Molecular markers, primer pairs, kits, and their applications targeting the gain-of-splitting site of the maize dwarfing gene Br2.
By screening and introducing the Br2 gene splice site variant br2-sag1, combined with molecular marker-assisted selection, the limitation of the maize dwarfing gene Br2 in breeding traits was solved, and the breeding effect of reducing plant height without reducing yield was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-30
- Publication Date
- 2026-04-03
AI Technical Summary
The application of the existing maize dwarfing gene Br2 is limited in breeding due to undesirable traits such as severe internode shortening and wide, densely overlapping leaves.
A molecular marker and primer pair targeting the acquired splicing site of the maize dwarfing gene Br2 is provided. The mutation site is detected by PCR amplification and sequencing. The mutant br2-sag1 with the Br2 gene splicing site variation is screened out and introduced into breeding materials through backcrossing. Combined with molecular marker-assisted selection, dwarf maize germplasm is cultivated.
It significantly reduces maize plant height while maintaining the same yield per plant, providing an effective way to improve dwarf maize germplasm in breeding and enhancing yield potential under planting density.
Smart Images

Figure CN121046573B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of maize molecular breeding technology, specifically to a method targeting maize dwarfing genes. Br2 Molecular markers, primer pairs, kits, and applications of acquired cleavage sites. Background Technology
[0002] With the continuous growth of global food demand and the increasing prominence of energy issues, the yield increase of maize, as an important food, feed, and industrial raw material crop, is of immeasurable value in alleviating the food crisis, ensuring food supply, and expanding energy sources. The number of ears per unit area, the number of kernels per ear, and the weight of 100 kernels are the three main factors influencing maize yield. Increasing planting density can increase the number of ears per unit area within a certain range, thereby achieving the goal of increasing yield. However, increasing maize planting density leads to many negative effects, such as lodging caused by excessive vegetative growth, decreased photosynthetic efficiency, low water and fertilizer utilization, increased pests and diseases, empty stalks, smaller ears, and poor grain filling rate, which restricts the promotion and development of high-density maize planting technology. To overcome the many challenges brought about by increased planting density, rationally optimizing plant structure is an important method, and dwarfing is an effective way to increase planting density. In the 1960s, semi-dwarf wheat and rice were successfully cultivated. The reason for dwarfing is that it plays a role in the growth and development of wheat and rice respectively. Rht-1 ( Reduced height-1 )and sd1 ( semi-dwarf1 These two genes are related to the signal transduction and synthesis of gibberellins in the body.
[0003] Dwarfing genes are an important resource for maize dwarfing breeding. Many maize dwarfing genes have been cloned, but their application in breeding production is quite limited. This is mainly because the loss of function of most cloned dwarfing genes leads to other undesirable traits, such as severely stunted plants, abnormal development of male and female flowers, and short, deformed or non-fertile ears, resulting in a significant decrease in yield. Currently, the most widely used dwarfing genes in breeding production are mainly auxin polar transport genes. Br2 (brachytic2). Br2 The gene, first discovered by Emerson in 1935, is a maize dwarfing gene and is the major gene responsible for maize dwarfing. Br2 It encodes P-glycoprotein, a protein related to auxin polar transport, and is associated with Arabidopsis thaliana. AtABCB1 They are homologous genes. br2The cell length in the stem of the loss-of-function mutant is only 40%-50% of that of the wild type, but it has 10 more cell layers in the parenchyma region. These differences result in a decrease of about 50% in plant height, shortened internodes below the ear, overlapping leaves, while significantly elongated internodes above the ear and narrower leaves; the stem diameter is thicker, greatly increasing stem strength. Because it exhibits dwarfing, lodging resistance, and high-yield potential in terms of agronomical traits, Br2 It has become an important genetic resource for creating dwarf germplasm. However, currently, for... Br2 There are still many problems with gene utilization, such as severely shortened internodes and wide, densely overlapping leaves in maize. These undesirable traits seriously affect yield per plant and limit the yield of maize. Br2 Applications of genes. Summary of the Invention
[0004] The severe shortening of internodes and the wide, densely overlapping leaves in maize significantly impact yield per plant, thus limiting [the yield of maize]. Br2 To address the technical challenges of gene application, this invention provides a gene targeting maize dwarfing. Br2 Molecular markers, primer pairs, kits, and applications of acquired splicing sites. The gene site mutations provided by this invention can reduce maize plant height, and the molecular markers can be used to detect the mutation sites, providing precise targets and genetic resources for maize plant architecture improvement in breeding production.
[0005] In a first aspect, the present invention provides a method for targeting maize dwarfing genes. Br2 Molecular markers of acquired splicing sites, maize dwarfing genes Br2 The gene number is Zm00001eb038710 dwarfing genes in maize Br2 The acquired splicing site is located at base 206632482 of chromosome 1 of maize. The wild-type nucleotide sequence of the molecular marker is shown in Sequence 1, and the base at the variant site is G, indicating that the maize being tested... Br2 The genotype is wild-type, and the base at the mutation site is A, indicating that the maize being tested... Br2 The genotype is a homozygous mutant genotype;
[0006] Corn with a homozygous mutant genotype is shorter than that with a wild genotype.
[0007] Secondly, the present invention provides a set of primer pairs for detecting the above-mentioned molecular markers, comprising:
[0008] Forward primer, the nucleotide sequence of which is shown in Sequence 3;
[0009] The reverse primer has the nucleotide sequence shown in Sequence 4.
[0010] Thirdly, the present invention provides a kit for detecting the above-mentioned molecular markers, comprising the above-mentioned primer pairs.
[0011] Fourthly, the present invention provides the above-mentioned primer pair and / or kit for detecting maize dwarfing genes. Br2 Applications in acquired splicing sites.
[0012] Furthermore, the detection method is as follows:
[0013] The genomic DNA of the maize sample was amplified by PCR using the primers described above. After sequencing the PCR products, the maize variants were identified based on the bases at the mutation sites. Br2 The genotype.
[0014] Furthermore, the base at the mutation site is G, indicating that the maize being tested is maize. Br2 The genotype is wild-type;
[0015] The base at the variant site is A, indicating that the maize being tested is maize. Br2 The genotype is a homozygous mutant genotype.
[0016] Fifthly, the present invention also provides the application of the above-mentioned molecular markers, primer pairs and / or kits in maize germplasm improvement and molecular-assisted breeding.
[0017] The beneficial effects of this invention are as follows:
[0018] This invention utilizes EMS mutagenesis and next-generation sequencing technologies to construct a maize EMS mutagenesis mutant library (http: / / maizeems.qlnu.edu.cn / ), from which one mutant was screened. Br2 A mutant with a gene splicing site variation. The mutation site is located on chromosome 1, at base 206632482, resulting in... Br2 A G>A mutation occurred before the 3' acceptor splice site in the second intron region of the gene, changing the original GG sequence to the new AG splice site acceptor. This shifted the second intron splice site forward, resulting in an additional 11 bases in the transcript and premature termination of protein translation. This mutant was named... br2-sag1 (splice acceptor gained). Compared to the wild type, br2-sag1 Plant height decreased by about 25.9%, but the yield per plant did not change significantly. br2-sag1 It can significantly reduce plant height while having little impact on yield per plant. By introducing the mutation at this site into the backbone parents through backcrossing and conversion, and using molecular markers for assisted selection, dwarf maize germplasm can be cultivated, which has great application potential in breeding and production. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, for those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1 Wild type and mutant br2-sag1 The phenotype, Figure 1 A is wild type and br2-sag1 Phenotypic diagram of mutant plant height; B represents wild type and br2-sag1 Phenotypic diagram of ear height in mutants; C represents wild type and br2-sag1 Phenotypic diagram of the number of aboveground internodes in mutants; D represents wild type and... br2-sag1 Phenotypic diagram of mutant ears; E represents wild type and br2-sag1 A histogram of plant height statistics for mutants; F represents wild type and... br2-sag1 A histogram of ear height of mutants; G represents wild type and br2-sag1 A bar chart of aboveground internode counts for mutants; H represents wild type and... br2-sag1 A bar chart showing the statistical weight of grains in the ear of the mutant. Figure 1 middle,** P <0.01, *** P <0.001, ns indicates no significant difference.
[0021] Figure 2 It is a corn dwarfing gene Br2 A diagram of acquired splicing sites on the gene structure. Figure 2 In the middle, A represents the mutation site. Br2 A diagram of the gene structure; B shows the difference in amino acid sequence length between wild type and mutant; C shows the sequencing results of wild type and mutant genotypes.
[0022] Figure 3 It is to utilize br2-sag1 Technical process for improving hybrid parent / inbred lines using mutants. Detailed Implementation
[0023] To enable those skilled in the art to better understand the technical solutions of this invention, the technical solutions of the embodiments of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this invention.
[0024] The gene number of the maize dwarfing gene Br2 used in the specific embodiments of this invention is: Zm00001eb038710 .
[0025] Example 1
[0026] A maize EMS mutagenesis library (http: / / maizeems.qlnu.edu.cn / ) was constructed using EMS mutagenesis and next-generation sequencing technologies, from which mutants were screened. Br2 A mutant material was found. Br2 Acquired splicing site mutant, the mutation site is located on chromosome 1, at base 206632482, resulting in Br2 A G>A mutation occurred before the 3' acceptor picesite in the second intron region of the gene, changing the original GG sequence to the new AG picesite acceptor. This shifted the second intron picesite forward, resulting in an additional 11 bases in the transcript and premature termination of protein translation. This mutant was named... br2-sag1 .
[0027] and br2-sag1 The nucleotide sequence (Sequence 1) of the wild-type gene corresponding to the mutant is as follows, with bolded underlined bases representing single nucleotide polymorphisms (SNPs):
[0028] CGGCTACCGCAGCGGCTTCGCCAAGGGGCTGGCCTCGGCGGCACCTACTTCACCGTCTTCTGCTGCTACGGGCTCCTGCTCTGGTACGGCGGCCACCTCGTGCGCGCCCAGCACACCAACGGCG GGCTCGCCATCGCCACCATGTTCTCCGTCATGATCGGCGGACTGTAAGGCCCACCACACCACGCACTCTCTCCTTCTGCTGCTCCTCGGCCCGCCCCCGTCGTCATTGCTGCTGACGGTATCTGT G GATCGCGTGCAGGGCCCTCGGGCAGTCGGCGCCGAGCATGGCCGCGTTCGCCAAGGCGCGTGTGGCGGCTGCCAAGATCTTCCGCATCATCGACCACAGGCCGGGCATCTCCTCGCGCGACGGCCG GAGCCAGAGTCGGTGACGGGGCGGGTGGAGATGCGGGGCGTGGACTTCGCGTACCCGTCGCGGCCGGACGTCCCCATCCTGCGCGGCTTCTCGCTGAGCGTGCCCGCCGGGAAGACCATCGC (sequence 1);
[0029] br2-sag1 The nucleotide sequences corresponding to the mutants are as follows, with bolded underlined bases representing single nucleotide polymorphisms (SNPs):
[0030] CGGCTACCGCAGCGGCTTCGCCAAGGGGCTGGCCTCGGCGGCACCTACTTCACCGTCTTCTGCTGCTACGGGCTCCTGCTCTGGTACGGCGGCCACCTCGTGCGCGCCCAGCACACCAACGGCG GGCTCGCCATCGCCACCATGTTCTCCGTCATGATCGGCGGACTGTAAGGCCCACCACACCACGCACTCTCTCCTTCTGCTGCTCCTCGGCCCGCCCCCGTCGTCATTGCTGCTGACGGTATCTGT A GATCGCGTGCAGGGCCCTCGGGCAGTCGGCGCCGAGCATGGCCGCGTTCGCCAAGGCGCGTGTGGCGGCTGCCAAGATCTTCCGCATCATCGACCACAGGCCGGGCATCTCCTCGCGCGACGGCCG GAGCCAGAGTCGGTGACGGGGCGGGTGGAGATGCGGGGCGTGGACTTCGCGTACCCGTCGCGGCCGGACGTCCCCATCCTGCGCGGCTTCTCGCTGAGCGTGCCCGCCGGGAAGACCATCGC (Sequence 2).
[0031] Select separately br2-sag1 Twenty seeds each of the mutant and wild-type B73 were sown simultaneously in the experimental field during the normal growing season. The phenotypic investigation began after all mutant and wild-type plants had masculinized.
[0032] Ten mutant and ten wild-type plants with uniform growth were selected. The main investigations included plant height, ear height, and number of above-ground internodes. Yield traits were statistically analyzed after harvest, primarily focusing on grain weight per ear. Results are as follows: Figure 1 Compared to the wild type, the mutant plant height decreased by approximately 25.9% ( Figure 1 In the middle A and E sections, the ear height decreased by approximately 41.6%. Figure 1 In the middle B and F sections, the number of aboveground internodes remained unchanged. Figure 1 In the C and G types, the yield per plant was not significantly different from that of the wild type. Figure 1 (D, H). This indicates that the mutant plant height is significantly reduced, but the yield per plant is not affected, indicating that it has great potential for increased yield due to dense planting.
[0033] Based on the above research, a gene targeting maize dwarfing was obtained. Br2 Molecular markers for acquired splicing sites were used. The wild-type nucleotide sequence of the markers is shown in Sequence 1, and the base at the variant site is G, indicating that the maize being tested... Br2 The genotype is wild-type, and the base at the mutation site is A, indicating that the maize being tested... Br2 The genotype is a homozygous mutant genotype;
[0034] Corn with a homozygous mutant genotype is shorter than that with a wild genotype.
[0035] Example 2
[0036] To verify the authenticity of the mutation site, specific primers were designed upstream and downstream of the mutation site, and the results are as follows:
[0037] Forward primer (sequence 3): CTTCACCGTCTTCTGCTGCTA;
[0038] Reverse primer (sequence 4): TGTGGTCGATGATGCGGAAG.
[0039] Ten mutants with the dwarf phenotype from Example 2 and ten B73 plants with normal plant height were selected. Leaf samples were taken from each plant, and DNA was extracted. Using this DNA as a template, the target fragment was amplified by PCR.
[0040] The PCR amplification system is shown in Table 1.
[0041] Table 1 PCR amplification system
[0042]
[0043] The PCR reaction program was as follows: 94℃ pre-denaturation for 1 min; 94℃ denaturation for 5 s; 58℃ annealing for 5 s; 72℃ extension for 5 s, 35 cycles; 72℃ extension for 2 min. After PCR product detection by 1% agarose gel electrophoresis, Sanger sequencing was performed, and the sequencing results were compared using the sequence alignment tool in SnapGene software. The results are as follows... Figure 2 As shown, the mutant exhibited a G-to-A base variation in the second intron region, while the wild type maintained the normal position at this site, proving the authenticity of the mutation site leading to stunted maize stalks.
[0044] Example 3
[0045] A kit containing the primer pair of Example 2, capable of detecting maize dwarfing genes in maize samples. Br2 Acquired splicing site molecular markers.
[0046] The specific testing methods are as follows:
[0047] (1) Using the genomic DNA of the maize material to be tested as a template, PCR amplification was performed using the primers shown in sequences 3 and 4 in Example 2;
[0048] (2) The PCR products obtained in step (1) were subjected to Sanger sequencing, and then the peak diagram was interpreted and the sequence was compared using SnapGene software. If the mutation site is base G, the maize material to be tested is wild-type; if the mutation site is base A, the maize material to be tested is a material with homozygous mutant genotype and shorter plant height; if the mutation site is G / A, the maize material to be tested is a material with heterozygous genotype and plant height is consistent with wild-type material.
[0049] Example 4
[0050] br2 - sag1 Acquired splicing sites can be introduced into the parents of maize hybrids or the backbone inbred lines in breeding production through continuous backcrossing to dwarf the plant height of the hybrid parents or backbone inbred lines. Specific implementation methods are as follows: Figure 3 :
[0051] (1) br2 - sag1 The mutant was crossed with the hybrid parent / backbone inbred line (hereinafter referred to as inbred line) to obtain the F1 generation hybrid;
[0052] (2) F1 was backcrossed with an inbred line to obtain the BC1F1 generation;
[0053] (3) The molecular markers developed in Example 1 were used to detect the mutation sites of BC1F1, and the plants containing the mutation sites were used to continue backcrossing with inbred lines;
[0054] (4) After backcrossing for four generations in the manner of (3), BC4F1 with the mutation site was obtained. After self-crossing, BC4F2 was obtained.
[0055] (5) Molecular marker detection, phenotypic identification, and background reversion rate detection were performed on the BC4F2 generation to ultimately obtain the utilization rate. br2-sag1 Mutant-modified parental or backbone inbred lines containing acquired splicing sites.
[0056] Although the present invention has been described in detail with reference to the accompanying drawings and preferred embodiments, the present invention is not limited thereto. Various equivalent modifications or substitutions can be made to the embodiments of the present invention by those skilled in the art without departing from the spirit and essence of the invention, and such modifications or substitutions should all be within the scope of the present invention. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should also be covered within the protection scope of the present invention.
Claims
1. A gene targeting maize dwarfing genes Br2 The application of molecular markers for acquired splicing sites in maize germplasm improvement and molecular-assisted breeding is characterized by, Corn dwarfing genes Br2 The gene number is Zm00001eb038710 dwarfing genes in maize Br2 The acquired splicing site is located at base 206632482 of chromosome 1 of maize. The wild-type nucleotide sequence of the molecular marker is shown in Sequence 1. The base at the variant site is G, indicating that the maize being tested... Br2 The genotype is wild-type, and the base at the mutation site is A, indicating that the maize being tested... Br2 The genotype is a homozygous mutant genotype; Corn with a homozygous mutant genotype is shorter than that of the wild genotype, but the yield per plant is not affected.
2. A set of methods for detecting maize dwarfing genes Br2 The application of primer pairs containing molecular markers of acquired splicing sites in maize germplasm improvement and molecular-assisted breeding is characterized by, Corn dwarfing genes Br2 The gene number is Zm00001eb038710 dwarfing genes in maize Br2 The acquired splicing site is located at base 206632482 of chromosome 1 of maize. The wild-type nucleotide sequence of the molecular marker is shown in Sequence 1. The base at the variant site is G, indicating that the maize being tested... Br2 The genotype is wild-type, and the base at the mutation site is A, indicating that the maize being tested... Br2 The genotype is a homozygous mutant genotype; Corn with a homozygous mutant genotype is shorter than that of wild-type corn, but the yield per plant is not affected. Primer pairs include: Forward primer, the nucleotide sequence of which is shown in Sequence 3; The reverse primer has the nucleotide sequence shown in Sequence 4.
3. A method for detecting maize dwarfing genes Br2 The application of a kit for molecular markers of acquired splicing sites in maize germplasm improvement and molecular-assisted breeding, characterized by: Corn dwarfing genes Br2 The gene number is Zm00001eb038710 dwarfing genes in maize Br2 The acquired splicing site is located at base 206632482 of chromosome 1 of maize. The wild-type nucleotide sequence of the molecular marker is shown in Sequence 1. The base at the variant site is G, indicating that the maize being tested... Br2 The genotype is wild-type, and the base at the mutation site is A, indicating that the maize being tested... Br2 The genotype is a homozygous mutant genotype; Corn with a homozygous mutant genotype is shorter than that of wild-type corn, but the yield per plant is not affected. The kit includes: Forward primer, the nucleotide sequence of which is shown in Sequence 3; The reverse primer has the nucleotide sequence shown in Sequence 4.