An injection for locust single base site editing and a gene editing method for protein sequence modification by using the locust single base site editing
By using the CRISPR-Cas9 system to perform single-base site-specific editing in locusts, and by microinjecting the Cas9-sgRNA complex and ssODN donor, precise regulation of locust protein sequences was achieved. This solves the problem of single-base editing being difficult to achieve in existing technologies and provides an efficient gene editing method.
Patent Information
- Application Number
- CN202511596657.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-04
- Publication Date
- 2026-02-10
- Estimated Expiration
- 2045-11-04
AI Technical Summary
Existing technologies struggle to achieve single-base site-specific editing in locusts, especially for precise regulation of protein sequences, and there is a lack of efficient gene editing methods.
Using a CRISPR-Cas9-mediated gene editing system, the Cas9-sgRNA ribonucleoprotein complex and ssODN donor were microinjected into locust eggs using an injection solution. This specifically altered a single base in the protein-coding region of the transcription factor CAMTA gene, achieving precise editing from the base level to the protein level.
This technology enables single-base editing with high accuracy and low off-target rate, which can alter the amino acid sequence and function of proteins, providing a new technical approach for locust gene function analysis and pest control.
Smart Images

Figure CN121046469B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of insect gene editing technology, and particularly relates to an injection solution for single-base site-directed editing in locusts and a gene editing method for protein sequence modification using single-base site-directed editing in locusts. Background Technology
[0002] Genome editing is a crucial tool for gene function analysis and modification, showing broad application prospects in agricultural pest control. Locusts are not only a typical model for studying insect behavior and social ecology, but also a serious agricultural pest globally. When local population density increases, locusts transform from concealed solitary species to gregarious aggregations, leading to large-scale locust plagues and significant agricultural losses. However, in most non-model insect studies, including locusts, RNA interference and gene knockout are still widely used techniques, and gene editing methods capable of fine-scale protein regulation are still lacking. Therefore, developing a gene editing technology capable of single-base site-specific editing in locusts, targeting protein sequence alteration, is of great significance for in-depth research into the molecular mechanisms of locusts and for exploring pest control strategies. Summary of the Invention
[0003] In view of this, the purpose of this invention is to provide an injection solution for single-base site-directed editing in locusts and a gene editing method for protein sequence modification using single-base site-directed editing in locusts. This invention utilizes a CRISPR-Cas9-mediated gene editing system to modify transcription factors in locusts. CAMTA Single-base editing at specific sites in the protein-coding region of a gene induces site-directed mutations in the protein's amino acid sequence, thereby altering the protein's amino acid sequence. This achieves precise regulation from the base level to the protein level, validating the feasibility of single-base editing technology in locust gene function research. This technology can not only edit any base (A, T, C, G), but also further achieve diversified regulation of protein amino acid sequences and their functions, providing a new technical approach for locust gene function analysis and pest control research.
[0004] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0005] This invention provides an injection solution for single-base site-directed editing in locusts, the injection solution comprising the following components at final concentrations: 380~420 ng / μL Cas9, 130~170 ng / μL sgRNA, and 280~320 ng / μL ssODN donor.
[0006] Preferably, the sequence of the sgRNA is shown in SEQ ID NO.2.
[0007] Preferably, the sgRNA is located at the target transcription factor CAMTA The IQ domain of the critical structural domain.
[0008] Preferably, the sequence of the ssODN donor is shown in SEQ ID NO.1.
[0009] This invention also provides a gene editing method for single-base site-directed editing of locusts for protein sequence modification, wherein the gene editing method involves microinjecting the injection solution into locust eggs and screening to obtain single-base edited individuals.
[0010] Preferably, the injection volume of the injection solution is 13.5~14 nL.
[0011] Preferably, the single-base editing individual is a transcription factor. CAMTA An individual whose single base A in the protein-coding region of a gene is mutated to G.
[0012] Compared with existing technologies, the present invention has the following beneficial effects: The present invention provides an injection solution for single-base site-directed editing in locusts and a gene editing method for protein sequence modification using single-base site-directed editing in locusts. The present invention prepares an injection solution by microinjecting the Cas9-sgRNA ribonucleoprotein (RNP) complex and ssODN donor into locust eggs, and introduces them together into the body, which can specifically alter transcription factors. CAMTA A single base in the protein-coding region of a gene causes a desired change in the amino acid encoded by the corresponding triplet codon, thereby achieving protein-level modification through single-base editing. Experimental results show that the gene editing method of this invention has high accuracy, low off-target rate, and can be extended to any A, T, C, and G bases, achieving diversified regulation of protein amino acid sequences and functions, providing a new technical approach for locust gene function analysis and pest control research. Attached Figure Description
[0013] Figure 1 This is a schematic diagram illustrating the principles of microinjection and gene editing repair.
[0014] Figure 2 Predicted and designed gRNA sequence for the CAMTA structure of the migratory locust;
[0015] Figure 3 Off-target prediction for gRNA5;
[0016] Figure 4 The results of the editing efficiency test;
[0017] Figure 5 A graph showing the one-to-one correspondence between editing efficiency and efficiency from A to G;
[0018] Figure 6 A schematic diagram illustrating the homozygous individuals obtained through three generations of hybridization;
[0019] Figure 7 Sequencing results for wild-type, heterozygous, and homozygous individuals;
[0020] Figure 8 This is a schematic diagram showing the base substitutions and amino acid transformations before and after editing. Detailed Implementation
[0021] This invention provides an injection solution for single-base site-directed editing in locusts, the injection solution comprising the following components at final concentrations: Cas9 380~420 ng / μL, preferably 390~410 ng / μL, more preferably 400 ng / μL; sgRNA 130~170 ng / μL, preferably 140~160 ng / μL, more preferably 150 ng / μL; and ssODN donor 280~320 ng / μL, preferably 290~310 ng / μL, more preferably 300 ng / μL.
[0022] In this invention, the sgRNA is located at the target transcription factor CAMTA The key structural domain is the IQ domain. The sequence of the sgRNA is shown in SEQ ID NO.2, specifically: GGCGTTAATGTCCCTCGTCCCCC.
[0023] In this invention, the sequence of the ssODN donor is shown in SEQ ID NO.1, specifically as follows:
[0024] TCCGTTCATATTGTGAGCACAAGCGTTTTAAGAAAAGTCAGGAAGCTGCAGTTTGCATTCAAAACTACTACCGCAATTACGGGGAGCAGGGGGGGAGGGAGTCGTGAAAGCACGCCTAGTGCAACAAG.
[0025] This invention also provides a gene editing method for single-base site-directed editing of locusts for protein sequence modification, wherein the gene editing method involves microinjecting the injection solution into locust eggs and screening to obtain single-base edited individuals.
[0026] In this invention, the injection solution comprises the following components at final concentrations: 380-420 ng / μL Cas9, 130-170 ng / μL sgRNA, and 280-320 ng / μL ssODN donor; the injection volume of the injection solution is 13.5-14 nL, preferably 13.7-13.9 nL, and more preferably 13.8 nL.
[0027] In this invention, the single-base editing individual is a transcription factor. CAMTA An individual whose single base A in the protein-coding region of a gene is mutated to G.
[0028] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0029] Example
[0030] Using the "Normal Mode" search in the SMART database and literature review, it was found that the IQ domain is crucial for achieving targeted transcription factors. CAMTA Key active structural domains (e.g.) Figure 2 (As shown). sgRNAs with predicted low off-target efficiency targeting the key domain of the transcription factor CAMTA were designed. The design and off-target prediction of sgRNAs were performed using CasOT software. The selected gRNA sequences are shown below. Figure 2 As shown in the figure, the off-target efficiency diagram is as follows: Figure 3 .
[0031] gRNA in vitro synthesis: Targeted synthesis based on the Locust Genome genome using CasOT software CAMTA The gRNA design improves efficiency while reducing off-target effects. High-quality gRNAs are selected for primer design and then synthesized by Tianyi Huiyuan Company.
[0032] gRNA synthesis was performed according to the GeneArt™ Precision gRNA Synthesis Kit (Invitrogen) instructions. First, PCR amplification was performed to obtain a DNA template containing the tracrRNA fragment and the T7 promoter. The system is shown in Table 1.
[0033] Table 1 PCR amplification system
[0034]
[0035] After in vitro transcription, DNA was removed by incubation with DNase I (Thermo Scientific) at 37°C for 15 minutes. gRNA was purified using the GeneJET RNA Cleanup and Concentration Micro Kit (Thermo Scientific). The purified product was dissolved in RNase-free water, the concentration was determined with Narodrop One and diluted to 1500 ng / μL, and then frozen at -80°C for later use.
[0036] The final concentration of the injection solution was 400 ng / μL of Cas9 (TrueCut HiFi Cas9 purchased from Thermo Fisher Scientific, catalog number A50576), 150 ng / μL of sgRNA (synthesized using Thermo Fisher Scientific's Precision gRNA Synthesis Kit according to the instructions, catalog number A29377), and 300 ng / μL of ssODN (single-stranded oligonucleotide, synthesized using BGI Genomics' long-chain primer service and purified by HPLC). The locust eggs were laid by locusts raised in the laboratory of the Institute of Zoology, Chinese Academy of Sciences.
[0037] The ssODN sequence is:
[0038] TCCGTTCATATTGTGAGCACAAGCGTTTTAAGAAAAGTCAGGAAGCTGCAGTTTGCATTCAAAACTACTACCGCAATTAC G GGGAGCAGGGGGGGAGAGGGAGTCGTGAAAGCACGCCTAGTGCAACAAG, where the 81st position is the site where A was edited to G, i.e., the position marked by the underline.
[0039] The method of microinjecting locust eggs is ( Figure 1 Take 0.8 μL of Cas9 protein solution (5 mg / mL), 1 μL of gRNA solution (1500 ng / μL), and 8.2 μL of... CAMTA Mix ssODN to obtain the injection solution, incubate at 37℃ for 10 minutes, and then use it for microinjection. Two hours before injection, prepare a moist sand basin, about 20cm deep, with sand just clumped together without dripping, for oviposition. Wash the collected egg bags in a water-filled petri dish with a fine brush to remove the sand and detach each egg from the reddish-brown secretions, changing the water frequently to ensure thorough cleaning. Use a brush to transfer the eggs into a grooved culture medium, arranging them neatly. Collect eggs laid 0-2 hours prior and inject the injection solution into the locust eggs using microinjection. Incubate at 30℃ for 14 days until hatching. Raise the larvae to the eclosion stage. Each locust egg is injected with 13.8 nL of the injection solution, while 13.8 nL of sterile water serves as a control group.
[0040] Mutant identification: After hatching and reaching the eclosion stage, 3-4 mm of foot tissue was added to 45 μL of 50 mmol / L NaOH solution. After heating and lysis for 30 min, 5 μL of 1 mol / L Tris-HCl solution (pH 8.0) was added to extract genomic DNA. Then, PCR amplification was performed on the DNA within 250 bp of the sgRNA. Primers were designed as follows:
[0041] F:TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCATGCAGCAATGGTGATACA (SEQ IDNO.3);
[0042] R: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGTTCGAACCCACCACAAAAGT (SEQ IDNO.4);
[0043] The PCR amplification procedure is shown in Table 2:
[0044] Table 2 PCR amplification program
[0045]
[0046] PCR products were sent to Beijing Qingke Biotechnology Co., Ltd. for Fast NGS sequencing for point mutation analysis. Based on the analysis report provided by Beijing Qingke Biotechnology Co., Ltd., sgRNAs with editing efficiency ≥60% were selected. Single-base edited individuals were obtained through sequencing screening. Statistics were compiled on the G0 generation individuals that successfully generated the AG mutation (Table 3 and...). Figure 5 ) and reproduce ( Figure 6 ).
[0047] Table 3. Results of mutant detection
[0048]
[0049] As shown in Table 3, the success rate of base editing is directly proportional to the cleavage efficiency of the individual's sgRNA.
[0050] Depend on Figure 5 It is evident that a highly efficient sgRNA is crucial for gene editing experiments.
[0051] use Figure 6 The method involves propagating successfully edited individuals and then mating them to obtain homozygous strains. For example... Figure 6 As shown, male and female individuals with the A to G mutation were mated (this generation is chimera). After they grew into adults, they were sequenced again, and male and female individuals with the A to G mutation were mated (this generation is heterozygous, and some may be homozygous). The offspring that were identified as homozygous for A to G through sequencing could be stably propagated. Thus, the single-base mutant was successfully constructed. The successfully constructed single-base mutant was then validated, as follows... Figure 7 and Figure 8 As shown.
[0052] It has been verified that changes in the base sequence, such as Figure 7As shown, the sequences correspond to those of wild-type individuals, heterozygotes, and homozygotes, respectively, and the corresponding amino acids are also altered, changing from arginine to glycine. Figure 8 ).
[0053] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. An injection solution for single-base site-directed editing in locusts, characterized in that, The injection solution comprises the following components at final concentrations: 380-420 ng / μL Cas9, 130-170 ng / μL sgRNA, and 280-320 ng / μL ssODN donor; The sequence of the sgRNA is shown in SEQ ID NO.2; The sequence of the ssODN donor is shown in SEQ ID NO.
1.
2. The injection solution according to claim 1, characterized in that, The sgRNA is located at the target transcription factor CAMTA The IQ domain of the critical structural domain.
3. A gene editing method for protein sequence modification using single-base site-directed editing in locusts, characterized in that, The gene editing method involves microinjecting the injection solution described in claim 1 or 2 into locust eggs and then screening to obtain single-base edited individuals.
4. The gene editing method according to claim 3, characterized in that, The injection volume of the injection solution is 13.5~14 nL.
5. The gene editing method according to claim 3, characterized in that, The single-base edited individuals are transcription factors. CAMTA An individual whose single base A in the protein-coding region of a gene is mutated to G.