Enterobacter cancerogenus and application thereof in degrading solanum alkaloid

Abstract

The application belongs to the technical field of microorganisms, and provides a carogenic Enterobacter and application thereof in degrading solanum alkaloid. Enterobacter cancerogenus JLU1, which was preserved in the China General Microbiological Culture Collection Center on June 23, 2025, and has a preservation number of CGMCC No.34971. In the embodiment of the application, intestinal bacteria are separated by dissecting the tomato leafworm larva intestine, and then bacteria resistant to solanum alkaloid or even capable of degrading and utilizing solanum alkaloid are screened and identified, so that the role of the bacteria in the resistance of the tomato leafworm to solanum alkaloid is analyzed, and a foundation is laid for subsequent research on the resistance mechanism.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, and in particular relates to a carcinogenic Enterobacter and its application in the degradation of tomatine. Background Technology

[0002] Tomato leafminer ( Tuta absoluta Tomato leafminers (Meyrick) are a global pest belonging to the genus Meyrick in the family Meytidae of the order Lepidoptera. They have a wide host range, strong dispersal ability, and cause significant damage to crops. The adults are small, fly rapidly, are secretive, and lay a large number of eggs, making control difficult. Tomato leafminers feed on a variety of crops, including approximately 50 species of plants from 11 families, with tomatoes being the most severely affected. They are holometabolous insects, with a life cycle consisting of four stages: egg, larva, pupa, and adult. The larvae have four instars. The larvae feed on the leaves, buds, and stems of tomatoes, and can also bore into the fruit. Leafmining is the most common form of damage. When leaves are damaged, the leaf tissue is eaten away, leaving only the upper and lower epidermis, forming translucent tunnels or spots resembling window paper. When observed against the light, the larvae can usually be seen feeding within the leaves. In severe cases, the leaves dry out and wrinkle.

[0003] Tomatine is a steroidal glycoside alkaloid found in tomato plants, with the chemical formula C. 50 H 83 NO 21 Tomatine, insoluble in water but soluble in organic solvents such as DMSO, is a defensive secondary metabolite produced by tomatoes. It is widely distributed in various organs and tissues of the tomato plant, with the highest content in tomato leaves. It is the source of the fruit's bitterness. High concentrations of tomatine in food can cause bitterness and a burning sensation in the throat, and may even lead to vomiting and diarrhea. Increased tomatine levels can also cause undesirable phenotypes in tomatoes, such as stunted growth, stem corking, and morphological deformities of leaves and fruits. Therefore, reducing tomatine expression is an important aspect of breeding. In addition, tomatine possesses certain antibacterial and insecticidal activities, which can help prevent plants from being eaten or infected by pathogens. Many studies have shown that tomatine can cause cell death by binding to cholesterol on fungal cell membranes and cleaving the membrane structure. It can inhibit various plant pathogenic fungi such as Botrytis cinerea, Leaf mold, and Potato late blight to a certain extent, and also has a certain inhibitory effect on pests such as whiteflies and Mediterranean fruit flies.

[0004] Current research on the gut bacteria of the tomato leafminer is limited. Most of the existing reports are limited to the species classification and diversity analysis of gut bacteria, and lack research on their alkaloid degradation function and interaction with the host. Summary of the Invention

[0005] The purpose of this invention is to provide a carcinogenic Enterobacter, which aims to solve the problems mentioned in the background art.

[0006] The present invention is implemented as follows: a carcinogenic Enterobacter, wherein the carcinogenic Enterobacter is a carcinogenic Enterobacter ( Enterobacter cancerogenus JLU1 was deposited on June 23, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34971. Its 16S rRNA sequence is shown in SEQ ID NO:1.

[0007] Another objective of this invention is to provide an application of Enterobacter carcinogens in the degradation of tomatine.

[0008] This invention isolates intestinal bacteria by dissecting the intestines of tomato leafminer larvae, then screens and identifies bacteria resistant to tomatine or even capable of degrading and utilizing tomatine, and analyzes their role in the tomatine resistance of tomato leafminer, laying the foundation for subsequent research on resistance mechanisms. Attached Figure Description

[0009] Figure 1 This is a schematic diagram of the dissection and collection of intestinal tissue of the tomato leafminer moth provided in Embodiment 1 of the present invention;

[0010] Figure 2 The growth of colonies after the enriched bacterial culture provided in Example 2 of this invention was spread on an LB plate (a is 1.0 × 10⁻⁶). -1 The enrichment culture solution was 1.0 × 10⁻⁶ times, with b being 1.0 × 10⁻⁶. -2 The enriched bacterial culture solution was 1.0 × 10⁻⁶ times the concentration, with c being 1.0 × 10⁻⁶. -3 The enriched bacterial culture solution was 1.0 × 10⁻⁶ times the concentration, with a d of 1.0 × 10⁻⁶. -4 The enriched bacterial culture solution was 1.0 × 10⁻⁶ times the concentration, with e being 1.0 × 10⁻⁶. -5 The enrichment culture solution was 1.0 × 10⁻⁶ times, with f being 1.0 × 10⁻⁶. -6 (multiplied by a factor of 100) of enriched bacterial culture.

[0011] Figure 3 The results of agarose gel electrophoresis provided in Example 2 of this invention are shown (M is DL2000 Plus DNA Marker as a control; 1 and 2 are bacterial 16Sr DNA samples obtained by PCR amplification).

[0012] Figure 4 The BLAST comparison results provided in Example 2 of this invention (1 is the isolated strain, 2 is the Enterobacter carcinogen with accession number CP025225.1 in the NCBI database) Enterobacter cancerogenus ));

[0013] Figure 5 This is a schematic diagram illustrating the use of ChiPlot to annotate species information according to Embodiment 2 of the present invention;

[0014] Figure 6 The growth curve of the strain provided in Example 3 of the present invention;

[0015] Figure 7 The chromatographic peak diagram for the detection of tomatine provided in Example 4 of the present invention is shown in Figure 4 (a is the retention time and peak area of ​​tomatine measured by high performance liquid chromatography of the control group, and b is the retention time and peak area of ​​tomatine measured after the sample is cultured for 12 hours). Detailed Implementation

[0016] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0017] The specific implementation of the present invention will be described in detail below with reference to specific embodiments.

[0018] Example 1, Screening of strains:

[0019] (1) Dissection and collection of intestinal tissue from the tomato leafminer moth:

[0020] Wild-type tomato leafminer moths (125.27°N, 43.92°E) that were stably bred in the greenhouse and laboratory of Jilin University's Heping Campus in Changchun City, Jilin Province, were collected. After approximately 20 days of rearing, third-instar larvae were used for experiments. Ten third-instar larvae of similar size and condition were randomly selected and starved for 24 hours. They were then disinfected by immersion in 75% alcohol for 30 seconds, followed by rinsing three times with sterile water. The larvae were then placed in disposable culture dishes containing sterile PBS buffer and aseptically dissected under a stereomicroscope using dissecting forceps. The larval tissue was slowly torn apart with the forceps until the intestinal tissue could be completely extracted (e.g., ...). Figure 1 As shown in the figure, intestinal tissue was collected and placed in a 1.5 mL centrifuge tube containing 100 μL of PBS buffer. The tissue was homogenized with a grinder, and then 900 μL of PBS buffer was added. The mixture was then vortexed to mix.

[0021] (2) Prepare a liquid culture medium with tomatine as the sole carbon source:

[0022] To screen bacteria with tomatine-degrading capabilities, a carbon-free liquid basic culture medium was prepared. The composition of the culture medium is shown in Table 1.

[0023] Table 1

[0024]

[0025] First, weigh the above ingredients and put them into a container. Add distilled water to make up the volume and then sterilize. Before autoclaving, adjust the pH value to 7.2-7.4, and the final pH value is 7.1-7.3.

[0026] Dissolve tomatine in DMSO to prepare a stock solution with a concentration of 50 mg / mL. After the liquid basic culture medium is sterilized and cooled, add 1 mL of culture medium to a 1.5 mL centrifuge tube, and then add 20 μL of tomatine stock solution to make the tomatine concentration in the culture medium reach 1.0 g / L, thus preparing a liquid culture medium with tomatine as the sole carbon source.

[0027] (3) Screening bacteria:

[0028] Add 20 μL of intestinal homogenate to the above 1.5 mL centrifuge tube. The culture conditions are: dark, 28°C, 200 rpm. After 24 h of culture, add 20 μL of the suspension to a new centrifuge tube with liquid culture medium containing tomatine as the sole carbon source. Repeat this re-inoculation process 7 times within one week under dark conditions at 28°C.

[0029] Example 2, Isolation and Identification of Strains:

[0030] (1) Isolation and culture of functional bacteria:

[0031] Take the bacterial culture obtained from the above multiple rounds of enrichment culture and dilute it with PBS buffer in a serial gradient to 1.0 × 10⁻⁶. -1 1.0 × 10 -2 1.0 × 10 -3 1.0 × 10 -4 1.0 × 10 -5 1.0 × 10 -6 Dilute 100 μL of each solution and spread it onto LB solid medium. Each treatment was repeated three times, with sterile water treatment as a blank control (e.g., ...). Figure 2 As shown in the figure, the culture conditions were: 28℃ in an incubator with a relative humidity of 70 ± 5%, and cultured for 16 h.

[0032] (2) PCR amplification of functional bacteria:

[0033] Single colonies with clear edges and not adhering to each other were screened from the culture medium. Each colony was picked up with a pipette tip and inoculated into a new liquid culture medium with tomatine as the sole carbon source. The culture was mixed by pipetting. The culture conditions were: dark, 28°C, and 200 rpm. After 24 hours of culture, bacterial samples were collected. Before PCR, the samples were preheated to 98°C for 20 minutes. Using the screened bacterial DNA as a template, PCR amplification was performed using universal primers for bacterial 16S rRNA. The universal primers are as follows: 27FAGAGTTTGATCCTGGCTCAG (as shown in SEQ ID NO:2); 1492R GGTTACCTTGTTACGACTT (as shown in SEQ ID NO:3).

[0034] The PCR reaction system is shown in Table 2:

[0035] Table 2

[0036]

[0037] The reaction conditions were: 98℃ for 30s; 98℃ for 10s; 60℃ for 10s; 72℃ for 40s; 25 cycles; 72℃ for 5min;

[0038] (3) Agarose gel electrophoresis detection of functional bacteria:

[0039] After the reaction, the samples were purified using a PCR product purification kit. The PCR product results were then detected using 1% agarose gel electrophoresis. 5 μL of sample (pre-mixed with DNA Loading Buffer) was added to each well, with a 2000 bp DNA marker as a control. Electrophoresis was performed at 180 V for 20 min. The band size was between 1000 bp and 1500 bp, consistent with the target band size (e.g., ...). Figure 3 (as shown);

[0040] (3) Identification of functional bacteria:

[0041] PCR products showing bands after agarose gel electrophoresis were sent to Sangon Biotech Co., Ltd. for sequencing. After obtaining the sequencing results, ClustalX2 was used to compare the results with previous bacterial microbial diversity analysis, and Espript 3.0 (https: / / espript.ibcp.fr / ) was used to annotate the sequence alignment results. The sequences were then BLAST-aligned on NCBI (e.g., ...). Figure 4 As shown), among the first 500 comparison results, 49 representative sequences were selected according to their phylogenetic relationship from closest to furthest. These 50 sequences were then used in MEGA11 software with the p-distance method and Neighbor-Joining (NJ) to construct a phylogenetic tree (Site Coverage Cutoff set to 50%, Bootstrap set to 1000). Species information was then labeled using ChiPlot (https: / / www.chiplot.online) (e.g., ...). Figure 5 As shown), it was discovered that the 16S rRNA gene sequence of this strain is similar to that of Enterobacteriaceae (as shown). Enterobacter Multiple strains of bacteria showed high homology, with sequence identity exceeding 99%, including *Enterobacter carcinogens* with accession number CP025225.1. Enterobacter cancerogenusThe sequence similarity of CR-Eb1 was 99.72%, the sequence comparison coverage reached 99%, and the E value was 0. Therefore, this strain was identified as Enterobacter carcinogens. Enterobacter cancerogenus JLU1).

[0042] Example 3: Determination of the growth curve of the strain:

[0043] Add 1 mL of liquid culture medium with tomatine as the sole carbon source to a 1.5 mL centrifuge tube, then add 10 μL of the bacterial suspension obtained in Example 2. The culture conditions are: dark conditions, temperature 28 °C, rotation speed 200 rpm, and culture for 24 h. The absorbance of the bacterial suspension at a wavelength of 600 nm is measured every 2 h using a micrometer. The culture medium without functional bacteria is used as a blank control to zero the instrument. Each measurement is repeated three times.

[0044] The measurement results are as follows Figure 6 As shown, the absorbance value of the bacterial culture did not change significantly in the first 8 hours. From the 8th hour onwards, the absorbance value increased rapidly, and the growth curve entered the logarithmic phase. The bacteria began to multiply rapidly, and the culture gradually became turbid. With the increase in population density and the consumption of nutrients, the increase in absorbance value slowed down after 14 hours of cultivation. Between 16 and 24 hours, the absorbance value showed almost no increase, and the growth curve entered the plateau phase. This verified the effectiveness of the *Enterobacter carcinogens* strain isolated in this embodiment of the invention. Enterobacter cancerogenus JLU1 has a certain tomatine degradation function and can use tomatine as the sole carbon source for growth and reproduction.

[0045] Example 4: Determination of the degradation effect of the strain on tomatine:

[0046] Glyceryl-preserved functional bacteria were activated by streaking on LB solid medium. Single colonies with clear edges were picked and inoculated into 1 mL of liquid medium with tomatine as the sole carbon source. The culture conditions were: dark, 28°C, 200 rpm, and 12 h. Before inoculation, 20 μL of the specified medium was taken and 180 μL of acetonitrile (filtered to remove air bubbles) was added. The mixture was then passed through a 0.22 μm microporous membrane, and the resulting filtrate was used for the control group. Similarly, bacterial culture after 12 h of culture was subjected to the above treatment, with each treatment repeated three times.

[0047] The samples were analyzed on an Agilent HPLC system equipped with a Shimadzu WondaSil WR-C18 column (4.6 mm × 250 mm, 5 μm). The mobile phase, consisting of solvent A (acetonitrile) and reagent B (0.1% diethylamine solution) in a 70:30 volume ratio, was used in isocratic mode at a flow rate of 0.3 mL / min, a temperature of 30 °C, and a wavelength of 265 nm.

[0048] The results are as follows Figure 7As shown, the retention time of tomatine was measured to be 8.3 minutes, where a represents the retention time and peak area of ​​tomatine measured by high-performance liquid chromatography in the control group, and b represents the retention time and peak area of ​​tomatine measured after 12 hours of sample incubation. The tomatine concentration of the sample was quantified by comparing the peak area of ​​tomatine in the sample with that in the control group. After 12 hours, the degradation rate of tomatine by functional bacteria reached 49.2%, with SE=2.01. This indicates that the *Enterobacterium carcinogens* strain isolated in this embodiment of the invention is effective. Enterobacter cancerogenus JLU1 has a strong ability to degrade tomatine.

[0049] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A type of carcinogenic Enterobacter, characterized in that, The carcinogenic Enterobacter is Enterobacter ( Enterobacter cancerogenus JLU1 was deposited on June 23, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34971.

2. The application of the Enterobacter carcinogens as described in claim 1 in the degradation of tomatine.

3. The application according to claim 2, characterized in that, The steps are as follows: The carcinogenic Enterobacter (C.) preserved in glycerol Enterobacter cancerogenus JLU1 was activated on the culture medium, and single colonies with clear edges were picked and inoculated into liquid culture medium with tomatine as the sole carbon source for culture.

4. The application according to claim 3, characterized in that, The culture conditions were: dark conditions, temperature 28°C, rotation speed 200 rpm, and culture for 24 hours.

Images