield.

3. The application as described in claim 2, characterized in that, The nucleotide sequence of the coding region of the nucleic acid molecule is shown in SEQ ID NO:

2.

4. The application as described in claim 3, characterized in that, The nucleic acid molecule also contains a promoter that initiates transcription of the coding region in potato cells.

5. The application as described in claim 4, characterized in that, The nucleotide sequence of the promoter is shown in SEQ ID NO:

1.

6. The application of biomaterials in increasing potato tuber yield, characterized in that, The biomaterial is any one of the following (a1) to (a7): (a1) An expression cassette for expressing the protein as described in claim 1; (a2) An expression cassette containing a nucleic acid molecule as described in any one of claims 2-5; (a3) A recombinant vector expressing the protein as described in claim 1; (a4) A recombinant vector containing the nucleic acid molecule as described in any one of claims 2-5; (a5) A host cell expressing the protein as described in claim 1; (a6) A host cell containing the nucleic acid molecule as described in any one of claims 2-5; (a7) A host cell containing any of the biological materials (a1)-(a4).

7. The application as described in claim 6, characterized in that, The host cell is a bacterial or fungal cell.

8. A method for cultivating potatoes, characterized in that, The method includes overexpressing the protein as described in claim 1 or the nucleic acid molecule as described in any one of claims 2-5 in a recipient plant to obtain the target plant; Compared with the recipient plant, the target plant exhibits increased tuber yield.

Images