Application of dsDiap1 and / or dsSnf7 in environmental safety evaluation of RNAi technical products on non-target organisms
By using dsDiap1 and dsSnf7 as positive controls, the problem of inaccurate detection results in the environmental safety evaluation of RNAi technology products was solved, and efficient and accurate safety evaluation and detection were achieved.
Patent Information
- Application Number
- CN202511227369.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-29
- Publication Date
- 2025-12-05
AI Technical Summary
The lack of positive controls matching the mechanism of action for existing RNAi technology products in environmental safety assessments leads to inaccurate test results, especially when using traditional chemical pesticides such as chlorpyrifos, which can easily result in false negatives or false positives, thus affecting the safety assessment of RNAi products.
dsDiap1 and/or dsSnf7 were used as positive controls to simulate the mechanism of RNAi in insects. Ladybugs were treated by microinjection or feeding, and their survival rate was counted and significant differences were analyzed to ensure the effectiveness of the experimental system and the accuracy of the detection.
It provides positive control substances with RNAi specificity and high mechanism matching, which improves the accuracy of environmental safety assessment and detection of RNAi crops or RNA pesticides and avoids the distortion of results caused by improper selection of positive controls.
Smart Images

Figure CN121065183A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of ecological risk assessment of RNAi technology products, in particular to the application of dsDiap1 and / or dsSnf7 in the environmental safety assessment of RNAi technology products on non-target organisms. BACKGROUND
[0002] RNA interference (RNAi) technology is a gene silencing mechanism triggered by double-stranded RNA (dsRNA), the core mechanism of which includes: dsRNA is cut into small RNA (siRNA) by Dicer enzyme, which is combined with RNA-induced silencing complex (RISC), recognizes and degrades the target mRNA through base pairing, and finally leads to gene expression silencing (Wang et al., 2022). RNAi technology has the characteristics of specificity, high efficiency and safety, and the development of this technology not only promotes the research of insect gene function, but also makes great progress in the field of agricultural pest control (Luo et al., 2024).
[0003] The commercial application of RNAi technology in agricultural pest control mainly includes RNA biological pesticides and RNAi insect-resistant crops (one of the genetically modified crops) and other forms (Zotti et al., 2018; Guan et al., 2022). However, such products must pass through strict environmental safety assessment (ERA) before they are put on the market, which is a key link to ensure the safe application of RNAi products and other biological breeding technology products (Schiemann et al., 2019; Papadopoulou et al., 2020). The core purpose of environmental safety assessment of RNAi technology products is to assess the potential risks they may bring to the ecosystem and provide scientific basis for risk management (Camastra et al., 2014; Meyer et al., 2011; Yahaya et al., 2024; Kearns et al., 2014). The focus is on identifying and assessing the potential adverse effects of RNAi technology products on non-target organisms, biodiversity and ecosystem functions (Ervin et al., 2005; Lu et al., 2008; Roberts et al., 2015).
[0004] In the environmental safety assessment of non-target organisms, positive controls are essential to verify the feasibility of experimental methods and the effectiveness of detection systems. However, existing research generally lacks the application of positive controls: most studies use blank, water, scrambled small RNA, or dsGFP as negative controls (Niuet al., 2018; Guan et al., 2018; Maue et al., 2009), ignoring the necessary role of positive controls in ensuring the reliability of experimental systems. Although some studies attempt to use known toxic substances such as chlorpyrifos and trypsin inhibitors as positive controls (Zhou et al., 2023; Chen et al., 2021), they have certain reference value in verifying the sensitivity of the detection system, but their mechanisms differ significantly from RNAi. In contrast, using dsRNA or miRNA as a positive control has more advantages in terms of mechanism relevance and effect specificity. For example, the stability of small RNA in environmental media and insect bodies is influenced by various factors, and the sensitivity of different species to RNAi also needs to be standardized and corrected by mechanism-related positive controls. Typically, a positive control will choose a gene that is known and easy to produce phenotypic changes as a target, and by observing the significant biological phenotypes produced after its interference, it confirms the effectiveness of RNAi (Walton et al., 2023).
[0005] The safety assessment or detection of non-target organisms for transgenic crops and biological pesticides mainly includes laboratory tests, semi-field tests, and field tests. Among them, laboratory tests, as the foundation, can provide reliable data under precise control of variables, laying the foundation for subsequent tests. Laboratory tests usually include Tier-1 tests, secondary nutrition tests, and tertiary nutrition tests. Tier-1 tests refer to mixing exogenous nucleic acid sequences inserted in transgenic crops, expressed exogenous proteins or other exogenous products, and effective nucleic acid components in nucleic acid biological pesticides directly into feed to feed non-target organisms for toxicological tests. In such tests, a complete toxicological detection system must be established, and negative and positive controls must be set up, with positive controls used to verify the feasibility and effectiveness of the test system.
[0006] For Tier-1 tests of RNAi technology products, positive controls should meet the following conditions: 1) have the same mechanism of action as RNAi technology products; 2) have significant toxicity to test organisms; 3) have certain stability in feed or other experimental substrates and are not easily degraded.
[0007] Current studies mostly use traditional chemical pesticides (such as chlorpyrifos) as positive controls. However, the neurotoxicity mechanism of chlorpyrifos is completely different from that of RNAi, which is easy to cause false negative or false positive, and thus affects the accuracy of the results. For example: when the nucleases in the saliva or body fluid of the non-target organism to be tested can degrade double-stranded RNA (dsRNA), even if the RNAi product fails, chlorpyrifos will still show toxicity, which may be misjudged as "the experimental system is effective", thereby leading to the false identification of the RNAi product as safe, while in fact the non-target organism cannot respond to RNAi due to physiological barriers. Therefore, chlorpyrifos is not suitable as a positive control for RNAi products in this case, and it is urgent to screen mechanism-related RNA molecules as positive controls to improve the scientificity and reliability of the evaluation.
[0008] Harmonia axyridis belongs to the family Coccinellidae of the order Coleoptera, and is an important predatory natural enemy insect, widely distributed in various farmland ecosystems. It has strong environmental adaptability, high reproductive capacity and wide food habits, and shows strong predatory ability to various vegetable and farmland pests (Cui YQ et al., 2022; Wu YW et al., 2022). As a key agricultural biocontrol insect, Harmonia axyridis plays an important role in maintaining the stability of farmland ecosystems (Gong Q et al., 2020; Wang S et al., 2007; Edward et al., 2009). Given its important position in farmland ecosystems, Harmonia axyridis is often used as an important indicator species for the safety of non-target organisms of RNAi technology products.
[0009] Therefore, the present application intends to take the important predatory natural enemy Harmonia axyridis in farmland as the evaluation object, and screen positive controls suitable for safety evaluation of RNAi technology products, in order to provide a scientific basis for the safe application of RNAi technology products. SUMMARY
[0010] The purpose of the present application is to provide the application of dsDiap1 and / or dsSnf7 in the environmental safety evaluation of RNAi technology products on non-target organisms, in order to solve the problems of the prior art.
[0011] To achieve the above-mentioned purpose, the present application provides the following solutions:
[0012] The present application provides the application of dsRNA in the environmental safety evaluation of transgenic plants, wherein the dsRNA comprises dsDiap1 and / or dsSnf7;
[0013] The nucleic acid sequence of the dsDiap1 is shown in SEQ ID NO. 10;
[0014] The nucleic acid sequence of the dsDiap1 is shown as SEQ ID NO. 10.
[0015] Further preferably, the transgenic plant is an RNAi plant.
[0016] The present application provides application of dsRNA in preparing a product for environmental safety evaluation of a transgenic plant, wherein the dsRNA comprises dsDiap1 and / or dsSnf7.
[0017] The nucleic acid sequence of the dsDiap1 is shown as SEQ ID NO. 10.
[0018] The nucleic acid sequence of the dsDiap1 is shown as SEQ ID NO. 10.
[0019] Preferably, the dsRNA is a positive control.
[0020] Preferably, the product comprises a reagent or a kit.
[0021] Further preferably, the transgenic plant is an RNAi plant.
[0022] The present application provides a product for evaluating environmental safety of a transgenic plant, wherein the product comprises dsRNA; and the dsRNA comprises dsDiap1 and / or dsSnf7.
[0023] The nucleic acid sequence of the dsDiap1 is shown as SEQ ID NO. 10.
[0024] The nucleic acid sequence of the dsDiap1 is shown as SEQ ID NO. 10.
[0025] Preferably, the product comprises a reagent or a kit.
[0026] The present application provides application of dsRNA in evaluation or detection of an RNAi technology product, wherein the dsRNA comprises dsDiap1 and / or dsSnf7; and the RNAi technology product comprises an RNAi plant and an RNA pesticide.
[0027] The nucleic acid sequence of the dsDiap1 is shown as SEQ ID NO. 10.
[0028] The nucleic acid sequence of the dsDiap1 is shown as SEQ ID NO. 10.
[0029] Further preferably, the evaluation comprises environmental safety evaluation.
[0030] The application provides a method for evaluating the safety of RNAi technology products to non-target organisms, Harmonia axyridis, by using dsRNA, comprising the steps of treating Harmonia axyridis larvae with dsRNA, counting the survival rate of the Harmonia axyridis larvae, and performing significant difference analysis; the RNAi technology products include RNAi plants and RNA pesticides;
[0031] The dsRNA comprises dsDiap1 and / or dsSnf7.
[0032] The nucleic acid sequence of the dsDiap1 is shown as SEQ ID NO. 10.
[0033] The nucleic acid sequence of the dsSnf7 is shown as SEQ ID NO. 9.
[0034] Preferably, the treatment mode comprises feeding or injection.
[0035] Preferably, the time for counting the survival rate of the Harmonia axyridis larvae is 0h, 12h, 24h, 36h, 48h, 60h, 72h, 84h and 96h after the dsRNA treatment of the Harmonia axyridis larvae.
[0036] As an additional method, the application further provides the use of dsRNA in the preparation of a product for evaluating the environmental safety of RNAi technology products, wherein the dsRNA comprises dsDiap1 and / or dsSnf7; the RNAi technology products include RNAi plants and RNA pesticides.
[0037] The nucleic acid sequence of the dsDiap1 is shown as SEQ ID NO. 10.
[0038] The nucleic acid sequence of the dsSnf7 is shown as SEQ ID NO. 9.
[0039] As an additional method, the application further provides a product for evaluating the environmental safety of RNAi technology products, wherein the product comprises dsRNA; the RNAi technology products include RNAi plants and RNA pesticides; and the dsRNA comprises dsDiap1 and / or dsSnf7.
[0040] The nucleic acid sequence of the dsDiap1 is shown as SEQ ID NO. 10.
[0041] The nucleic acid sequence of the dsSnf7 is shown as SEQ ID NO. 9.
[0042] Further preferably, the product comprises reagents or a kit.
[0043] The application discloses the following technical effects:
[0044] The application adopts gene-specific dsRNA (dsDiap1 and / or dsSnf7) to replace traditional chemical pesticides, and strictly simulates the mechanism of RNAi in insects (target gene silencing → death). In the experimental operation, the dsRNA positive control provided by the application is highly consistent with the exogenous dsRNA in the RNAi product in terms of in vitro degradation, insect intake mode and dose, and in vivo degradation; and through the double verification of >90% mortality within 72 hours after injection and significant down-regulation of the target gene, the effectiveness of the test system and the applicability of the tested organism are confirmed. The application provides a standardized positive control material or tool with RNAi specificity and a highly matched mechanism for the evaluation or detection of RNAi products, avoiding distorted evaluation or detection results caused by improper selection of positive controls.
[0045] Therefore, the dsDiap1 and dsSnf7 provided by the application can be used as positive controls for environmental safety evaluation and detection of RNAi crops or RNA pesticides. The delivery methods include microinjection or feeding (such as mixing into artificial feed or spraying on the surface of feed or plant leaves), which can effectively induce target gene silencing and produce lethal effects in non-target organisms, Harmonia axyridis.
[0046] In summary, the application establishes a highly matched positive control material (dsDiap1 and / or dsSnf7) for the mechanism of RNAi, which is used for safety evaluation or detection of RNAi crops or RNA biological pesticides on non-target organisms, Harmonia axyridis, effectively replacing traditional chemical pesticides or other unmatched positive materials, thereby improving the accuracy and efficiency of evaluation or detection. BRIEF DESCRIPTION OF DRAWINGS
[0047] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings described below are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor.
[0048] Figure 1 Survival rate of Harmonia axyridis injected with miRNA; wherein, miR-92a: injection of miR-92a agomir; mimics NC: injection of mimics NC; PBS: injection of PBS;
[0049] Figure 2 Survival rate of Harmonia axyridis injected with dsRNA; wherein, dsGFP: injection of dsGFP; dsDiap1: injection of dsDiap1; dsSnf7: injection of dsSnf7;
[0050] Figure 3Figure 6 shows the expression of Diap1 gene in Harmonia axyridis after injection of dsDiap1; dsGFP: injection of dsGFP; dsDiap1: injection of dsDiap1; abscissa: time, ordinate: relative expression level of target gene Diap1; "*" indicates significant difference (t-test, P<0.05).
[0051] Figure 4 Figure 7 shows the expression of Snf7 gene in Harmonia axyridis after injection of dsSnf7; dsGFP: injection of dsGFP; dsSnf7: injection of dsSnf7; abscissa: time (h), ordinate: relative expression level of target gene Snf7; "*" indicates significant difference (t-test, P<0.05). DETAILED DESCRIPTION
[0052] The following detailed description of the application is provided for the purpose of understanding the application, but is not intended to limit the application. The detailed description is presented primarily for the purpose of enabling others skilled in the art to practice the application.
[0053] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. In addition, any numerical range recited herein is intended to include all sub-ranges of the same numerical precision subsumed
[0054] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice of the present application. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In the event of conflict between the present specification and any document incorporated by reference, the present specification controls.
[0055] Various modifications and changes can be made to the specific embodiments described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples presented herein. The description and examples are illustrative of the application and are not intended to limit the scope of the application.
[0056] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.
[0057] Example 1
[0058] 1 Material method
[0059] 1.1 Test insects
[0060] The Harmonia axyridis used in this experiment was collected from farmland in the northeast in 2018 and was raised in a laboratory artificial climate chamber with Acyrthosiphon pisum as food. The specific process is as follows: pea plants were planted for Acyrthosiphon pisum to feed on, and fresh pea seedlings with sufficient Acyrthosiphon pisum were collected daily for Harmonia axyridis to feed on. The rearing conditions were L:D = 16h:8h (light for 16h and dark for 8h), temperature of 25±1℃, and humidity of 70±10%.
[0061] 1.2 Experimental equipment
[0062] RXZ intelligent artificial climate chamber (RXZ-500B), body microscope (SZX16-OLMPUS), nucleic acid electrophoresis instrument (DYY-6C type), EC3 gel imaging system, microcentrifuge (Centrifuge-5452R), electric grinding pestle (OSE-Y30), T100TM PCR instrument, CFX96 Touch Real-Time PCR, Detection System.
[0063] 1.3 Main reagents
[0064] TRlzol reagent (15596018), anhydrous ethanol, isopropyl alcohol, agarose, T7 RNAi Transcription Kit, One-Step gDNA Removal and cDNA Synthesis SuperMix (AT311), Green qPCR SuperMix (AQ601).
[0065] 1.4 Double-stranded RNA synthesis
[0066] 1.4.1 Extraction and reverse transcription of RNA
[0067] In this example, TRlzol reagent was used to extract total RNA from Harmonia axyridis. The entire experiment was carried out under low temperature conditions. The centrifuge tubes and gun heads used in the experiment were RNase-free to avoid RNA degradation. The sample concentration was detected using NanoDrop-2000, and the RNA quality was detected by agarose gel electrophoresis. Then, according to the instructions of the Removal and cDNA Synthesis SuperMix (AT311) kit, cDNA was synthesized by reverse transcription and stored at -80℃ for future use.
[0068] 1.4.2 Primer synthesis
[0069]
[0070] Table 1 primer sequences
[0071] Primer name Primer sequence (5'-3') HaSnf7-F TAATACGACTCACTATAGGGCGGATGAAGCACCAAGTACG (SEQ ID NO. 3) HaSnf7-R TAATACGACTCACTATAGGGTCAGGAAGTTTGTTTGTAGGCA (SEQ ID NO. 4) HaDiap1-F TAATACGACTCACTATAGGGAAACCCATAGACCTGGCTGC (SEQ ID NO. 5) HaDiap1-R TAATACGACTCACTATAGGGTCAAGGCTGACGCACAATCT (SEQ ID NO. 6) GFP-F TAATACGACTCACTATAGGGGCGAGGGCGATGCCACCTAC (SEQ ID NO. 7) GFP-R TAATACGACTCACTATAGGGCACGCTGCCGTCCTCGATGT (SEQ ID NO. 8)
[0072] Note: dsGFP is directly purchased from Shanghai Shenguo Biotech Co., Ltd., and the primer sequence is directly provided by the company.
[0073] 1.4.3 PCR amplification
[0074] The T7 promoter DNA template was amplified under the action of high-fidelity enzyme, and then PCR was performed. Whether the PCR product met the expectation was detected by agarose gel electrophoresis, and the target band product was sent to Shenguo Biotech Co., Ltd. for sequencing. After all met the expectation, the PCR product was directly used as a dsRNA template and sent to Shanghai Shenguo Biotech Co., Ltd. for dsRNA synthesis. The nucleic acid sequence of the dsSnf7 gene is shown in SEQ ID NO. 9, which is specifically as follows:
[0075] 5'-CGGATGAAGCACCAAGTACGGGGGCTGCTATCCAAAAACTACGTGAAACGGAG GAAATGCTGAATAAGAAACAAGCCTTTCTTGAAAAGAAAATAGAACAAGAAATTTTACTTGCTAAACAAAATGCTGCTAAAAATAAAAGGGCGGCTATACAAGCATTGAAAAGGAAGAAGCGTTATGAAAAACAGCTGCAACAGATAGATGGAACCCTTACAACTTTGGAATTACAAAGAGGAACACTAGAAGAGGCAGTAACGAATACAGATGTTATACAAACTATGAAAAATGCTGCCGATGCCATTAAACATGCTCACAAACATATGAATGTTGATCAAGTACATGATATAATGGATGATATTGCTGAGCAACAAGATGTAGCTAATGAGATATCACAGGCCATCAGCAACCCGATTGGTTTTGGAGAGGATATTGATGAAGATGAATTAAACAAGGAATTAGAAGAACTTGAACAAGAAACACTTGATAGTGAATTACTTGATATCACTTTGCCTACAAACAAACTTCCTGA-3';
[0076] The nucleic acid sequence of the dsDiap1 gene is shown in SEQ ID NO. 10, which is specifically as follows:
[0077] 5'-AAACCCATAGACCTGGCTGCTGCAGGTTTTTACTATTTAGGCGTCGGAGACCAG GTCATGTGCTTCTATTGTGGGGGAGGTTTAAAAGACTGGGTTGAACAAGACGATCCCTGGGAACAACATGCATTGTGGTACCCCGAATGCAATTACCTTTTATTGAAGAAAACCCCAGCCTTTGTCGAAGATATTCAGAAAAAACGAATAGCTAATAAAGTGGAAAAAGAAGAAGAATCACATAATAAAGAAGGAGAATCATGTAAAAAAGAAGTAGAATCTTGTATAAAGGAAAATGAGATTGAAGCGTGTTGTAGCTCTAATAGTGACACCAAAGAAACTCCTAGCAATCCTATCACAATTGTAGAGGAGAGAAAATCTGAAGAACGTATGCCAGTGTGCAAAATTTGTTATACAAACAATGCGGCAATTTTGTTTTTGCCATGTGGACATTTGGTTTCTTGTGCAGATTGTGCGTCAGCCTTGA-3';
[0078] The nucleic acid sequence of the dsGFP gene (dsGFP standard) is shown as SEQ ID NO. 11, which is purchased from Shanghai Zhishengyougu Biotechnology Co., Ltd., with the product number DS001, and the nucleotide sequence is specifically as follows:
[0079] 5'-CACGCTGCCGTCCTCGATGTTGTGGCGGATCTTGAAGTTCACCTTGATGCCGTT CTTCTGCTTGTCGGCCATGATATAGACGTTGTGGCTGTTGTAGTTGTACTCCAGCTTGTGCCCCAGGATGTTGCCGTCCTCCTTGAAGTCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTGTCGCCCTCGAACTTCACCTCGGCGCGGGTCTTGTAGTTGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTAGCCTTCGGGCATGGCGGACTTGAAGAAGTCGTGCTGCTTCATGTGGTCGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGTCAGGGTGGTCACGAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAGCTTGCCGTAGGTGGCATCGCCCTCGC-3'.
[0080] 1.5 Effect of miR92a injection on the growth and development of H. axyridis larvae
[0081] The 2nd instar larvae of H. axyridis were collected for microinjection. Three treatments were set in the experiment, miR-92a agomir (the nucleotide sequence of the sense strand is shown in SEQ ID NO. 12, specifically: AUUGCACUAGUCCCGGCCUA, the nucleotide sequence of the antisense strand is shown in SEQ ID NO. 13, specifically: GGCCGGGACUAGUGCAAUUU), mimics NC (the nucleotide sequence of the sense strand is shown in SEQ ID NO. 14, specifically: UUGUACUACACAAAAGUACUG, the nucleotide sequence of the antisense strand is shown in SEQ ID NO. 15, specifically: GUACUUUUGUGUAGUACAAUU) and PBS treatment. The injection amount of each treatment was 60 ng per head, i.e. the concentration of the solution injected per head was 3000 ng / μL, and the injection volume was 0.02 μL. 30 larvae were injected for each treatment. The injected larvae were placed in a clean culture dish and raised under standard environmental conditions. The survival rate of H. axyridis larvae in each treatment was counted, and the experiment was performed for 120 h.
[0082] 1.6 Effect of dsRNA interference treatment on the growth and development of H. axyridis larvae
[0083] Harvested 2nd instar larvae of H. axyridis for microinjection. Three treatments were set, including dsDiap1 (SEQ ID NO. 10), dsSnf7 (SEQ ID NO. 9) and dsGFP (SEQ ID NO. 11), and the injection amount of each treatment was 400 ng per head, i.e. the concentration of the solution injected per head was 20 μg / μL, and the injection volume was 0.02 μL. 30 larvae were injected for each treatment. The injected larvae were placed in a clean culture dish and raised under standard feeding conditions. The survival rate of the larvae in each treatment was counted, and the experiment lasted for 96 h.
[0084] 1.7 Real-time fluorescent quantitative PCR
[0085] The RP49 gene (ribosomal protein 49) was selected as the internal reference gene, and the expression levels of the target genes Diap1 and Snf7 in the 0th, 2nd and 4th day larvae after injection were detected. Each sample was 10 larvae, and three biological replicates were performed. According to the manufacturer's instructions, the reaction system was configured by using the Green qPCR SuperMix kit (full type AQ601), and the reaction program was as follows: 94°C pre-denaturation for 30 s, 94°C denaturation for 5 s, 60°C extension for 30 s, and 40 cycles. The expression level of the gene was calculated by using the 2 Green qPCR SuperMix kit (full type AQ601), and the reaction program was as follows: 94°C pre-denaturation for 30 s, 94°C denaturation for 5 s, 60°C extension for 30 s, and 40 cycles. The expression level of the gene was calculated by using the 2 method.
[0086] The primers required for the experiment were designed by using the primer 6.0 software and synthesized by Beijing Sangon Biotech (Table 2)
[0087] Table 2 Real-time fluorescent quantitative PCR primers
[0088] Primer name Primer sequence (5'-3') HaSnf7-F TGGGCCTCATAAGGACAAAT (SEQ ID NO. 16) HaSnf7-R ATTCATAATGAGGCAACGTTCT (SEQ ID NO. 17) HaDiap1-F GCAGCAGTACACTCATTCCT (SEQ ID NO. 18) HaDiap1-R GGTCTTCAGTCGGTCTATTGTT (SEQ ID NO. 19) HaRP49-F GCGATCGCTATGGAAAACTC (SEQ ID NO. 20) HaRP49-R TACGATTTTGCATCAACAGT (SEQ ID NO. 21)
[0089] 1.8 Data analysis
[0090] The survival curves of the H. axyridis in different treatments were analyzed by using the Log-rank (Mantel-Cox) test; the expression levels of the genes in the H. axyridis after different treatments were calculated by using the 2 -ΔΔCt method. The t-test method was used to analyze the significant difference in the expression levels of the target genes in the H. axyridis after different treatments. All the figures were drawn by using the GraphPad Prism software.
[0091] 2 Results
[0092] 2.1 Effect of miR92a injection on the survival ability of H. axyridis larvae
[0093] The survival rate of H. axyridis decreased with time in all treatment groups within 0-120 h after injection of miR-92a agomir. At 12 h, the injected miR-92a began to die, and the rest of the treatment insects died at 60 h after injection. However, the survival rate of the three treatment groups was 87.5%-97.06% at the end of the test. Log-rank (Mantel-Cox) test showed that there was no significant difference between the treatment group injected with miR-92a agomir and the negative control group and the blank control group (df = 2, P = 0.2947), indicating that injection of 60 ng / individual of miR-92a had no significant effect on the survival rate of H. axyridis larvae. Figure 1 ).
[0094] 2.2 Effect of dsRNA injection on the survival of H. axyridis larvae
[0095] The survival rate of H. axyridis in each treatment group decreased significantly with time within 96 h after injection of dsRNA. Among them, the mortality rate of the insects reached 93.33% at 36 h after injection of dsDiap1, and only 6.67% of the individuals survived. The mortality rate of the insects injected with dsSnf7 was > 90% at 60 h, and all the insects died at 72 h after injection. Log-rank (Mantel-Cox) test analysis found that the survival curves of the treatment groups injected with dsDiap1 or dsSnf7 were significantly different from those of the negative control group and the blank control group (P < 0.0001), indicating that dsDiap1 and dsSnf7 had a significant lethal effect on H. axyridis, but there were some differences in the action time of the two( Figure 2 ).
[0096] 2.3 qPCR detection of the expression level of target genes Snf7 and Diap1 in H. axyridis larvae
[0097] The expression levels of target genes Diap1 and Snf7 in H. axyridis injected with dsRNAs were detected at different time periods. The expression levels of Diap1 in H. axyridis were significantly decreased at 2 h, 6 h, and 12 h after injection of dsDiap1 (P = 0.0070, P = 0.0002, P = 0.0219) Figure 3 ). The expression levels of Snf7 in H. axyridis were also significantly decreased at 2 h, 6 h, 12 h, 24 h, and 48 h after injection of dsSnf7 (P = 0.0016, P = 0.0005, P < 0.0001, P = 0.0016, P = 0.0020) Figure 4 ).
[0098] In conclusion, the dsDiap1 and dsSnf7 provided by the application can efficiently silence the expression of target genes of the ladybird larvae, and the target gene silencing leads to a significant increase in the mortality of the ladybird larvae. Therefore, the dsDiap1 and dsSnf7 provided by the application can be used as positive control products of RNAi technology products for safety evaluation of non-target organisms, i.e. ladybirds.
[0099] The above-described embodiments are only used to describe the preferred modes of the present application, and are not used to limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements of the technical solutions of the present application made by those skilled in the art shall fall within the protection scope of the present application defined by the claims.
Claims
1. Application of dsRNA in environmental safety assessment of transgenic plants, characterized in that, The dsRNA comprises dsDiap1 and / or dsSnf7. The nucleic acid sequence of the dsDiap1 is shown as SEQ ID NO.
10. The nucleic acid sequence of the dsSnf7 is shown as SEQ ID NO.
9.
2. Use of dsRNA for the preparation of a product for the environmental safety assessment of transgenic plants, characterized in that, The dsRNA comprises dsDiap1 and / or dsSnf7. The nucleic acid sequence of the dsDiap1 is shown as SEQ ID NO.
10. The nucleic acid sequence of the dsSnf7 is shown as SEQ ID NO.
9.
3. The product of claim 2, wherein, The dsRNA is a positive control.
4. The product of claim 2, wherein, The product comprises a reagent or a kit.
5. A product for evaluating environmental safety of a transgenic plant, characterized by, The product comprises a dsRNA; the dsRNA comprises dsDiap1 and / or dsSnf7. The nucleic acid sequence of the dsDiap1 is shown as SEQ ID NO.
10. The nucleic acid sequence of the dsSnf7 is shown as SEQ ID NO.
9.
6. The product of claim 5, wherein, The product comprises a reagent or a kit.
7. Use of dsRNA in the evaluation or detection of a product of RNAi technology, characterized in that, The dsRNA comprises dsDiap1 and / or dsSnf7; the RNAi technology product comprises an RNAi plant and an RNA pesticide. The nucleic acid sequence of the dsDiap1 is shown as SEQ ID NO.
10. The nucleic acid sequence of the dsSnf7 is shown as SEQ ID NO.
9.
8. A method for evaluating the safety of an RNAi technology product to the non-target organism H. axyridis using dsRNA, characterized in that, The steps comprise counting the survival rate of the Harmonia axyridis larvae after treating the Harmonia axyridis larvae with the dsRNA, and performing significant difference analysis; the RNAi technology product comprises an RNAi plant and an RNA pesticide. The dsRNA comprises dsDiap1 and / or dsSnf7. The nucleic acid sequence of the dsDiap1 is shown as SEQ ID NO.
10. The nucleic acid sequence of the dsSnf7 is shown as SEQ ID NO.
9.
9. The method of claim 8, wherein, The treatment mode comprises feeding or injection.
10. The method of claim 8, wherein, The time for counting the survival rate of the Harmonia axyridis larvae is 0h, 12h, 24h, 36h, 48h, 60h, 72h, 84h and 96h after treating the Harmonia axyridis larvae with the dsRNA.