Lilium sargentiae beta-1, 3-glucanase gene LsGlu and application
By overexpressing the β-1,3-glucanase gene LsGlu from Luding lily in tobacco and tomato, the problem of gray mold susceptibility in tobacco and tomato was solved, achieving efficient molecular disease resistance breeding and reducing the use of chemical pesticides and environmental pollution.
Patent Information
- Application Number
- CN202511219780.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-28
- Publication Date
- 2025-12-05
AI Technical Summary
In existing technologies, tobacco and tomatoes are susceptible to gray mold, and the effectiveness of chemical control measures has been declining year by year and causes environmental pollution problems. There is a lack of effective molecular disease resistance breeding methods.
By utilizing the β-1,3-glucanase gene LsGlu from Luding lily, this gene was overexpressed in tobacco and tomato through genetic engineering to enhance the plant's resistance to Botrytis cinerea.
It significantly reduces the risk of gray mold in tobacco and tomatoes, shortens the breeding cycle, reduces the use of chemical pesticides, reduces environmental pollution, and provides disease-resistant varieties for green agricultural development.
Smart Images

Figure CN121065147A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, specifically to a β-1,3-glucanase gene from the lily of Luding. LsGlu and applications. Background Technology
[0002] lily( Lilium spp. ) belongs to the Liliaceae family ( Liliaccae ) Lily genus ( Lilium Lilies are perennial bulbous flowers. With their elegant and pure appearance, rich colors, and fragrant aroma, lilies carry cultural connotations and auspicious meanings such as "a harmonious union for a hundred years" and "growing old together," making them a beloved flower and one of the world's five most popular cut flowers. Besides their ornamental value, lilies also have edible and medicinal value. Their bulbs contain abundant protein, polysaccharides, and trace elements, making them highly nutritious. Medicinally, lilies contain colchicine, which can inhibit mitosis and thus has anti-cancer effects. They also have the effects of nourishing yin and moistening the lungs, calming the mind and soothing the nerves. (Li et al. (2024); In recent years, the development and utilization of lily by-products have received increasing attention. The 2023 Lily Industry Market Survey Report shows that the market sales of lilies have steadily increased in the past few years.
[0003] Botrytis cinerea ( Botrytis cinerea *Pseudomonas aeruginosa* is a saprophytic filamentous fungus widely distributed worldwide. It is characterized by its broad host range and strong adaptability, and can infect a variety of agricultural and economic crops. B. cinerea Gray mold, which infects lily leaves, stems, and flowers, is prone to outbreaks in spring and autumn, spreading rapidly and causing significant plant death, leading to a 20%–30% yield reduction or even total crop failure. Furthermore, *Botrytis cinerea* significantly damages plants in the Solanaceae and Tobacco genera, particularly tomatoes. Solanum lycopersicum L.) and tobacco ( Nicotiana tabacum L. is an important host for it, often causing severe gray mold disease.
[0004] Currently, the main control measures for gray mold are spraying chemical agents or optimizing cultivation conditions. However, due to the rapid reproduction rate and high genetic variation rate of Botrytis cinerea, it is easy for chemical agents to develop resistance, leading to a decline in control effectiveness year by year. At the same time, excessive use of chemical pesticides can cause pesticide residues in agricultural products, environmental pollution, and disruption of ecological balance, which does not meet the development needs of green agriculture. Therefore, studying the molecular mechanisms of plant resistance to gray mold, screening disease-resistant genes, and conducting molecular disease-resistant breeding are of great significance for the green and healthy development of crops.
[0005] Beta-1, 3-glucanase is widely present in plants, can participate in cell division, intercellular filament transportation, flower formation to seed maturation, seed germination and abiotic stress, and belongs to PR-2 type pathogenesis-related protein, and plays an important role in plant biological stress. Beta-1, 3-glucanase belongs to the 17th family (GH17) of glycosyl hydrolase, has a conserved functional domain (LIVM)-X-(LIVMFYM)3-(STAG)-E-(ST)-G-W-P-(ST)-X-G, and the domain is related to hydrolysis activity and can directly participate in beta-1, 3-glucan hydrolysis.
[0006] Luding lily is one of the most beautiful wild lilies in the world, and has strong disease and pest resistance and strong vitality. So far, the beta-1, 3-glucanase gene in Luding lily has not been reported. LsGlu The specific function has not been reported. SUMMARY
[0007] Technical problems to be solved: In view of the defects in the prior art, the application provides a Luding lily beta-1, 3-glucanase gene LsGlu The application solves the problem that tobacco and tomato are prone to gray mold.
[0008] The application first provides a Luding lily beta-1, 3-glucanase gene LsGlu The CDS (Coding Sequence) of the Luding lily beta-1, 3-glucanase gene is shown as SEQ ID NO: 1, and the protein encoded by the amino acid sequence shown as SEQ ID NO: 2.
[0009] The Luding lily beta-1, 3-glucanase gene LsGlu The application is used in improving the resistance of tobacco and tomato to Botrytis cinerea. Botrytis cinerea The Luding lily beta-1, 3-glucanase gene The application is used in improving the resistance of tobacco and tomato to Botrytis cinerea.
[0010] The Luding lily beta-1, 3-glucanase gene LsGlu The application is used in improving the resistance of tobacco and tomato to Botrytis cinerea.
[0011] Technical scheme: In order to achieve the purpose of the application, the application provides the following technical scheme: (1) a CDS specific primer of the gene is designed by combining the transcriptome sequence of Luding lily infected with Staphylococcus ovalis Botrytis elliptica) LsGlu The primer sequence is as follows: Upstream primer: GCGGCCGTCGACCCCGGGATGGCTGCCATGGCATCCCTC; Downstream primer: GATTCAGAATTCGGATCCTCAAGTGAAGCTGATCGAG.
[0012] (2) Extract total RNA from the leaves of Lilium regale after inoculation B. cinerea , amplify the CDS of the gene by reverse transcription-polymerase chain reaction (RT-PCR), and then connect the CDS to the overexpression vector 35S:PRI101-eGFP to obtain a clone with the target gene through sequencing. LsGlu
[0013] (3) Perform inoculation treatment on the isolated leaves of Lilium regale, and apply 1mmol / L of MeJA (methyl jasmonate), 4mmol / L of Ethephon (ethephon), 1mmol / L of SA (salicylic acid), and 2mmol / L of Melatonin (melatonin) at different time points (0h, 12h, 24h, 48h, and 72h). B. cinerea According to the sequence of the cloned gene in step (1), design qPCR primers, and perform RT-qPCR detection on the samples treated in different ways to determine the induced hormone signals. LsGlu LsGlu (4) According to the qPCR primer sequence in (3), design VIGS primers, construct the amplified fragments to the TRV2 vector, and perform virus-mediated gene silencing VIGS experiment to transiently silence the gene in the flower buds of Lilium regale, and perform inoculation treatment on the isolated petals to detect the anti-disease function of the gene in lilies.
[0014] (5) The overexpression vector 35S:PRI101-eGFP-LsGlu constructed in (1) is used to transfer the target gene into the receptor plants cultivated tomatoes (Micro-Tom) and cultivated tobacco (K326) for overexpression by using the Agrobacterium tumefaciens (A. tumefaciens) mediation method. LsGlu Then, the positive transgenic materials are screened by using a GFP antibody through Western blot experiment, and finally, the anti-disease function is detected by performing inoculation treatment on the isolated leaves. LsGlu Compared with the prior art, the present application has the following beneficial effects:
[0015] The present application first discovers that the beta-1, 3-glucanase gene in Lilium regale has the function of improving the resistance of tobacco and tomatoes to Botrytis cinerea. Agrobacterium tumefaciens
[0016] Compared with the prior art, the present application has the following beneficial effects: The present application first discovers that the beta-1, 3-glucanase gene in Lilium regale has the function of improving the resistance of tobacco and tomatoes to Botrytis cinerea. LsGlu Botrytis cinerea LsGlu The overexpression in tobacco and tomato finds that the risk of tomato and tobacco suffering from gray mold can be reduced, a new method for improving the resistance of plants to fungal diseases is provided, and the disease-resistant plants can be cultivated by genetic engineering, which can overcome the shortcomings of traditional breeding, shorten the breeding period, and obtain high-resistant materials; the genetic engineering technology for cultivating resistant plant varieties and materials has obvious advantages and irreplaceable importance; it can not only provide convenience for large-scale production of crops, flowers and medicinal materials, but also help to reduce the use of chemical pesticides, save costs and reduce environmental pollution. Therefore, the application has wide market application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1 is a GH17 family gene expression heat map of the bud of Luzhidian lily inoculated with gray mold in Example 1; wherein the arrow LsGlu gene is the gene with the highest expression.
[0018] Figure 2 is the relative expression amount of the gene at different time points after the bud of Luzhidian lily inoculated with gray mold in Example 1 is verified by RT-qPCR. LsGlu
[0019] Figure 3 is the relative expression amount of the gene at different time points after the bud of Luzhidian lily is sprayed with 1mmol / L of MeJA (methyl jasmonate) in Example 1 is verified by RT-qPCR. LsGlu
[0020] Figure 4 is the relative expression amount of the gene at different time points after the bud of Luzhidian lily is sprayed with 4mmol / L of Ethephon (ethephon) in Example 1 is verified by RT-qPCR. LsGlu
[0021] Figure 5 is the relative expression amount of the gene at different time points after the bud of Luzhidian lily is sprayed with 1mmol / L of SA (salicylic acid) in Example 1 is verified by RT-qPCR. LsGlu
[0022] Figure 6 is the relative expression amount of the gene at different time points after the bud of Luzhidian lily is sprayed with 2mmol / L of Melatonin (melatonin) in Example 1 is verified by RT-qPCR. LsGlu
[0023] Figure 7 is the transient silencing efficiency of the bud of Luzhidian lily flower bud LsGlu gene in Example 3. TRV2 is an empty loading transformation control group, and TRV2-Glu is a LsGlu gene transient silencing experiment group.
[0024] Figure 8 Figure 3 is the lesion phenotype (A) and lesion diameter histogram (B) of the transient silencing body of the bud of Ludi Lily in Example 3.
[0025] Figure 9 Figure 4 is the Western blot verification of the transgenic tomato and transgenic tobacco. GFP is the 35S::PRI101-eGFP stable transformant, LsGlu-GFP is the 35S::PRI101-eGFP-LsGlu stable transformant. Ludi red is used to stain total protein, and GFP antibody is used to identify positive plants.
[0026] Figure 10 Figure 5 is the lesion phenotype (A) and lesion diameter histogram (B) of the transgenic tobacco and tomato.
[0027] Statistical method: the error line in the RT-qPCR experiment represents the standard error among 4 biological repeats, and different letters represent that the difference has statistical significance (P<0.05) by one-way ANOVA and Duncan's test. The error line of the lesion diameter statistics represents the standard error among 6 or 10 biological repeats, and the asterisk indicates that there is a significant difference between the experimental group and the control group (*P<0.05, **P<0.01) by t test. DETAILED DESCRIPTION
[0028] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the scope of the present application.
[0029] Although the embodiments of the present application have been shown and described, it can be understood by those of ordinary skill in the art that various changes, modifications, replacements and variations can be made to these embodiments without departing from the principles and spirits of the present application, and the scope of the present application is defined by the appended claims and their equivalents.
[0030] The experimental methods involved in the embodiments are all conventional methods well known to those skilled in the art.
[0031] Example 1 LsGlu Expression analysis of genes Luding lilies were inoculated with *Botrytis cinerea* mycelial blocks (experimental group, 2 dpi) and culture medium (control group, mock 2 d). Transcriptome data from *Botrytis cinerea* infection were analyzed 2 days after inoculation. B. elliptica Eighteen GH17 family genes were induced (FoldChange>2, q<0.05, 9 upregulated genes and 9 downregulated genes), among which... LsGlu (lili00G180890.t1) showed the highest induction level and the largest upregulation fold in lilies after disease infection. Figure 1 (Obtained from transcriptome data) LsGlu The protein-coding sequence CDS of the gene (SEQ NO ID .1) was used to design qPCR primer pairs LsGlu-QF / LsGlu-QR using the NCBI primer-blast website (Table 1).
[0032] The isolated leaves of Luding lily were subjected to separate tests. B. cinerea The bacterial colony was inoculated with 1 mmol / L MeJA (methyl jasmonate), 4 mmol / L Ethephon, 1 mmol / L SA (salicylic acid), and 2 mmol / L Melatonin. Samples were taken at different time points (0 h, 12 h, 24 h, 48 h, 72 h). After grinding the samples with liquid nitrogen, RNA was extracted using Trizol, and the first strand of cDNA was synthesized using total RNA as a template using reverse transcriptase M-MLV (TransGen Biotech). Real-time quantitative PCR was performed using iTaq. TM universal SYBR ® Green super mix (Bole, 1725125) system (iTaq) TM universal SYBR ® Green super mix: 7µL; primer F: 1µL; primer R: 1µL; cDNA: 2µL; H2O: 3µL). LsACTIN-QF / LsACTIN-QR (Table 1) were used as internal reference genes in real-time quantitative PCR. RT-qPCR results were consistent with transcriptome results. LsGlu The expression level was significantly increased after infection with lilies, and was also highly induced after treatment with different hormones (MeJA, Ethephon, SA, Melatonin). Figures 2-6 ).
[0033] Table 1 Primer sequences Example 2 Construction of LsGlu transient silencing vector and overexpression vector In order to study the function of β-1,3-glucanase gene LsGlu In order to study the function of β-1,3-glucanase gene in the resistance of plants to Botrytis cinerea, the full-length fragment of the sequence of the gene SEQ NO ID.1 of the application was used to design primer pairs LsGlu-TRV2-F / LsGlu-TRV2-R and LsGlu-eGFP-F / LsGlu-eGFP-R (Table 1), and the cDNA of the leaves of Luzhou lily after being infected was used as a template to perform PCR (2 x Phanta Flash Master Mix: 25 µL; primer F: 2 µL; primer R: 2 µL; cDNA: 2 µL; H2O: 19 µL) by using Vazyme 2xPhanta Flash Master Mix kit (Novozyme, P510-01) to amplify the corresponding fragments with a size of 233 bp (for constructing a VIGS gene silencing system) and 987 bp (for constructing an overexpression system), respectively. The TRV2 and 35S::PRI101-eGFP vectors were double-digested by using NEB BamHI and SmaI, and the two fragments (233 bp and 987 bp) amplified above were purified by using a gel recovery kit, and the digested vector recovery fragments were recombined into the corresponding vectors by using ClonExpressII One Step Cloning Kit (Novozyme, C112-01) (5 x CE Buffer: 4 µL; linearized product of the vector: 150 ng; purified PCR amplification product: 100 ng; Exnase ® II: 2 µL; ddH2O: supplemented to 20 µL), 37°C for 30 min; reduced to 4°C to obtain the recombinant plasmid, which was transformed into E. coli TOP10 by heat shock transformation, positive clones were picked and subjected to subsequent plasmid extraction, and the plasmid was sent for sequencing (Shanghai SunGene), and the sequence-corrected LsGlu The transient silencing vector TRV2-Glu and the overexpression vector 35S::PRI101-eGFP-LsGlu.
[0034] Example 3 Analysis of the transient silencing and the function of Botrytis cinerea resistance of the flower buds of Luzhou lily LsGlu The flower buds of Luzhou lily were subjected to gene transient silencing by using virus-mediated gene silencing VIGS technology (tobacco rattle virus TRV1 and TRV2 system). LsGlu gene transient silencing.
[0035] The TRV2-Glu vector and TRV2 and TRV1 vectors constructed in Example 2 were transformed into Agrobacterium GV3101, respectively, and plated on LB agar plates containing antibiotics (rifampicin 50ug / mL, kanamycin 50ug / mL). After three days of culture, positive clones were picked and cultured overnight in 4 mL of YEP. The next day, the bacterial culture was further cultured in a large volume of 50 mL until the bacterial concentration reached OD500. 600 =0.6. The bacterial culture was transferred to a 50 mL centrifuge tube (5000 rpm, 6 minutes), the supernatant was discarded, and the cells were resuspended in 5 mL of MgCl2 (10 mmol / L) and 5 mL of MES (10 mmol / L). The TRV1 culture was mixed thoroughly with equal volumes of TRV2 and TRV2-Glu cultures. The mixed culture was injected into lily buds using a 1 mL syringe. TRV2 served as an empty vector control for the VIGS experiment. Five days after injection, the outer petals were inoculated with *Botrytis cinerea*, and samples were taken for RT-qPCR detection. LsGlu The efficiency of silence, such as Figure 7 The phenotypic pattern of lesions and the statistical analysis of lesion diameter on the 3rd day after infection are as follows: Figure 8 The results showed that, at 1 day after infection (1 dpi), compared with the control TRV2, the TRV2-Glu silencer had significantly lower levels of... LsGlu The gene expression level was downregulated by 75%, and the diameter of the lesions increased. This indicates... LsGlu It plays a positive regulatory role in the resistance of lilies to gray mold.
[0036] Example 4 Agrobacterium-mediated genetic transformation of tobacco and its anti-Botrytis cinerea function analysis The 35S::PRI101-eGFP-LsGlu vector and the 35S::PRI101-eGFP vector (blank control) constructed in Example 2 were transformed into Agrobacterium LBA4404, respectively. The transformed cultures were then plated on LB solid medium containing the corresponding antibiotics (rifampin, 50 μg / mL, for the target strain; kanamycin, 50 μg / mL, for the plasmid) and incubated at 28°C with inverted incubation for 2 days. Single positive colonies were picked and inoculated into 3 mL of LB liquid medium containing the same antibiotics and cultured at 28°C with shaking at 200 rpm until OD500 was reached. 600 =0.6; Take 1 mL of bacterial culture and transfer it to 50 mL of YEB liquid medium (antibiotic-free), and continue culturing until OD. 600 ≈0.6 (logarithmic growth phase), centrifuge at 5000 rpm for 6 minutes, discard the supernatant, resuspend in MS liquid medium (hormone-free), and adjust OD. 600 The concentration was increased to 0.5 to obtain Agrobacterium-infected solution.
[0037] Mature seeds of tobacco K326 were selected, 75% alcohol was used to soak for 30 seconds, sterile water was used to rinse for 2 times, 0.1% mercury (HgCl2) was used to soak for 10 minutes, sterile water was used to rinse for 5 times, and then the seeds were sowed on MS basic medium (without hormone), and the culture was carried out at 25°C with 16 hours light / 8 hours darkness, so as to obtain 2-3 weeks old sterile seedlings. The tender leaves of the sterile seedlings were cut into 0.5*0.5 cm2 small pieces, which were inoculated on pre-culture medium (MS+15 g / L sucrose+9 g / L agar powder, pH 5.8) and cultured at 25°C with 16 hours light for 2 days.
[0038] The pre-cultured tobacco leaves were soaked in the agrobacterium infection solution for 5 minutes, and then the explants were taken out and the surface excess bacterial solution was absorbed with sterile filter paper (to avoid excessive growth of agrobacteria); co-culture: the explants were inoculated on co-culture medium (MS+2 mg / L 6-BA+0.2 mg / L NAA+30 g / L sucrose+9 g / L agar powder, pH 5.8), and the back of the tobacco leaves was downward, and the culture was carried out at 25°C in dark condition for 3 days (to observe whether there was a slight white bacterial film on the edge of the explants, and to avoid contamination caused by more than 3 days).
[0039] After co-culture, the explants were transferred to screening medium (MS+2 mg / L 6-BA+0.2 mg / L NAA+30 g / L sucrose+9 g / L agar powder+30 mg / L Basta+300 mg / L phosphinothricin, pH 5.8), and the culture was carried out at 25°C with 16 hours light (light intensity 2000-3000 lux), and the medium was replaced every 2 weeks (to prevent recurrence of agrobacteria and nutrient depletion), and after 3-4 weeks, green resistant buds were differentiated on the edge of the explants (non-transformed cells were yellow and dead), and when the resistant buds grew to 2-3 cm, they were cut (to avoid taking too much callus), and then inoculated on rooting medium (MS+0.5 mg / L NAA+30 g / L sucrose+9 g / L agar powder+300 mg / L phosphinothricin, pH 5.8), and the culture was carried out at 25°C with 16 hours light, and white root system grew after 2-3 weeks (non-transformed buds could not root or the root system was yellow), and after rooting, the culture bottle sealing film was opened, and the seedlings were adapted at room temperature for 2 days (hardening), and then transplanted to sterilized substrate (peat soil: perlite = 3:1), and the culture was carried out for 1 week, until the seedlings were healthy, and the transcription and expression of the target gene of the transformed seedlings were detected by Western blot, and 2 strains of transgenic tobacco 35S::PRI101-eGFP-LsGlu and 35S::PRI101-eGFP were obtained through screening. Figure 9 ).
[0040] Based on the above transgenic positive plants GFP and LsGlu-GFP, T2 generation seeds were obtained and replanted to obtain healthy tobacco leaf, and then inoculated with Botrytis cinerea. After 3 days, the lesion phenotype was observed and the lesion diameter was measured. The results showed that compared with the control GFP, the lesion of LsGlu-GFP transgenic tobacco was smaller Figure 10 ).
[0041] Example 5 Agrobacterium-mediated genetic transformation of tomato and functional analysis of resistance to Botrytis cinerea Select full, uniform, fresh tomato seeds, rinse with sterile water several times, then sterilize the tomato seeds with 70% alcohol for 30 seconds, rinse with sterile water 3 times, then sterilize with 10% sodium hypochlorite for 10 minutes, rinse with sterile water 4 times, dry with sterile filter paper, and then inoculate in seed germination medium (1 / 2MS). Dark culture until most of the seeds germinate and turn white, then place them in a culture condition of 16 hours of light per day, light intensity of 1600-1800 lux, and temperature of (24±2)℃.
[0042] Transform the 35S:PRI101-eGFP-LsGlu vector and the 35S:PRI101-eGFP vector constructed in Example 2 into Agrobacterium LBA4404, respectively, and coat on LB solid medium containing corresponding antibiotics (rifampicin, 50ug / mL, for the strain; kanamycin, 50ug / mL, for the plasmid), and invert culture at 28℃ for 2 days. Pick positive single colonies and inoculate in 3mL LB liquid medium containing the same antibiotics, and culture at 28℃, 200rpm for 16 hours (to OD 600 =0.6). Transfer 1mL bacterial solution to 50mL YEB liquid medium (without antibiotics), continue to culture to OD 600 ≈0.6 (logarithmic growth phase), centrifuge at 5000rpm for 6 minutes, discard the supernatant, resuspend with MS liquid medium (without hormones), adjust OD 600 to 0.5, and obtain Agrobacterium infection solution.
[0043] Select well-grown tomato hypocotyls as explants for transformation, cut the hypocotyls into segments about 0.5-0.6mm long, and place them horizontally on pre-culture medium (1 / 2MS+ZT 2.0mg / L+IAA 0.2mg / L) at 15-20 pieces per dish, and culture at 25℃ with 16 hours of light for 2 days.
[0044] Take the explants from the pre-culture medium, infect them in the prepared Agrobacterium infection solution for 30 minutes, take out the explants and dry them on sterile paper, and then re-culture them in the pre-culture medium for 2 days.
[0045] The explants after co-cultivation are transferred to the selection medium (ZT 2.0 mg / L+IAA 0.2 mg / L+Kan 100 mg / L+carbenicillin 500 mg / L) for selection culture. After several days of selection culture, the cotyledon starts to thicken, the hypocotyl starts to thicken, and the transformed explants will form callus and adventitious buds on the selection medium. The subculture is performed every two weeks.
[0046] The callus with bud primordia is cut into small pieces and transferred to the stem elongation medium (ZT 1.0 mg / L+IAA 0.05 mg / L+Kan 100 mg / L+carbenicillin 500 mg / L) for subculture, which is performed every two weeks.
[0047] When the adventitious buds grow to about 1 cm, the healthy regenerated sprouts are selected, the base callus and the culture medium are completely removed, and the regenerated sprouts are transferred to the rooting medium (MS or 1 / 2 MS as the basic medium, supplemented with IAA 0.1 mg / L+Kan 50 mg / L+carbenicillin 300 mg / L) for culture to form complete plants.
[0048] After the seedlings grow lateral roots, the bottle cap is opened, a small amount of sterile water is poured into the culture bottle (3-5 mm above the culture medium), and the culture bottle is placed in a cool and ventilated place for seedling training. After 3 days, the root culture medium is washed, the seedlings are transferred to the soil, the seedlings are covered with a transparent plastic film for 7 days, and the seedlings are cultured in weak light for a period of time to adapt to the change from the culture medium to the nutrient medium. After the seedlings are alive, they are moved to the natural environment for seedling training. The transcription and expression of the target gene in the transformed seedlings are detected by Western blot, and 2 strains of transgenic tomato 35S::PRI101-eGFP-LsGlu and 35S::PRI101-eGFP are obtained after screening. Figure 9 ).
[0049] Based on the T2 generation seeds of the above transgenic positive plants GFP and LsGlu-GFP, healthy tomato plant leaves and fruits are obtained after replanting, and the plants are inoculated with Botrytis cinerea. After 3 days, the lesion phenotype is observed and the lesion diameter is measured and counted. The results show that compared with the control GFP, the lesion of the LsGlu-GFP transgenic tomato is smaller. Figure 10 ).
Claims
1. A lily turf β-1, 3-glucanase gene LsGlu whose CDS is shown as SEQ ID NO: 1, encoding a protein with an amino acid sequence shown as SEQ ID NO:
2.
2. The Lilium brownii var. formosanum β-1,3-glucanase gene of claim 1 LsGlu in enhancing resistance of tobacco and tomato to Botrytis cinerea Botrytis cinerea ) 3. The Lilium brownii var. formolancum β-1,3-glucanase gene of claim 1 LsGlu application in enhancing resistance to gray mold in tobacco and tomato.